>dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds
          Length = 1285

 Score =  174 bits (88), Expect = 4e-41
 Identities = 101/105 (96%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                        
Query: 14   aacaggcgacgctgccggcangnacacacaccgaggagagacggcagatttgagaactat 73
            |||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||
Sbjct: 1144 aacaggcgacgctgccggcaggcacacacaccgaggagagacggcagatttgagaactat 1085

                                                         
Query: 74   tacagcgtgcgcggccgagacacgatncacg-tacgcgcgcacca 117
            |||||||||||||||||||||||||| |||| |||||||||||||
Sbjct: 1084 tacagcgtgcgcggccgagacacgatccacgttacgcgcgcacca 1040

>gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, complete cds
          Length = 1248

 Score = 46.1 bits (23), Expect = 0.022
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                             
Query: 21   gacgctgccggcangnacacacaccgaggagag 53
            ||||||| ||||| | |||||||||||||||||
Sbjct: 1111 gacgctgtcggcaggcacacacaccgaggagag 1079

>gb|AC167201.6| Mus musculus 10 BAC RP23-402J11 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 216676

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    cagatttgagaactattaca 77
             ||||||||||||||||||||
Sbjct: 46344 cagatttgagaactattaca 46325

>gb|AC160029.3| Mus musculus 10 BAC RP24-105I7 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 184696

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    cagatttgagaactattaca 77
             ||||||||||||||||||||
Sbjct: 18168 cagatttgagaactattaca 18187

>ref|XM_655149.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN2637.2), mRNA
          Length = 1023

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 45  cgaggagagacggcagatt 63
           |||||||||||||||||||
Sbjct: 912 cgaggagagacggcagatt 930

>emb|AL592114.13| Human DNA sequence from clone RP11-203F10 on chromosome 1 Contains the 5'
              end of the REN gene for renin, the KISS1 gene for KiSS-1
              metastasis-suppressor, a novel gene (FLJ42654), the 3' end
              of the gene for phosphoinositol 3-phosphate-binding
              protein-3 (PEPP3) and  a novel gene, complete sequence
          Length = 189023

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 57     gcagatttgagaactatta 75
              |||||||||||||||||||
Sbjct: 109603 gcagatttgagaactatta 109585

>emb|AL355351.18| Human DNA sequence from clone RP11-337M11 on chromosome 6, complete
             sequence
          Length = 42047

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 56    ggcagatttgagaactatt 74
             |||||||||||||||||||
Sbjct: 24615 ggcagatttgagaactatt 24633

>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence
          Length = 3809201

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 14      aacaggcgacgctgccggc 32
               |||||||||||||||||||
Sbjct: 1380460 aacaggcgacgctgccggc 1380478


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 382,164
Number of Sequences: 3902068
Number of extensions: 382164
Number of successful extensions: 24357
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 24264
Number of HSP's gapped (non-prelim): 92
length of query: 119
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 98
effective length of database: 17,151,101,840
effective search space: 1680807980320
effective search space used: 1680807980320
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)