ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal37k20
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AJ511346.1|HVU511346 Hordeum vulgare subsp. vulgare partial ... 377 e-101
2gb|AF470355.1| Triticum aestivum metallothionein mRNA, partial cds 204 2e-49
3gb|AF498268.1| Haynaldia villosa clone kong28 mRNA 192 6e-46
4gb|AF246982.1| Poa secunda metallothionein-like protein type 2 m... 100 6e-18
5gb|DQ427657.1| Sorghum propinquum locus HHU61 genomic sequence 96 1e-16
6gb|DQ427655.1| Sorghum bicolor voucher PI267539 locus HHU61 geno... 96 1e-16
7gb|DQ427654.1| Sorghum bicolor voucher PI267408 locus HHU61 geno... 96 1e-16
8gb|DQ427653.1| Sorghum bicolor voucher PI221607 locus HHU61 geno... 96 1e-16
9gb|DQ427652.1| Sorghum bicolor voucher PI152702 locus HHU61 geno... 96 1e-16
10gb|DQ427651.1| Sorghum bicolor voucher NSL92371 locus HHU61 geno... 96 1e-16
11gb|DQ427649.1| Sorghum bicolor voucher NSL87666 locus HHU61 geno... 96 1e-16
12gb|DQ427648.1| Sorghum bicolor voucher NSL77217 locus HHU61 geno... 96 1e-16
13gb|DQ427647.1| Sorghum bicolor voucher NSL77034 locus HHU61 geno... 96 1e-16
14gb|DQ427644.1| Sorghum bicolor voucher NSL55243 locus HHU61 geno... 96 1e-16
15gb|DQ427642.1| Sorghum bicolor voucher NSL51030 locus HHU61 geno... 96 1e-16
16gb|DQ427641.1| Sorghum bicolor voucher NSL50875 locus HHU61 geno... 96 1e-16
17gb|DQ427640.1| Sorghum bicolor voucher BTx623 locus HHU61 genomi... 96 1e-16
18gb|DQ427361.1| Sorghum propinquum locus CDSR091 genomic sequence 96 1e-16
19gb|DQ427358.1| Sorghum bicolor voucher PI267408 locus CDSR091 ge... 96 1e-16
20gb|DQ427357.1| Sorghum bicolor voucher PI221607 locus CDSR091 ge... 96 1e-16
21gb|DQ427356.1| Sorghum bicolor voucher PI152702 locus CDSR091 ge... 96 1e-16
22gb|DQ427355.1| Sorghum bicolor voucher NSL92371 locus CDSR091 ge... 96 1e-16
23gb|DQ427353.1| Sorghum bicolor voucher NSL87666 locus CDSR091 ge... 96 1e-16
24gb|DQ427352.1| Sorghum bicolor voucher NSL77217 locus CDSR091 ge... 96 1e-16
25gb|DQ427351.1| Sorghum bicolor voucher NSL77034 locus CDSR091 ge... 96 1e-16
26gb|DQ427348.1| Sorghum bicolor voucher NSL55243 locus CDSR091 ge... 96 1e-16
27gb|DQ427346.1| Sorghum bicolor voucher NSL51030 locus CDSR091 ge... 96 1e-16
28gb|DQ427345.1| Sorghum bicolor voucher NSL50875 locus CDSR091 ge... 96 1e-16
29gb|DQ427344.1| Sorghum bicolor voucher BTx623 locus CDSR091 geno... 96 1e-16
30gb|AY574281.1| Cynodon dactylon metallothionein-like protein mRN... 94 4e-16
31gb|DQ427656.1| Sorghum bicolor voucher PI585454 locus HHU61 geno... 88 2e-14
32gb|DQ427650.1| Sorghum bicolor voucher NSL87902 locus HHU61 geno... 88 2e-14
33gb|DQ427646.1| Sorghum bicolor voucher NSL56174 locus HHU61 geno... 88 2e-14
34gb|DQ427645.1| Sorghum bicolor voucher NSL56003 locus HHU61 geno... 88 2e-14
35gb|DQ427643.1| Sorghum bicolor voucher NSL51365 locus HHU61 geno... 88 2e-14
36gb|DQ427360.1| Sorghum bicolor voucher PI585454 locus CDSR091 ge... 88 2e-14
37gb|DQ427359.1| Sorghum bicolor voucher PI267539 locus CDSR091 ge... 88 2e-14
38gb|DQ427354.1| Sorghum bicolor voucher NSL87902 locus CDSR091 ge... 88 2e-14
39gb|DQ427350.1| Sorghum bicolor voucher NSL56174 locus CDSR091 ge... 88 2e-14
40gb|DQ427349.1| Sorghum bicolor voucher NSL56003 locus CDSR091 ge... 88 2e-14
41gb|DQ427347.1| Sorghum bicolor voucher NSL51365 locus CDSR091 ge... 88 2e-14
42gb|AY781898.1| Saccharum hybrid cultivar isolate c18 metallothio... 82 2e-12
43dbj|AP004490.1| Lotus japonicus genomic DNA, chromosome 3, clone... 76 9e-11
44dbj|AB176567.1| Lablab purpureus MET mRNA for type 2 metallothio... 74 4e-10
45dbj|AB176559.1| Glycine max MET mRNA for type 2 metallothionein,... 74 4e-10
46gb|AY463024.1| Musa acuminata metallothionein-like protein mRNA,... 72 1e-09
47gb|AF268392.1| Musa acuminata metallothionein-like protein (MWMT... 72 1e-09
48gb|AF001525.1|AF001525 Musa acuminata ripening-associated protei... 72 1e-09
49emb|AJ843994.1| Plantago major mRNA for metallothionein 2 (mt2 g... 70 6e-09
50emb|AJ247196.1|ECR247196 Eichhornia crassipes MT1 gene for metal... 68 2e-08
51emb|AJ006700.1|ZMA6700 Zea mays mRNA for anther specific protein... 68 2e-08
52gb|AY109343.1| Zea mays CL1155_3 mRNA sequence 68 2e-08
53gb|DQ097731.1| Arachis hypogaea metallothionein-like protein mRN... 66 9e-08
54gb|AF333385.1|AF333385 Avicennia marina class I type 2 metalloth... 66 9e-08
55gb|AF201384.1|AF201384 Petunia x hybrida putative metallothionei... 66 9e-08
56gb|AF078912.1|AF078912 Mesembryanthemum crystallinum clone R6-R8... 66 9e-08
57gb|AF000935.1|AF000935 Mesembryanthemum crystallinum metallothio... 66 9e-08
58gb|AY109353.1| Zea mays CL1155_2 mRNA sequence 64 4e-07
59gb|DQ222401.1| Arachis hypogaea type 2 metallothionein (MT2b) ge... 62 1e-06
60gb|BT016341.1| Zea mays clone Contig174 mRNA sequence 62 1e-06
61gb|AY594297.1| Populus balsamifera subsp. trichocarpa x Populus ... 62 1e-06
62gb|DQ178618.1| Arachis hypogaea type 2 metallothionein (MT2c) mR... 62 1e-06
63gb|DQ178617.1| Arachis hypogaea type 2 metallothionein (MT2b) mR... 62 1e-06
64gb|DQ178616.1| Arachis hypogaea type 2 metallothionein (MT2a) mR... 62 1e-06
65gb|DQ442271.1| Camellia sinensis metallothionin 2 mRNA, complete... 62 1e-06
66gb|DQ097730.1| Arachis hypogaea type 2 metallothionein mRNA, com... 62 1e-06
67gb|AF268391.1| Musa acuminata metallothionein-like protein (MWMT... 62 1e-06
68ref|NM_184376.1| Oryza sativa (japonica cultivar-group), mRNA 60 6e-06
69dbj|AB175925.1| Oryza rufipogon met6 gene for metallothionein, c... 60 6e-06
70dbj|AB175924.1| Oryza rufipogon met6 gene for metallothionein, c... 60 6e-06
71dbj|AB175923.1| Oryza rufipogon met6 gene for metallothionein, c... 60 6e-06
72dbj|AB175922.1| Oryza rufipogon met6 gene for metallothionein, c... 60 6e-06
73dbj|AB175921.1| Oryza rufipogon met6 gene for metallothionein, c... 60 6e-06
74dbj|AB175920.1| Oryza rufipogon met6 gene for metallothionein, c... 60 6e-06
75dbj|AB175919.1| Oryza rufipogon met6 gene for metallothionein, c... 60 6e-06
76dbj|AB175918.1| Oryza rufipogon met6 gene for metallothionein, c... 60 6e-06
77dbj|AB175917.1| Oryza rufipogon met6 gene for metallothionein, c... 60 6e-06
78dbj|AB175916.1| Oryza rufipogon met6 gene for metallothionein, c... 60 6e-06
79dbj|AB175915.1| Oryza rufipogon met6 gene for metallothionein, c... 60 6e-06
80dbj|AB175914.1| Oryza rufipogon met6 gene for metallothionein, c... 60 6e-06
81dbj|AB175913.1| Oryza rufipogon met6 gene for metallothionein, c... 60 6e-06
82dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 60 6e-06
83dbj|AP002540.2| Oryza sativa (japonica cultivar-group) genomic D... 60 6e-06
84emb|AJ417527.1|OSA417527 Oryza sativa partial mRNA for putative ... 60 6e-06
85emb|AJ247090.1|ECR247090 Eichhornia crassipes MT1 gene for metal... 60 6e-06
86emb|AJ010162.1|ECR010162 Eichhornia crassipes mRNA for metalloth... 60 6e-06
87emb|AJ010161.1|ECR010161 Eichhornia crassipes mRNA for metalloth... 60 6e-06
88emb|AJ010160.1|ECR010160 Eichhornia crassipes mRNA for metalloth... 60 6e-06
89dbj|AK069318.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 6e-06
90dbj|D89931.1| Oryza sativa DNA for metallothionein-like protein,... 60 6e-06
91gb|U43530.1|OSU43530 Oryza sativa metallothionein-like type 2 (O... 60 6e-06
92gb|AY486002.1| Thlaspi caerulescens metallothionein-like mRNA, p... 58 2e-05
93emb|Z34269.1|HVBKACPS4 H.vulgare (pMaW25) mRNA for beta-ketoacyl... 58 2e-05
94emb|Y10850.1|BJY10850 Brassica juncea mRNA for metallothionein-l... 58 2e-05
95emb|AJ879116.1| Capsicum chinense mRNA for metallothionein-like ... 58 2e-05
96gb|DQ132853.1| Nicotiana tabacum metallothionein-like protein mR... 58 2e-05
97gb|AF200712.1|AF200712 Brassica oleracea cultivar Green King met... 58 2e-05
98dbj|AB176561.1| Vigna angularis MET mRNA for type 2 metallothion... 58 2e-05
99dbj|AB176557.1| Vigna radiata var. radiata MET mRNA for type 2 m... 58 2e-05
100emb|AJ511345.1|HVU511345 Hordeum vulgare subsp. vulgare mRNA for... 58 2e-05
101emb|Z68138.1|LEMT1 L.esculentum mRNA for metallothionein-like pr... 58 2e-05
102gb|L31940.1|BNABIF98 Brassica campestris L. ssp pekinensis (clon... 58 2e-05
103dbj|D78498.1| Brassica rapa mRNA for metallothionein-like protei... 58 2e-05
104dbj|D78491.1| Brassica rapa mRNA for metallothionein-like protei... 58 2e-05
105gb|AY566693.1| Xerophyta humilis clone HC27 metallothionein mRNA... 56 9e-05
106emb|AJ247195.1|ECR247195 Eichhornia crassipes MT1 gene for metal... 56 9e-05
107gb|U61973.1|MDU61973 Malus domestica metallothionein-like protei... 56 9e-05
108ref|NM_111773.3| Arabidopsis thaliana MT2A (METALLOTHIONEIN 2A) ... 54 3e-04
109gb|AY170656.1| Silene paradoxa pop-variant CM metallothionein (M... 54 3e-04
110gb|AY170655.1| Silene paradoxa pop-variant CV metallothionein (M... 54 3e-04
111gb|AY170654.1| Silene paradoxa pop-variant PO metallothionein (M... 54 3e-04
112gb|AY170653.1| Silene paradoxa pop-variant PS metallothionein (M... 54 3e-04
113gb|AY170652.1| Silene paradoxa pop-variant FE metallothionein (M... 54 3e-04
114gb|AY277667.1| Malus x domestica metallothionein-like protein mR... 54 3e-04
115gb|AY077669.1| Arabidopsis thaliana AT3g09390/F3L24_28 mRNA, com... 54 3e-04
116gb|AF101825.1|AF101825 Silene vulgaris metallothionein mRNA, com... 54 3e-04
117gb|AY037263.1| Arabidopsis thaliana AT3g09390/F3L24_28 mRNA, com... 54 3e-04
118gb|AF268027.1|AF268027 Amaranthus cruentus metallothionein mRNA,... 54 3e-04
119emb|BX822943.1|CNS0A7AD Arabidopsis thaliana Full-length cDNA Co... 54 3e-04
120emb|BX842226.1|CNS09YEG Arabidopsis thaliana Full-length cDNA Co... 54 3e-04
121gb|AF257465.1|AF257465 Porteresia coarctata metallothionein mRNA... 54 3e-04
122emb|AJ277599.2|QSU277599 Quercus suber mRNA for metallothionein-... 54 3e-04
123emb|X62818.1|ATATMT1 A.thaliana AtMT-1 mRNA for metallothionein-... 54 3e-04
124emb|AJ243532.1|PPE243532 Prunus persica mRNA for metallothionein... 54 3e-04
125gb|U15108.1|ATU15108 Arabidopsis thaliana metallothionein-like p... 54 3e-04
126gb|DQ023294.1| Avicennia germinans class I type 2 metallothionei... 52 0.001
127gb|AF334141.1|AF334141 Avicennia marina class I type 2 metalloth... 52 0.001
128gb|AF329968.1|AF329968 Avicennia marina class I type 2 metalloth... 52 0.001
129dbj|AB176565.1| Pisum sativum MET mRNA for type 2 metallothionei... 52 0.001
130gb|AY833717.1| Codonopsis lanceolata metallothionein-like protei... 50 0.005
131emb|X68600.1|HVPZE40 H. vulgare pZE40 gene 50 0.005
132emb|X95709.1|CANMT2MET C.arietinum mRNA for class I type 2 metal... 50 0.005
133gb|AY962830.1| Prunus armeniaca metallothionein-like protein mRN... 50 0.005
134gb|AY578087.1| Prunus armeniaca metallothionein-like protein mRN... 50 0.005
135dbj|AB126057.1| Codonopsis lanceolata mRNA for metallothionein 2... 50 0.005
136emb|AJ309387.1|ABE309387 Atropa belladonna mRNA for putative met... 50 0.005
137gb|U97494.1|PAU97494 Prunus armeniaca metallothionein-like prote... 50 0.005
138ref|NM_188286.1| Oryza sativa (japonica cultivar-group), predic... 48 0.021
139gb|AY389559.1| Hyacinthus orientalis metallothionein-like protei... 48 0.021
140dbj|AB175808.1| Oryza barthii met2 gene for metallothionein, com... 48 0.021
141dbj|AB175807.1| Oryza rufipogon met2 gene for metallothionein, c... 48 0.021
142dbj|AB175806.1| Oryza rufipogon met2 gene for metallothionein, c... 48 0.021
143dbj|AB175805.1| Oryza rufipogon met2 gene for metallothionein, c... 48 0.021
144dbj|AB175804.1| Oryza rufipogon met2 gene for metallothionein, c... 48 0.021
145dbj|AB175803.1| Oryza rufipogon met2 gene for metallothionein, c... 48 0.021
146dbj|AB175802.1| Oryza rufipogon met2 gene for metallothionein, c... 48 0.021
147dbj|AB175801.1| Oryza rufipogon met2 gene for metallothionein, c... 48 0.021
148dbj|AB175800.1| Oryza rufipogon met2 gene for metallothionein, c... 48 0.021
149dbj|AB175799.1| Oryza rufipogon met2 gene for metallothionein, c... 48 0.021
150dbj|AB175798.1| Oryza rufipogon met2 gene for metallothionein, c... 48 0.021
151dbj|AB175797.1| Oryza rufipogon met2 gene for metallothionein, c... 48 0.021
152gb|L77966.1|TOMMTB Lycopersicon esculentum metallothionein II-li... 48 0.021
153emb|BX823125.1|CNS0A703 Arabidopsis thaliana Full-length cDNA Co... 48 0.021
154dbj|AP003197.4| Oryza sativa (japonica cultivar-group) genomic D... 48 0.021
155dbj|AK120350.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.021
156emb|Z26492.1|TRMT1AMR T.repens TrMT1A mRNA for metallothionein-l... 48 0.021
157emb|AJ297968.1|ABE297968 Atropa belladonna mRNA for methallothio... 48 0.021
158gb|AF147786.1|AF147786 Oryza sativa metallothionein-like protein... 48 0.021
159dbj|AK058313.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.021
160gb|AF001396.1|OSAF001396 Oryza sativa metallothionein-like prote... 48 0.021
161ref|NM_120316.1| Arabidopsis thaliana MT2B (METALLOTHIONEIN 2B) ... 46 0.084
162gb|AF339712.1| Arabidopsis thaliana putative metallothionein 2b ... 46 0.084
163gb|AF324665.2| Arabidopsis thaliana AT5g02380 (AT5g02380/T1E22_1... 46 0.084
164emb|BX830194.1|CNS0A1F2 Arabidopsis thaliana Full-length cDNA Co... 46 0.084
165emb|BX829647.1|CNS0A1H4 Arabidopsis thaliana Full-length cDNA Co... 46 0.084
166emb|BX833573.1|CNS0A0MR Arabidopsis thaliana Full-length cDNA Co... 46 0.084
167gb|BT004570.1| Arabidopsis thaliana At5g02380 gene, complete cds 46 0.084
168gb|AY101566.1| Sparganophilus tamesis 28S ribosomal RNA gene, pa... 46 0.084
169emb|AJ130886.1|FSY130886 Fagus sylvatica mRNA for metallothionei... 46 0.084
170gb|AY833008.1| Oryza officinalis metallothionein-like protein (M... 46 0.084
171gb|L02306.1|RCCMETAL Ricinus communis metallothionein (RCMIT) mR... 46 0.084
172gb|CP000027.1| Dehalococcoides ethenogenes 195, complete genome 44 0.33
173gb|BT017417.1| Zea mays clone EL01N0401C05.c mRNA sequence 44 0.33
174ref|XM_361587.1| Magnaporthe grisea 70-15 hypothetical protein (... 44 0.33
175dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.33
176dbj|AP005124.5| Oryza sativa (japonica cultivar-group) genomic D... 44 0.33
177dbj|AP003743.4| Oryza sativa (japonica cultivar-group) genomic D... 44 0.33
178dbj|AB176563.1| Vicia faba MET mRNA for type 2 metallothionein, ... 44 0.33
179emb|X77254.1|VFMTIRNA V.faba MTI mRNA 44 0.33
180emb|Z68309.1|LEMEPT512 L.esculentum mRNA for Metallothionein-lik... 44 0.33
181gb|AF136924.1|AF136924 Fragaria x ananassa metallothionein-like ... 44 0.33
182gb|AF389451.1| Tiger frog virus, complete genome 44 0.33
183gb|AY667624.1| Gossypium hirsutum metallothionein-like protein (... 44 0.33
184gb|L47746.1|PIAEMB30R Picea glauca metallothionein-like protein ... 42 1.3
185dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 42 1.3
186gb|AC153918.4| Mus musculus BAC RP23-89M16 (Roswell Park Cancer... 42 1.3
187dbj|AK104075.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.3
188emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid compl... 42 1.3
189dbj|AK062796.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.3
190emb|AJ555613.1|HVU555613 Hordeum vulgare subsp. vulgare mRNA for... 42 1.3
191gb|AC135861.5| Mus musculus BAC clone RP23-179J18 from 6, comple... 42 1.3
192emb|Z14124.1|SSAPOAIG S.scrofa apoAI gene 42 1.3
193gb|L00626.1|PIGAPAI Pig apolipoprotein A-1 gene, complete cds 42 1.3
194dbj|AB002820.1| Oryza sativa mRNA for RicMT, complete cds 42 1.3
195emb|AJ309103.1|PPI309103 Pinus pinaster partial mRNA for putativ... 42 1.3
196ref|NM_188514.1| Oryza sativa (japonica cultivar-group), Ozsa818... 40 5.2
197ref|XM_468477.1| Oryza sativa (japonica cultivar-group), mRNA 40 5.2
198ref|XM_464392.1| Oryza sativa (japonica cultivar-group), mRNA 40 5.2
199ref|XM_463738.1| Oryza sativa (japonica cultivar-group), predic... 40 5.2
200gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, comp... 40 5.2
201gb|AY389609.1| Hyacinthus orientalis unknown mRNA 40 5.2
202gb|AY389604.1| Hyacinthus orientalis type 2 metallothionein-like... 40 5.2
203gb|AY389576.1| Hyacinthus orientalis metallothionein 2 (MT2) mRN... 40 5.2
204ref|XM_324215.1| Neurospora crassa OR74A hypothetical protein (N... 40 5.2
205ref|XM_954023.1| Neurospora crassa OR74A hypothetical protein (N... 40 5.2
206gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com... 40 5.2
207gb|BT012848.1| Lycopersicon esculentum clone 113926R, mRNA sequence 40 5.2
208gb|AF540910.1| Foot-and-mouth disease virus SAT 2 clone ZIM/7/83... 40 5.2
209gb|AC011436.7|ATAC011436 Arabidopsis thaliana chromosome III BAC... 40 5.2
210gb|AC115119.5| Mus musculus BAC clone RP23-87M19 from 18, comple... 40 5.2
211gb|AC122027.1| Mus musculus BAC clone RP24-390L20 from 1, comple... 40 5.2
212gb|AY370020.1| Trichoderma viride strain YNUCC0183 endo-1,4-beta... 40 5.2
213gb|AY320048.1| Trichoderma viride strain YNUCC0183 endo-1,4-beta... 40 5.2
214emb|AL034550.31|HS1184F4 Human DNA sequence from clone RP5-1184F... 40 5.2
215emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos... 40 5.2
216emb|AL939108.1|SCO939108 Streptomyces coelicolor A3(2) complete ... 40 5.2
217emb|AL731595.1|OSJN00238 Oryza sativa genomic DNA, chromosome 4,... 40 5.2
218emb|AL162874.1|ATT1E22 Arabidopsis thaliana DNA chromosome 5, BA... 40 5.2
219emb|AJ289860.2|LFL289860 Lampetra fluviatilis partial mRNA for k... 40 5.2
220emb|AJ843996.1| Plantago major mRNA for metallothionein 4 (mt4 g... 40 5.2
221emb|AJ843993.1| Plantago major mRNA for metallothionein 1 (mt1 g... 40 5.2
222emb|BX571771.5| Zebrafish DNA sequence from clone CH211-160F8 in... 40 5.2
223gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 40 5.2
224emb|AL954696.17| Zebrafish DNA sequence from clone CH211-234K4, ... 40 5.2
225emb|BX323849.10| Zebrafish DNA sequence from clone DKEY-107K2 in... 40 5.2
226gb|AE005792.1| Caulobacter crescentus CB15 section 118 of 359 of... 40 5.2
227gb|AE005987.1| Caulobacter crescentus CB15 section 313 of 359 of... 40 5.2
228tpg|BK002407.1| TPA: TPA_inf: Drosophila melanogaster HDC12548 (... 40 5.2
229gb|CP000133.1| Rhizobium etli CFN 42, complete genome 40 5.2
230dbj|AB175912.1| Oryza barthii met5 gene for metallothionein, com... 40 5.2
231dbj|AB175911.1| Oryza rufipogon met5 gene for metallothionein, c... 40 5.2
232dbj|AB175910.1| Oryza rufipogon met5 gene for metallothionein, c... 40 5.2
233dbj|AB175909.1| Oryza rufipogon met5 gene for metallothionein, c... 40 5.2
234dbj|AB175908.1| Oryza rufipogon met5 gene for metallothionein, c... 40 5.2
235dbj|AB175907.1| Oryza rufipogon met5 gene for metallothionein, c... 40 5.2
236dbj|AB175906.1| Oryza rufipogon met5 gene for metallothionein, c... 40 5.2
237dbj|AB175905.1| Oryza rufipogon met5 gene for metallothionein, c... 40 5.2
238dbj|AB175904.1| Oryza rufipogon met5 gene for metallothionein, c... 40 5.2
239dbj|AB175903.1| Oryza rufipogon met5 gene for metallothionein, c... 40 5.2
240dbj|AB175902.1| Oryza rufipogon met5 gene for metallothioneein, ... 40 5.2
241dbj|AB175901.1| Oryza rufipogon met5 gene for metallothionein, c... 40 5.2
242dbj|AB175900.1| Oryza rufipogon met5 gene for metallothionein, c... 40 5.2
243dbj|AB175899.1| Oryza rufipogon met5 gene for metallothionein, c... 40 5.2
244dbj|AB175898.1| Oryza rufipogon met5 gene for metallothionein, c... 40 5.2
245dbj|AB175897.1| Oryza rufipogon met5 gene for metallothionein, c... 40 5.2
246dbj|AB175896.1| Oryza rufipogon met5 gene for metallothionein, c... 40 5.2
247gb|AF322486.1|AF322486 Cryptocercus punctulatus 5.8S ribosomal R... 40 5.2
248gb|AC009512.6| Drosophila melanogaster, chromosome 3R, region 85... 40 5.2
249gb|AC146538.2| Gasterosteus aculeatus clone CH213-118G22, comple... 40 5.2
250dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.2
251dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.2
252dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.2
253gb|AC142247.2| Homo sapiens chromosome 17, clone XXfos-85526C9, ... 40 5.2
254emb|AL731622.1|OSJN00265 Oryza sativa genomic DNA, chromosome 4,... 40 5.2
255emb|BX822408.1|CNS0A768 Arabidopsis thaliana Full-length cDNA Co... 40 5.2
256gb|AC008314.7|AC008314 Drosophila melanogaster, chromosome 3R, r... 40 5.2
257dbj|AB193157.1| Ipomoea batatas mt2k mRNA for metallothionein-li... 40 5.2
258gb|AC026423.9| Homo sapiens chromosome 16 clone CTD-2169M19, com... 40 5.2
259dbj|AP003735.4| Oryza sativa (japonica cultivar-group) genomic D... 40 5.2
260dbj|AP003298.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.2
261dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.2
262gb|AY085738.1| Arabidopsis thaliana clone 17539 mRNA, complete s... 40 5.2
263gb|AC055858.18| Homo sapiens chromosome 17, clone RP11-682M7, co... 40 5.2
264dbj|AP001800.2| Oryza sativa (japonica cultivar-group) genomic D... 40 5.2
265gb|AY156910.1| Trichoderma sp. SY xylanase mRNA, complete cds 40 5.2
266gb|AC027824.17| Homo sapiens chromosome 17, clone RP11-762A9, co... 40 5.2
267dbj|AB041032.1| Oryza sativa gene for metallothionein-like prote... 40 5.2
268dbj|AP004046.2| Oryza sativa (japonica cultivar-group) genomic D... 40 5.2
269dbj|AP003520.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.2
270dbj|AP004734.2| Oryza sativa (japonica cultivar-group) genomic D... 40 5.2
271dbj|AP003989.4| Oryza sativa (japonica cultivar-group) genomic D... 40 5.2
272dbj|D11394.1|ATHMTLP A. thaliana gene for metallothionein-like p... 40 5.2
273emb|Z68185.1|LEMT2MR L.esculentum mRNA for metallothionein-like ... 40 5.2
274gb|AF215719.1|AF215719 Pongo pygmaeus transitional protein 2 (TN... 40 5.2
275dbj|AK103445.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.2
276dbj|AK072778.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.2
277dbj|AK068502.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.2
278dbj|AK065566.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.2
279gb|AC147219.5| Mus musculus BAC clone RP23-37K18 from 18, comple... 40 5.2
280gb|AY106923.1| Zea mays PCO133385 mRNA sequence 40 5.2
281gb|AE003680.4| Drosophila melanogaster chromosome 3R, section 18... 40 5.2
282gb|AF017365.1|AF017365 Oryza sativa metallothionein-like protein... 40 5.2
283emb|AJ577263.1|QRO577263 Quercus robur partial mRNA for metallot... 40 5.2
284gb|AF091514.1|AF091514 Elaeagnus umbellata metallothionein homol... 40 5.2
285emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome 40 5.2
286emb|BX000434.11| Zebrafish DNA sequence from clone CH211-2E18, c... 40 5.2
287gb|AC140840.3| Mus musculus BAC clone RP24-545K17 from 13, compl... 40 5.2
288gb|U11256.1|ATU11256 Arabidopsis thaliana Columbia ecotype metal... 40 5.2
289dbj|AB021785.1| Pyrus pyrifolia PPFRU8 mRNA for metallothionein-... 40 5.2

>emb|AJ511346.1|HVU511346 Hordeum vulgare subsp. vulgare partial mRNA for metallothioneine
           type2 (mt2b gene)
          Length = 241

 Score =  377 bits (190), Expect = e-101
 Identities = 199/202 (98%)
 Strand = Plus / Minus

                                                                       
Query: 186 tgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctcggcgg 245
           ||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 tgcagatgcatgggttgcaggtgcagttggggccgcacttgcacccgccgttctcggcgg 182

                                                                       
Query: 246 cggcggcctcgaacgagggcccgttgcccttggaggacgccactcccatgacgagggcct 305
           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 181 cggcggcctcgaacgagggcccgttgcccttggagggcgccactcccatgacgagggcct 122

                                                                       
Query: 306 gggaggaggtggcggtggtgctcaccccctcgtccatcccagggtacatcttgcaccctc 365
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 gggaggaggtggcggtggtgctcaccccctcgtccatcccagggtacatcttgcaccctc 62

                                 
Query: 366 cgcagccgttgccgcacttgca 387
           ||||||||||||||||||||||
Sbjct: 61  cgcagccgttgccgcacttgca 40



to top

>gb|AF470355.1| Triticum aestivum metallothionein mRNA, partial cds
          Length = 345

 Score =  204 bits (103), Expect = 2e-49
 Identities = 181/207 (87%), Gaps = 15/207 (7%)
 Strand = Plus / Minus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           |||||||||||||||||||||||||| ||||||||||||||||||||| || ||||||||
Sbjct: 345 tcacttgcaggtgcacgggttgcaggagcagttggggccgcacttgcatcctccgttctc 286

                                                                       
Query: 241 ggcggcggcggcctcgaacgagggcccgttgcccttggaggacgccactcccatgacgag 300
           |||||||||   ||||||||| ||   | |||||||||||| |||||| ||||||| |||
Sbjct: 285 ggcggcggc---ctcgaacgacgg---ggtgcccttggagggcgccacgcccatgatgag 232

                                                                       
Query: 301 ggcctgggaggaggtggcggtggtgctcaccccctcgtccatcccagggtacatcttgca 360
           || |||||||         |||||| ||||||||||||||||| ||||||||||||||||
Sbjct: 231 ggtctgggag---------gtggtgttcaccccctcgtccatctcagggtacatcttgca 181

                                      
Query: 361 ccctccgcagccgttgccgcacttgca 387
           |||||||||||||||||||||||||||
Sbjct: 180 ccctccgcagccgttgccgcacttgca 154



to top

>gb|AF498268.1| Haynaldia villosa clone kong28 mRNA
          Length = 1474

 Score =  192 bits (97), Expect = 6e-46
 Identities = 181/209 (86%), Gaps = 15/209 (7%)
 Strand = Plus / Plus

                                                                        
Query: 179  gatcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttc 238
            ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 1181 gatcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcaccctccgttc 1240

                                                                        
Query: 239  tcggcggcggcggcctcgaacgagggcccgttgcccttggaggacgccactcccatgacg 298
            |||||||||||   ||||||||| ||   | ||||||||||||  || || ||||||| |
Sbjct: 1241 tcggcggcggc---ctcgaacgacgg---ggtgcccttggagggggcaacgcccatgatg 1294

                                                                        
Query: 299  agggcctgggaggaggtggcggtggtgctcaccccctcgtccatcccagggtacatcttg 358
            |||| |||||||         | |||| |||| |||||||||||| ||||||||||||||
Sbjct: 1295 agggtctgggag---------gcggtgttcactccctcgtccatctcagggtacatcttg 1345

                                         
Query: 359  caccctccgcagccgttgccgcacttgca 387
            |||||||||||||||||||||||||||||
Sbjct: 1346 caccctccgcagccgttgccgcacttgca 1374



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 66/77 (85%), Gaps = 3/77 (3%)
 Strand = Plus / Plus

                                                                        
Query: 32   cgatagatcccgtcttattctagtaggtggcaattaaaaacgaaacacacactcgcgatt 91
            ||||||||| ||||||||||| |   ||||||||| |||||||||||||| || ||||||
Sbjct: 1047 cgatagatctcgtcttattctgg---gtggcaatttaaaacgaaacacacgcttgcgatt 1103

                             
Query: 92   catggatggctactact 108
            |||| ||  ||||||||
Sbjct: 1104 catgcataactactact 1120



to top

>gb|AF246982.1| Poa secunda metallothionein-like protein type 2 mRNA, complete cds
          Length = 615

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 62/66 (93%)
 Strand = Plus / Minus

                                                                       
Query: 322 ggtgctcaccccctcgtccatcccagggtacatcttgcaccctccgcagccgttgccgca 381
           |||| ||| |||||||||||| ||||||||||||||||| ||||||||||||||||||||
Sbjct: 177 ggtggtcaacccctcgtccatgccagggtacatcttgcatcctccgcagccgttgccgca 118

                 
Query: 382 cttgca 387
           ||||||
Sbjct: 117 cttgca 112



 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 59/64 (92%)
 Strand = Plus / Minus

                                                                       
Query: 180 atcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttct 239
           |||||||||||||||| ||||||||||||||||||  |||||||||||| || |||||||
Sbjct: 316 atcacttgcaggtgcaagggttgcaggtgcagttgtcgccgcacttgcagcctccgttct 257

               
Query: 240 cggc 243
           ||||
Sbjct: 256 cggc 253



to top

>gb|DQ427657.1| Sorghum propinquum locus HHU61 genomic sequence
          Length = 370

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 369 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccgtcgttctc 310



to top

>gb|DQ427655.1| Sorghum bicolor voucher PI267539 locus HHU61 genomic sequence
          Length = 347

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 346 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccgtcgttctc 287



to top

>gb|DQ427654.1| Sorghum bicolor voucher PI267408 locus HHU61 genomic sequence
          Length = 347

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 346 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccgtcgttctc 287



to top

>gb|DQ427653.1| Sorghum bicolor voucher PI221607 locus HHU61 genomic sequence
          Length = 347

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 346 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccgtcgttctc 287



to top

>gb|DQ427652.1| Sorghum bicolor voucher PI152702 locus HHU61 genomic sequence
          Length = 347

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 346 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccgtcgttctc 287



to top

>gb|DQ427651.1| Sorghum bicolor voucher NSL92371 locus HHU61 genomic sequence
          Length = 347

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 346 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccgtcgttctc 287



to top

>gb|DQ427649.1| Sorghum bicolor voucher NSL87666 locus HHU61 genomic sequence
          Length = 347

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 346 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccgtcgttctc 287



to top

>gb|DQ427648.1| Sorghum bicolor voucher NSL77217 locus HHU61 genomic sequence
          Length = 347

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 346 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccgtcgttctc 287



to top

>gb|DQ427647.1| Sorghum bicolor voucher NSL77034 locus HHU61 genomic sequence
          Length = 347

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 346 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccgtcgttctc 287



to top

>gb|DQ427644.1| Sorghum bicolor voucher NSL55243 locus HHU61 genomic sequence
          Length = 347

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 346 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccgtcgttctc 287



to top

>gb|DQ427642.1| Sorghum bicolor voucher NSL51030 locus HHU61 genomic sequence
          Length = 347

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 346 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccgtcgttctc 287



to top

>gb|DQ427641.1| Sorghum bicolor voucher NSL50875 locus HHU61 genomic sequence
          Length = 344

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 343 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccgtcgttctc 284



to top

>gb|DQ427640.1| Sorghum bicolor voucher BTx623 locus HHU61 genomic sequence
          Length = 347

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 346 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccgtcgttctc 287



to top

>gb|DQ427361.1| Sorghum propinquum locus CDSR091 genomic sequence
          Length = 707

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 57/60 (95%)
 Strand = Plus / Plus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 372 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccgtcgttctc 431



to top

>gb|DQ427358.1| Sorghum bicolor voucher PI267408 locus CDSR091 genomic sequence
          Length = 678

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 57/60 (95%)
 Strand = Plus / Plus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 352 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccgtcgttctc 411



to top

>gb|DQ427357.1| Sorghum bicolor voucher PI221607 locus CDSR091 genomic sequence
          Length = 678

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 57/60 (95%)
 Strand = Plus / Plus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 352 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccgtcgttctc 411



to top

>gb|DQ427356.1| Sorghum bicolor voucher PI152702 locus CDSR091 genomic sequence
          Length = 678

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 57/60 (95%)
 Strand = Plus / Plus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 352 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccgtcgttctc 411



to top

>gb|DQ427355.1| Sorghum bicolor voucher NSL92371 locus CDSR091 genomic sequence
          Length = 678

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 57/60 (95%)
 Strand = Plus / Plus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 352 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccgtcgttctc 411



to top

>gb|DQ427353.1| Sorghum bicolor voucher NSL87666 locus CDSR091 genomic sequence
          Length = 678

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 57/60 (95%)
 Strand = Plus / Plus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 352 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccgtcgttctc 411



to top

>gb|DQ427352.1| Sorghum bicolor voucher NSL77217 locus CDSR091 genomic sequence
          Length = 678

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 57/60 (95%)
 Strand = Plus / Plus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 352 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccgtcgttctc 411



to top

>gb|DQ427351.1| Sorghum bicolor voucher NSL77034 locus CDSR091 genomic sequence
          Length = 678

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 57/60 (95%)
 Strand = Plus / Plus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 352 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccgtcgttctc 411



to top

>gb|DQ427348.1| Sorghum bicolor voucher NSL55243 locus CDSR091 genomic sequence
          Length = 678

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 57/60 (95%)
 Strand = Plus / Plus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 352 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccgtcgttctc 411



to top

>gb|DQ427346.1| Sorghum bicolor voucher NSL51030 locus CDSR091 genomic sequence
          Length = 683

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 57/60 (95%)
 Strand = Plus / Plus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 357 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccgtcgttctc 416



to top

>gb|DQ427345.1| Sorghum bicolor voucher NSL50875 locus CDSR091 genomic sequence
          Length = 680

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 57/60 (95%)
 Strand = Plus / Plus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 357 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccgtcgttctc 416



to top

>gb|DQ427344.1| Sorghum bicolor voucher BTx623 locus CDSR091 genomic sequence
          Length = 678

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 57/60 (95%)
 Strand = Plus / Plus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 352 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccgtcgttctc 411



to top

>gb|AY574281.1| Cynodon dactylon metallothionein-like protein mRNA, complete cds
          Length = 678

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 68/75 (90%)
 Strand = Plus / Minus

                                                                       
Query: 313 ggtggcggtggtgctcaccccctcgtccatcccagggtacatcttgcaccctccgcagcc 372
           ||||||||||||| ||||| ||||| ||||  | ||||||||||||||||||||||||||
Sbjct: 192 ggtggcggtggtggtcacctcctcggccatgtccgggtacatcttgcaccctccgcagcc 133

                          
Query: 373 gttgccgcacttgca 387
           | |||||||||||||
Sbjct: 132 gctgccgcacttgca 118



 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 192 tgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctcggcggcggcgg 251
           |||| ||||||||| |||||||||||||||||||||| ||| ||||||| ||  |||| |
Sbjct: 310 tgcaggggttgcagctgcagttggggccgcacttgcaaccgtcgttctcagctccggcag 251

                   
Query: 252 cctcgaac 259
           ||||||||
Sbjct: 250 cctcgaac 243



to top

>gb|DQ427656.1| Sorghum bicolor voucher PI585454 locus HHU61 genomic sequence
          Length = 345

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||  |||||||
Sbjct: 344 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccttcgttctc 285



to top

>gb|DQ427650.1| Sorghum bicolor voucher NSL87902 locus HHU61 genomic sequence
          Length = 345

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||  |||||||
Sbjct: 344 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccttcgttctc 285



to top

>gb|DQ427646.1| Sorghum bicolor voucher NSL56174 locus HHU61 genomic sequence
          Length = 345

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||  |||||||
Sbjct: 344 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccttcgttctc 285



to top

>gb|DQ427645.1| Sorghum bicolor voucher NSL56003 locus HHU61 genomic sequence
          Length = 345

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||  |||||||
Sbjct: 344 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccttcgttctc 285



to top

>gb|DQ427643.1| Sorghum bicolor voucher NSL51365 locus HHU61 genomic sequence
          Length = 345

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||  |||||||
Sbjct: 344 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccttcgttctc 285



to top

>gb|DQ427360.1| Sorghum bicolor voucher PI585454 locus CDSR091 genomic sequence
          Length = 682

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 56/60 (93%)
 Strand = Plus / Plus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||  |||||||
Sbjct: 358 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccttcgttctc 417



to top

>gb|DQ427359.1| Sorghum bicolor voucher PI267539 locus CDSR091 genomic sequence
          Length = 679

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 56/60 (93%)
 Strand = Plus / Plus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||  |||||||
Sbjct: 355 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccttcgttctc 414



to top

>gb|DQ427354.1| Sorghum bicolor voucher NSL87902 locus CDSR091 genomic sequence
          Length = 679

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 56/60 (93%)
 Strand = Plus / Plus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||  |||||||
Sbjct: 355 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccttcgttctc 414



to top

>gb|DQ427350.1| Sorghum bicolor voucher NSL56174 locus CDSR091 genomic sequence
          Length = 679

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 56/60 (93%)
 Strand = Plus / Plus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||  |||||||
Sbjct: 355 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccttcgttctc 414



to top

>gb|DQ427349.1| Sorghum bicolor voucher NSL56003 locus CDSR091 genomic sequence
          Length = 679

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 56/60 (93%)
 Strand = Plus / Plus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||  |||||||
Sbjct: 355 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccttcgttctc 414



to top

>gb|DQ427347.1| Sorghum bicolor voucher NSL51365 locus CDSR091 genomic sequence
          Length = 679

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 56/60 (93%)
 Strand = Plus / Plus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| |||||||||||||||||||||||||  |||||||
Sbjct: 355 tcacttgcaggtgcaggggttgcagctgcagttggggccgcacttgcacccttcgttctc 414



to top

>gb|AY781898.1| Saccharum hybrid cultivar isolate c18 metallothionein-like protein
           mRNA, complete cds
          Length = 597

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 65/73 (89%)
 Strand = Plus / Minus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| ||||||||| ||||||||||||| |||||||| ||| |||||||
Sbjct: 246 tcacttgcaggtgcaggggttgcagctgcagttggggccacacttgcagccgtcgttctc 187

                        
Query: 241 ggcggcggcggcc 253
            ||  ||||||||
Sbjct: 186 agctccggcggcc 174



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 40/41 (97%)
 Strand = Plus / Minus

                                                    
Query: 347 gggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           ||||||||||||||||||||||||||| |||||||||||||
Sbjct: 80  gggtacatcttgcaccctccgcagccgctgccgcacttgca 40



to top

>dbj|AP004490.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT11G09, TM0022,
            complete sequence
          Length = 114576

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                        
Query: 181  tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
            ||||||||||||||| |||| |||||||||||| |  ||||||||||| || ||||||||
Sbjct: 4422 tcacttgcaggtgcaggggtcgcaggtgcagtttgatccgcacttgcagccaccgttctc 4363

                      
Query: 241  ggcggcggcg 250
             |||||||||
Sbjct: 4362 agcggcggcg 4353



to top

>dbj|AB176567.1| Lablab purpureus MET mRNA for type 2 metallothionein, complete cds
          Length = 673

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 40/41 (97%)
 Strand = Plus / Minus

                                                    
Query: 347 gggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||||||| ||||||||||||||||||||||||||
Sbjct: 173 gggtacatcttgcagcctccgcagccgttgccgcacttgca 133



to top

>dbj|AB176559.1| Glycine max MET mRNA for type 2 metallothionein, complete cds
          Length = 564

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 40/41 (97%)
 Strand = Plus / Minus

                                                    
Query: 347 gggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||||||| ||||||||||||||||||||||||||
Sbjct: 174 gggtacatcttgcagcctccgcagccgttgccgcacttgca 134



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagtt 213
           ||||||||| ||||| |||||||||||||||||
Sbjct: 334 tcacttgcaagtgcaggggttgcaggtgcagtt 302



to top

>gb|AY463024.1| Musa acuminata metallothionein-like protein mRNA, complete cds
          Length = 548

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 48/52 (92%)
 Strand = Plus / Minus

                                                               
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccg 232
           |||||||||| |||| |||| |||||||||||||| ||||||||||||||||
Sbjct: 303 tcacttgcagttgcaggggtcgcaggtgcagttggagccgcacttgcacccg 252



to top

>gb|AF268392.1| Musa acuminata metallothionein-like protein (MWMT2B) mRNA, complete
           cds
          Length = 570

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 48/52 (92%)
 Strand = Plus / Minus

                                                               
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccg 232
           |||||||||| |||| |||| |||||||||||||| ||||||||||||||||
Sbjct: 307 tcacttgcagttgcaggggtcgcaggtgcagttggagccgcacttgcacccg 256



to top

>gb|AF001525.1|AF001525 Musa acuminata ripening-associated protein mRNA, partial cds
          Length = 571

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 48/52 (92%)
 Strand = Plus / Minus

                                                               
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccg 232
           |||||||||| |||| |||| |||||||||||||| ||||||||||||||||
Sbjct: 298 tcacttgcagttgcaggggtcgcaggtgcagttggagccgcacttgcacccg 247



to top

>emb|AJ843994.1| Plantago major mRNA for metallothionein 2 (mt2 gene)
          Length = 596

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           ||||||||||||||||||||||||||||  |||||||||||||
Sbjct: 137 cagggtacatcttgcaccctccgcagccactgccgcacttgca 95



to top

>emb|AJ247196.1|ECR247196 Eichhornia crassipes MT1 gene for metallothionein, exons 1-33
           (clone E)
          Length = 711

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           |||||||||| |||| |||||||||||||||||||  ||||||||||| ||  |||||||
Sbjct: 488 tcacttgcagttgcaagggttgcaggtgcagttggatccgcacttgcagccttcgttctc 429

             
Query: 241 gg 242
           ||
Sbjct: 428 gg 427



to top

>emb|AJ006700.1|ZMA6700 Zea mays mRNA for anther specific protein, partial
          Length = 724

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 66/76 (86%), Gaps = 3/76 (3%)
 Strand = Plus / Minus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttgggg---ccgcacttgcacccgccgtt 237
           ||||||||||||||| |||| |||||||||| ||| |   ||||||||||||||||||||
Sbjct: 325 tcacttgcaggtgcaggggtcgcaggtgcagctggcggcgccgcacttgcacccgccgtt 266

                           
Query: 238 ctcggcggcggcggcc 253
           ||| ||  ||||||||
Sbjct: 265 ctcagctccggcggcc 250



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 347 gggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           ||||||||||||||||||||||| ||| |||||||||||||
Sbjct: 177 gggtacatcttgcaccctccgcacccgctgccgcacttgca 137



to top

>gb|AY109343.1| Zea mays CL1155_3 mRNA sequence
          Length = 850

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 66/76 (86%), Gaps = 3/76 (3%)
 Strand = Plus / Minus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttgggg---ccgcacttgcacccgccgtt 237
           ||||||||||||||| |||| |||||||||| ||| |   ||||||||||||||||||||
Sbjct: 369 tcacttgcaggtgcaggggtcgcaggtgcagctggcggcgccgcacttgcacccgccgtt 310

                           
Query: 238 ctcggcggcggcggcc 253
           ||| ||  ||||||||
Sbjct: 309 ctcagctccggcggcc 294



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 347 gggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           ||||||||||||||||||||||| ||| |||||||||||||
Sbjct: 215 gggtacatcttgcaccctccgcacccgctgccgcacttgca 175



to top

>gb|DQ097731.1| Arachis hypogaea metallothionein-like protein mRNA, complete cds
          Length = 540

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 347 gggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 166 gggtacatcttgcagcctccacagccgttgccgcacttgca 126



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagtt 213
           ||||||||||||||| ||||||||| |||||||
Sbjct: 329 tcacttgcaggtgcatgggttgcagctgcagtt 297



to top

>gb|AF333385.1|AF333385 Avicennia marina class I type 2 metallothionein mRNA, complete cds
          Length = 651

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 347 gggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 153 gggtacatgttgcaccctccgcagccgttgccacacttgca 113



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 39/44 (88%), Gaps = 3/44 (6%)
 Strand = Plus / Minus

                                                       
Query: 200 ttgcaggtgcagttggggccgcacttgcacccgccgttctcggc 243
           ||||||||||||||||  |||||||||||   ||||||||||||
Sbjct: 294 ttgcaggtgcagttggctccgcacttgca---gccgttctcggc 254



to top

>gb|AF201384.1|AF201384 Petunia x hybrida putative metallothionein-like protein (Mt2) mRNA,
           complete cds
          Length = 597

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 347 gggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 143 gggtacatcttgcatcctccacagccgttgccgcacttgca 103



to top

>gb|AF078912.1|AF078912 Mesembryanthemum crystallinum clone R6-R86 metallothionein mRNA,
           complete cds
          Length = 558

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 347 gggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||||||||||||| |||||||| |||||||||||
Sbjct: 136 gggtacatcttgcaccctccacagccgttaccgcacttgca 96



to top

>gb|AF000935.1|AF000935 Mesembryanthemum crystallinum metallothionein mRNA, complete cds
          Length = 264

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 347 gggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||||||||||||| |||||||| |||||||||||
Sbjct: 97  gggtacatcttgcaccctccacagccgttaccgcacttgca 57



to top

>gb|AY109353.1| Zea mays CL1155_2 mRNA sequence
          Length = 1048

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 67/78 (85%), Gaps = 3/78 (3%)
 Strand = Plus / Minus

                                                                       
Query: 313 ggtggcggtggtgctcaccccctcgtccatcccagggtacatc---ttgcaccctccgca 369
           ||||||||||||| |||||  |||  ||||  | |||||||||   ||||||||||||||
Sbjct: 491 ggtggcggtggtggtcacctgctcagccatgtccgggtacatcttgttgcaccctccgca 432

                             
Query: 370 gccgttgccgcacttgca 387
           ||||||||||||||||||
Sbjct: 431 gccgttgccgcacttgca 414



 Score = 46.1 bits (23), Expect = 0.084
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 207 tgcagttggggccgcacttgcacccgccgttctcggcggcggcggcc 253
           ||||||||  |||||||||||||||||||| ||| ||  ||||||||
Sbjct: 597 tgcagttgccgccgcacttgcacccgccgtcctcagctccggcggcc 551



to top

>gb|DQ222401.1| Arachis hypogaea type 2 metallothionein (MT2b) gene, complete cds
          Length = 821

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||||||||| |||||||||||| |||| ||||||||
Sbjct: 86  cagggtacatcttgcatcctccgcagccgctgccacacttgca 44



 Score = 48.1 bits (24), Expect = 0.021
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| |||| ||| |||||||| |  || |||||||| || ||||||||
Sbjct: 584 tcacttgcaggtgcaagggtcgcatgtgcagttagatccacacttgcagccaccgttctc 525



to top

>gb|BT016341.1| Zea mays clone Contig174 mRNA sequence
          Length = 761

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 357 tgcaccctccgcagccgttgccgcacttgca 387
           |||||||||||||||||||||||||||||||
Sbjct: 127 tgcaccctccgcagccgttgccgcacttgca 97



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 208 gcagttggggccgcacttgcacccgccgttctcggcggcggcggcc 253
           |||||||  |||||||||||||||||||||||| ||  ||||||||
Sbjct: 276 gcagttgccgccgcacttgcacccgccgttctcagctccggcggcc 231



to top

>gb|AY594297.1| Populus balsamifera subsp. trichocarpa x Populus deltoides
           metallothionein 2a (MT2a) mRNA, complete cds
          Length = 592

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||||||||| ||||| |||||| |||||||||||||
Sbjct: 146 cagggtacatcttgcatcctccacagccgctgccgcacttgca 104



to top

>gb|DQ178618.1| Arachis hypogaea type 2 metallothionein (MT2c) mRNA, complete cds
          Length = 487

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||||||||| |||||||||||| |||| ||||||||
Sbjct: 86  cagggtacatcttgcatcctccgcagccgctgccacacttgca 44



 Score = 48.1 bits (24), Expect = 0.021
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| |||| ||| |||||||| |  || |||||||| || ||||||||
Sbjct: 247 tcacttgcaggtgcaagggtcgcatgtgcagttagatccacacttgcagccaccgttctc 188



to top

>gb|DQ178617.1| Arachis hypogaea type 2 metallothionein (MT2b) mRNA, complete cds
          Length = 484

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||||||||| |||||||||||| |||| ||||||||
Sbjct: 86  cagggtacatcttgcatcctccgcagccgctgccacacttgca 44



 Score = 48.1 bits (24), Expect = 0.021
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| |||| ||| |||||||| |  || |||||||| || ||||||||
Sbjct: 247 tcacttgcaggtgcaagggtcgcatgtgcagttagatccacacttgcagccaccgttctc 188



to top

>gb|DQ178616.1| Arachis hypogaea type 2 metallothionein (MT2a) mRNA, complete cds
          Length = 487

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||||||||| |||||||||||| |||| ||||||||
Sbjct: 86  cagggtacatcttgcatcctccgcagccgctgccacacttgca 44



 Score = 48.1 bits (24), Expect = 0.021
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| |||| ||| |||||||| |  || |||||||| || ||||||||
Sbjct: 247 tcacttgcaggtgcaagggtcgcatgtgcagttagatccacacttgcagccaccgttctc 188



to top

>gb|DQ442271.1| Camellia sinensis metallothionin 2 mRNA, complete cds
          Length = 559

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||| ||||| ||||| ||||||||||||||||||||
Sbjct: 84  cagggtacatgttgcatcctccacagccgttgccgcacttgca 42



to top

>gb|DQ097730.1| Arachis hypogaea type 2 metallothionein mRNA, complete cds
          Length = 667

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||||||||| |||||||||||| |||| ||||||||
Sbjct: 191 cagggtacatcttgcatcctccgcagccgctgccacacttgca 149



 Score = 48.1 bits (24), Expect = 0.021
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                       
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||||||| |||| ||| |||||||| |  || |||||||| || ||||||||
Sbjct: 352 tcacttgcaggtgcaagggtcgcatgtgcagttagatccacacttgcagccaccgttctc 293



to top

>gb|AF268391.1| Musa acuminata metallothionein-like protein (MWMT2A) mRNA, complete
           cds
          Length = 601

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                  
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcact 383
           |||||||||||||||| |||||||||||| |||||||||
Sbjct: 118 cagggtacatcttgcatcctccgcagccgctgccgcact 80



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 185 ttgcaggtgcacgggttgcaggtgcagttggggccgcacttgca 228
           |||||| |||| || | ||||||||||||||  |||||||||||
Sbjct: 272 ttgcagttgcagggatcgcaggtgcagttggatccgcacttgca 229



to top

>ref|NM_184376.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 249

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 187 gcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccg 232
           |||| |||| ||||||||||||||||||  ||||||||||||||||
Sbjct: 240 gcagttgcaggggttgcaggtgcagttgtcgccgcacttgcacccg 195



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                
Query: 347 gggtacatcttgcaccctccgcagccgttgccgcact 383
           |||||||||||||| |||||||||||| |||||||||
Sbjct: 80  gggtacatcttgcatcctccgcagccgctgccgcact 44



to top

>dbj|AB175925.1| Oryza rufipogon met6 gene for metallothionein, complete cds,
            strain:sn
          Length = 1431

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                          
Query: 187  gcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccg 232
            |||| |||| ||||||||||||||||||  ||||||||||||||||
Sbjct: 1407 gcagttgcaggggttgcaggtgcagttgtcgccgcacttgcacccg 1362



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 360 accctccgcagccgttgccgcact 383
           |||||||||||||| |||||||||
Sbjct: 67  accctccgcagccgctgccgcact 44



to top

>dbj|AB175924.1| Oryza rufipogon met6 gene for metallothionein, complete cds,
            strain:LV61
          Length = 1460

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                          
Query: 187  gcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccg 232
            |||| |||| ||||||||||||||||||  ||||||||||||||||
Sbjct: 1436 gcagttgcaggggttgcaggtgcagttgtcgccgcacttgcacccg 1391



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 360 accctccgcagccgttgccgcact 383
           |||||||||||||| |||||||||
Sbjct: 67  accctccgcagccgctgccgcact 44



to top

>dbj|AB175923.1| Oryza rufipogon met6 gene for metallothionein, complete cds,
            strain:cb22
          Length = 1432

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                          
Query: 187  gcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccg 232
            |||| |||| ||||||||||||||||||  ||||||||||||||||
Sbjct: 1408 gcagttgcaggggttgcaggtgcagttgtcgccgcacttgcacccg 1363



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 360 accctccgcagccgttgccgcact 383
           |||||||||||||| |||||||||
Sbjct: 67  accctccgcagccgctgccgcact 44



to top

>dbj|AB175922.1| Oryza rufipogon met6 gene for metallothionein, complete cds,
            strain:yg2a
          Length = 1432

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                          
Query: 187  gcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccg 232
            |||| |||| ||||||||||||||||||  ||||||||||||||||
Sbjct: 1408 gcagttgcaggggttgcaggtgcagttgtcgccgcacttgcacccg 1363



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 360 accctccgcagccgttgccgcact 383
           |||||||||||||| |||||||||
Sbjct: 67  accctccgcagccgctgccgcact 44



to top

>dbj|AB175921.1| Oryza rufipogon met6 gene for metallothionein, complete cds,
            strain:ct56
          Length = 1430

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                          
Query: 187  gcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccg 232
            |||| |||| ||||||||||||||||||  ||||||||||||||||
Sbjct: 1406 gcagttgcaggggttgcaggtgcagttgtcgccgcacttgcacccg 1361



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 360 accctccgcagccgttgccgcact 383
           |||||||||||||| |||||||||
Sbjct: 67  accctccgcagccgctgccgcact 44



to top

>dbj|AB175920.1| Oryza rufipogon met6 gene for metallothionein, complete cds,
            strain:ct51
          Length = 1431

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                          
Query: 187  gcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccg 232
            |||| |||| ||||||||||||||||||  ||||||||||||||||
Sbjct: 1407 gcagttgcaggggttgcaggtgcagttgtcgccgcacttgcacccg 1362



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 360 accctccgcagccgttgccgcact 383
           |||||||||||||| |||||||||
Sbjct: 67  accctccgcagccgctgccgcact 44



to top

>dbj|AB175919.1| Oryza rufipogon met6 gene for metallothionein, complete cds,
            strain:w1976
          Length = 1460

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                          
Query: 187  gcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccg 232
            |||| |||| ||||||||||||||||||  ||||||||||||||||
Sbjct: 1436 gcagttgcaggggttgcaggtgcagttgtcgccgcacttgcacccg 1391



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 360 accctccgcagccgttgccgcact 383
           |||||||||||||| |||||||||
Sbjct: 67  accctccgcagccgctgccgcact 44



to top

>dbj|AB175918.1| Oryza rufipogon met6 gene for metallothionein, complete cds,
            strain:w1972
          Length = 1431

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                          
Query: 187  gcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccg 232
            |||| |||| ||||||||||||||||||  ||||||||||||||||
Sbjct: 1407 gcagttgcaggggttgcaggtgcagttgtcgccgcacttgcacccg 1362



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 360 accctccgcagccgttgccgcact 383
           |||||||||||||| |||||||||
Sbjct: 67  accctccgcagccgctgccgcact 44



to top

>dbj|AB175917.1| Oryza rufipogon met6 gene for metallothionein, complete cds,
            strain:w1956
          Length = 1457

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                          
Query: 187  gcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccg 232
            |||| |||| ||||||||||||||||||  ||||||||||||||||
Sbjct: 1433 gcagttgcaggggttgcaggtgcagttgtcgccgcacttgcacccg 1388



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 360 accctccgcagccgttgccgcact 383
           |||||||||||||| |||||||||
Sbjct: 67  accctccgcagccgctgccgcact 44



to top

>dbj|AB175916.1| Oryza rufipogon met6 gene for metallothionein, complete cds,
            strain:w630
          Length = 1433

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                          
Query: 187  gcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccg 232
            |||| |||| ||||||||||||||||||  ||||||||||||||||
Sbjct: 1409 gcagttgcaggggttgcaggtgcagttgtcgccgcacttgcacccg 1364



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 360 accctccgcagccgttgccgcact 383
           |||||||||||||| |||||||||
Sbjct: 67  accctccgcagccgctgccgcact 44



to top

>dbj|AB175915.1| Oryza rufipogon met6 gene for metallothionein, complete cds,
            strain:w120
          Length = 1422

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                          
Query: 187  gcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccg 232
            |||| |||| ||||||||||||||||||  ||||||||||||||||
Sbjct: 1398 gcagttgcaggggttgcaggtgcagttgtcgccgcacttgcacccg 1353



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 360 accctccgcagccgttgccgcact 383
           |||||||||||||| |||||||||
Sbjct: 67  accctccgcagccgctgccgcact 44



to top

>dbj|AB175914.1| Oryza rufipogon met6 gene for metallothionein, complete cds,
            strain:w593
          Length = 1421

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                          
Query: 187  gcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccg 232
            |||| |||| ||||||||||||||||||  ||||||||||||||||
Sbjct: 1397 gcagttgcaggggttgcaggtgcagttgtcgccgcacttgcacccg 1352



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 360 accctccgcagccgttgccgcact 383
           |||||||||||||| |||||||||
Sbjct: 67  accctccgcagccgctgccgcact 44



to top

>dbj|AB175913.1| Oryza rufipogon met6 gene for metallothionein, complete cds,
            strain:w108
          Length = 1456

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                          
Query: 187  gcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccg 232
            |||| |||| ||||||||||||||||||  ||||||||||||||||
Sbjct: 1432 gcagttgcaggggttgcaggtgcagttgtcgccgcacttgcacccg 1387



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 360 accctccgcagccgttgccgcact 383
           |||||||||||||| |||||||||
Sbjct: 67  accctccgcagccgctgccgcact 44



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                             
Query: 187     gcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccg 232
               |||| |||| ||||||||||||||||||  ||||||||||||||||
Sbjct: 2692538 gcagttgcaggggttgcaggtgcagttgtcgccgcacttgcacccg 2692583



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                             
Query: 187     gcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccg 232
               |||| |||| ||||||||||||||||||  ||||||||||||||||
Sbjct: 2664439 gcagttgcaggggttgcaggtgcagttgtcgccgcacttgcacccg 2664484



 Score = 48.1 bits (24), Expect = 0.021
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                       
Query: 201     tgcaggtgcagttggggccgcacttgcacccgccgttctc 240
               |||||| |||| ||| |||||||||||| |||||||||||
Sbjct: 5478426 tgcaggagcagctggtgccgcacttgcagccgccgttctc 5478387



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                         
Query: 319     ggtggtgctcaccccctcgtccatcccagggtacatcttgca 360
               ||||||| ||||| ||||  ||||||| ||||||||||||||
Sbjct: 2665423 ggtggtggtcacctcctcagccatccccgggtacatcttgca 2665464



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 360      accctccgcagccgttgccgcact 383
                |||| |||||||||||||||||||
Sbjct: 43039679 acccgccgcagccgttgccgcact 43039656



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 306      gggaggaggtggcggtggtg 325
                ||||||||||||||||||||
Sbjct: 41842199 gggaggaggtggcggtggtg 41842180



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 238     ctcggcggcggcggcctcga 257
               ||||||||||||||||||||
Sbjct: 6702147 ctcggcggcggcggcctcga 6702166



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 360     accctccgcagccgttgccgcact 383
               |||||||||||||| |||||||||
Sbjct: 2693906 accctccgcagccgctgccgcact 2693929



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 360     accctccgcagccgttgccgcact 383
               |||||||||||||| |||||||||
Sbjct: 2667782 accctccgcagccgctgccgcact 2667805



to top

>dbj|AP002540.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0434B04
          Length = 167029

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                            
Query: 187    gcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccg 232
              |||| |||| ||||||||||||||||||  ||||||||||||||||
Sbjct: 142313 gcagttgcaggggttgcaggtgcagttgtcgccgcacttgcacccg 142358



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                            
Query: 187    gcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccg 232
              |||| |||| ||||||||||||||||||  ||||||||||||||||
Sbjct: 114214 gcagttgcaggggttgcaggtgcagttgtcgccgcacttgcacccg 114259



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                        
Query: 319    ggtggtgctcaccccctcgtccatcccagggtacatcttgca 360
              ||||||| ||||| ||||  ||||||| ||||||||||||||
Sbjct: 115198 ggtggtggtcacctcctcagccatccccgggtacatcttgca 115239



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 360    accctccgcagccgttgccgcact 383
              |||||||||||||| |||||||||
Sbjct: 143681 accctccgcagccgctgccgcact 143704



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 360    accctccgcagccgttgccgcact 383
              |||||||||||||| |||||||||
Sbjct: 117557 accctccgcagccgctgccgcact 117580



to top

>emb|AJ417527.1|OSA417527 Oryza sativa partial mRNA for putative metallothionein-like protein
           (xd15 gene)
          Length = 317

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 187 gcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccg 232
           |||| |||| ||||||||||||||||||  ||||||||||||||||
Sbjct: 85  gcagttgcaggggttgcaggtgcagttgtcgccgcacttgcacccg 40



to top

>emb|AJ247090.1|ECR247090 Eichhornia crassipes MT1 gene for metallothionein, exons 1-3 (clone
           A)
          Length = 850

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 185 ttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctcgg 242
           |||||| |||| |||||||||||||||||||  ||||||||||| ||  |||||||||
Sbjct: 484 ttgcagttgcaagggttgcaggtgcagttggatccgcacttgcagccttcgttctcgg 427



to top

>emb|AJ010162.1|ECR010162 Eichhornia crassipes mRNA for metallothionein-like protein, clone C
          Length = 537

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 185 ttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctcgg 242
           |||||| |||| |||||||||||||||||||  ||||||||||| ||  |||||||||
Sbjct: 310 ttgcagttgcaagggttgcaggtgcagttggatccgcacttgcagccttcgttctcgg 253



 Score = 46.1 bits (23), Expect = 0.084
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||| ||||||||||| || | |||||| ||||||||||||||
Sbjct: 162 caggatacatcttgcagccgctgcagccattgccgcacttgca 120



to top

>emb|AJ010161.1|ECR010161 Eichhornia crassipes mRNA for metallothionein-like protein, clone B
          Length = 572

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 185 ttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctcgg 242
           |||||| |||| |||||||||||||||||||  ||||||||||| ||  |||||||||
Sbjct: 310 ttgcagttgcaagggttgcaggtgcagttggatccgcacttgcagccttcgttctcgg 253



 Score = 46.1 bits (23), Expect = 0.084
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||| ||||||||||| || | |||||| ||||||||||||||
Sbjct: 162 caggatacatcttgcagccgctgcagccattgccgcacttgca 120



to top

>emb|AJ010160.1|ECR010160 Eichhornia crassipes mRNA for metallothionein-like protein, clone A
          Length = 676

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 185 ttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctcgg 242
           |||||| |||| |||||||||||||||||||  ||||||||||| ||  |||||||||
Sbjct: 310 ttgcagttgcaagggttgcaggtgcagttggatccgcacttgcagccttcgttctcgg 253



 Score = 46.1 bits (23), Expect = 0.084
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||| ||||||||||| || | |||||| ||||||||||||||
Sbjct: 162 caggatacatcttgcagccgctgcagccattgccgcacttgca 120



to top

>dbj|AK069318.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023014M14, full
            insert sequence
          Length = 3883

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                          
Query: 187  gcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccg 232
            |||| |||| ||||||||||||||||||  ||||||||||||||||
Sbjct: 3529 gcagttgcaggggttgcaggtgcagttgtcgccgcacttgcacccg 3484



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                      
Query: 319  ggtggtgctcaccccctcgtccatcccagggtacatcttgca 360
            ||||||| ||||| ||||  ||||||| ||||||||||||||
Sbjct: 2545 ggtggtggtcacctcctcagccatccccgggtacatcttgca 2504



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 360 accctccgcagccgttgccgcact 383
           |||||||||||||| |||||||||
Sbjct: 187 accctccgcagccgctgccgcact 164



to top

>dbj|D89931.1| Oryza sativa DNA for metallothionein-like protein, complete cds
          Length = 1460

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                          
Query: 187  gcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccg 232
            |||| |||| ||||||||||||||||||  ||||||||||||||||
Sbjct: 1448 gcagttgcaggggttgcaggtgcagttgtcgccgcacttgcacccg 1403



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 360 accctccgcagccgttgccgcact 383
           |||||||||||||| |||||||||
Sbjct: 79  accctccgcagccgctgccgcact 56



to top

>gb|U43530.1|OSU43530 Oryza sativa metallothionein-like type 2 (OsMT-2) mRNA, complete
           cds
          Length = 264

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 187 gcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccg 232
           |||| |||| ||||||||||||||||||  ||||||||||||||||
Sbjct: 252 gcagttgcaggggttgcaggtgcagttgtcgccgcacttgcacccg 207



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                
Query: 347 gggtacatcttgcaccctccgcagccgttgccgcact 383
           |||||||||||||| |||||||||||| |||||||||
Sbjct: 92  gggtacatcttgcatcctccgcagccgctgccgcact 56



to top

>gb|AY486002.1| Thlaspi caerulescens metallothionein-like mRNA, partial sequence
          Length = 516

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 347 gggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||| ||||| |||||||| |||||||||||||||||
Sbjct: 148 gggtacattttgcaacctccgcatccgttgccgcacttgca 108



to top

>emb|Z34269.1|HVBKACPS4 H.vulgare (pMaW25) mRNA for beta-ketoacyl-ACP synthase
          Length = 2380

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 347  gggtacatcttgcaccctccgcagccgttgccgcacttgca 387
            |||||||| ||||| || |||||||||||||||||||||||
Sbjct: 2043 gggtacatgttgcagccgccgcagccgttgccgcacttgca 2003



to top

>emb|Y10850.1|BJY10850 Brassica juncea mRNA for metallothionein-like protein type 2, clone
           mt2-18
          Length = 558

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 347 gggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||| ||||| |||||||| |||||||||||||||||
Sbjct: 131 gggtacattttgcaacctccgcaaccgttgccgcacttgca 91



to top

>emb|AJ879116.1| Capsicum chinense mRNA for metallothionein-like protein (mtb gene)
          Length = 612

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 347 gggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||||||| ||||| ||||| ||||||||||||||
Sbjct: 159 gggtacatcttgcatcctccacagccattgccgcacttgca 119



to top

>gb|DQ132853.1| Nicotiana tabacum metallothionein-like protein mRNA, complete cds
          Length = 289

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 347 gggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||||||| || || ||||||||||||||||||||
Sbjct: 80  gggtacatcttgcatccgccacagccgttgccgcacttgca 40



to top

>gb|AF200712.1|AF200712 Brassica oleracea cultivar Green King metallothionein-like protein
           2 (MT2) mRNA, complete cds
          Length = 243

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 347 gggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||| ||||| |||||||| |||||||||||||||||
Sbjct: 80  gggtacattttgcaacctccgcaaccgttgccgcacttgca 40



to top

>dbj|AB176561.1| Vigna angularis MET mRNA for type 2 metallothionein, complete cds
          Length = 649

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 347 gggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||||||| |||||||||||  |||||||||||||
Sbjct: 173 gggtacatcttgcagcctccgcagccactgccgcacttgca 133



to top

>dbj|AB176557.1| Vigna radiata var. radiata MET mRNA for type 2 metallothionein,
           complete cds
          Length = 670

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 347 gggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||||||| |||||||||||  |||||||||||||
Sbjct: 173 gggtacatcttgcagcctccgcagccactgccgcacttgca 133



to top

>emb|AJ511345.1|HVU511345 Hordeum vulgare subsp. vulgare mRNA for metallothioneine type2
           (mt2a gene)
          Length = 237

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 347 gggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||| ||||| || |||||||||||||||||||||||
Sbjct: 80  gggtacatgttgcagccgccgcagccgttgccgcacttgca 40



to top

>emb|Z68138.1|LEMT1 L.esculentum mRNA for metallothionein-like protein
          Length = 599

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 347 gggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||||||| ||||| ||||||||| ||||||||||
Sbjct: 151 gggtacatcttgcaacctccacagccgttgtcgcacttgca 111



to top

>gb|L31940.1|BNABIF98 Brassica campestris L. ssp pekinensis (clone bif98)
           metallothionein-like protein mRNA, complete cds
          Length = 490

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 347 gggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||| ||||| |||||||| |||||||||||||||||
Sbjct: 83  gggtacattttgcaacctccgcaaccgttgccgcacttgca 43



to top

>dbj|D78498.1| Brassica rapa mRNA for metallothionein-like protein, complete cds
          Length = 484

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 347 gggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||| ||||| |||||||| |||||||||||||||||
Sbjct: 83  gggtacattttgcaacctccgcaaccgttgccgcacttgca 43



to top

>dbj|D78491.1| Brassica rapa mRNA for metallothionein-like protein, complete cds
          Length = 484

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 347 gggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||| ||||| |||||||| |||||||||||||||||
Sbjct: 83  gggtacattttgcaacctccgcaaccgttgccgcacttgca 43



to top

>gb|AY566693.1| Xerophyta humilis clone HC27 metallothionein mRNA, complete cds
          Length = 546

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 185 ttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           |||||| |||| ||||||||| ||||||| || ||||||||||| || ||||||||
Sbjct: 395 ttgcagttgcaggggttgcagttgcagttaggaccgcacttgcagcctccgttctc 340



to top

>emb|AJ247195.1|ECR247195 Eichhornia crassipes MT1 gene for metallothionein, exons 1-3 (clone
           D)
          Length = 746

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 185 ttgcaggtgcacgggttgcaggtgcagttggggccgcacttgca 228
           |||||| |||| |||||||||||||||||||  |||||||||||
Sbjct: 484 ttgcagttgcaagggttgcaggtgcagttggatccgcacttgca 441



to top

>gb|U61973.1|MDU61973 Malus domestica metallothionein-like protein (AMT1) mRNA, complete
           cds
          Length = 618

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgca 228
           |||||||||| |||| ||||||||||||||||||   |||||||||||
Sbjct: 293 tcacttgcagttgcaggggttgcaggtgcagttgtctccgcacttgca 246



to top

>ref|NM_111773.3| Arabidopsis thaliana MT2A (METALLOTHIONEIN 2A) AT3G09390 (MT2A)
           mRNA, complete cds
          Length = 538

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||| ||||| ||||| || |||||||||||||||||
Sbjct: 123 cagggtacattttgcaacctccacaaccgttgccgcacttgca 81



to top

>gb|AY170656.1| Silene paradoxa pop-variant CM metallothionein (MT2b) mRNA,
           complete cds
          Length = 237

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           ||||| |||||||||| ||||| |||||| |||||||||||||
Sbjct: 82  cagggaacatcttgcatcctccacagccgctgccgcacttgca 40



to top

>gb|AY170655.1| Silene paradoxa pop-variant CV metallothionein (MT2b) mRNA,
           complete cds
          Length = 237

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           ||||| |||||||||| ||||| |||||| |||||||||||||
Sbjct: 82  cagggaacatcttgcatcctccacagccgctgccgcacttgca 40



to top

>gb|AY170654.1| Silene paradoxa pop-variant PO metallothionein (MT2b) mRNA,
           complete cds
          Length = 237

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           ||||| |||||||||| ||||| |||||| |||||||||||||
Sbjct: 82  cagggaacatcttgcatcctccacagccgctgccgcacttgca 40



to top

>gb|AY170653.1| Silene paradoxa pop-variant PS metallothionein (MT2b) mRNA,
           complete cds
          Length = 237

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           ||||| |||||||||| ||||| |||||| |||||||||||||
Sbjct: 82  cagggaacatcttgcatcctccacagccgctgccgcacttgca 40



to top

>gb|AY170652.1| Silene paradoxa pop-variant FE metallothionein (MT2b) mRNA,
           complete cds
          Length = 237

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           ||||| |||||||||| ||||| |||||| |||||||||||||
Sbjct: 82  cagggaacatcttgcatcctccacagccgctgccgcacttgca 40



to top

>gb|AY277667.1| Malus x domestica metallothionein-like protein mRNA, partial cds
          Length = 291

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgc 227
           |||||||||| |||| ||||||||||||||||||   ||||||||||
Sbjct: 47  tcacttgcagttgcaggggttgcaggtgcagttgtctccgcacttgc 1



to top

>gb|AY077669.1| Arabidopsis thaliana AT3g09390/F3L24_28 mRNA, complete cds
          Length = 246

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||| ||||| ||||| || |||||||||||||||||
Sbjct: 82  cagggtacattttgcaacctccacaaccgttgccgcacttgca 40



to top

>gb|AF101825.1|AF101825 Silene vulgaris metallothionein mRNA, complete cds
          Length = 237

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           ||||| |||||||||| ||||| |||||| |||||||||||||
Sbjct: 82  cagggaacatcttgcatcctccacagccgctgccgcacttgca 40



to top

>gb|AY037263.1| Arabidopsis thaliana AT3g09390/F3L24_28 mRNA, complete cds
          Length = 516

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||| ||||| ||||| || |||||||||||||||||
Sbjct: 111 cagggtacattttgcaacctccacaaccgttgccgcacttgca 69



to top

>gb|AF268027.1|AF268027 Amaranthus cruentus metallothionein mRNA, complete cds
          Length = 545

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 351 acatcttgcaccctccgcagccgttgccgca 381
           |||||||||| ||||||||||||||||||||
Sbjct: 135 acatcttgcatcctccgcagccgttgccgca 105



to top

>emb|BX822943.1|CNS0A7AD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB74ZF11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 497

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||| ||||| ||||| || |||||||||||||||||
Sbjct: 87  cagggtacattttgcaacctccacaaccgttgccgcacttgca 45



to top

>emb|BX842226.1|CNS09YEG Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL78ZC09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 516

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||| ||||| ||||| || |||||||||||||||||
Sbjct: 105 cagggtacattttgcaacctccacaaccgttgccgcacttgca 63



to top

>gb|AF257465.1|AF257465 Porteresia coarctata metallothionein mRNA, complete cds
          Length = 581

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 202 gcaggtgcagttggggccgcacttgcacccgccgttctcggcggcggcggc 252
           ||||| |||| ||| |||||||||||||||| ||||||| ||| |||||||
Sbjct: 237 gcaggagcagctggagccgcacttgcacccgtcgttctcagcgccggcggc 187



to top

>emb|AJ277599.2|QSU277599 Quercus suber mRNA for metallothionein-like protein (mt gene)
          Length = 309

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           ||||| |||||||||| ||||| |||||| |||||||||||||
Sbjct: 157 cagggaacatcttgcatcctccacagccgctgccgcacttgca 115



to top

>emb|X62818.1|ATATMT1 A.thaliana AtMT-1 mRNA for metallothionein-like protein
          Length = 545

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||| ||||| ||||| || |||||||||||||||||
Sbjct: 123 cagggtacattttgcaacctccacaaccgttgccgcacttgca 81



to top

>emb|AJ243532.1|PPE243532 Prunus persica mRNA for metallothionein-like protein
          Length = 590

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||||  ||||||||| |||||| |||||||||||||
Sbjct: 118 cagggtacatcccgcaccctccacagccgctgccgcacttgca 76



to top

>gb|U15108.1|ATU15108 Arabidopsis thaliana metallothionein-like protein (AtMT-K) mRNA,
           complete cds
          Length = 491

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||| ||||| ||||| || |||||||||||||||||
Sbjct: 85  cagggtacattttgcaacctccacaaccgttgccgcacttgca 43



to top

>gb|DQ023294.1| Avicennia germinans class I type 2 metallothionein mRNA, partial
           cds.~~
          Length = 468

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 347 gggtacatcttgcaccctccgcagcc 372
           ||||||||||||||||||||||||||
Sbjct: 91  gggtacatcttgcaccctccgcagcc 66



to top

>gb|AF334141.1|AF334141 Avicennia marina class I type 2 metallothionein mRNA, complete cds
          Length = 659

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 347 gggtacatcttgcaccctccgcagcc 372
           ||||||||||||||||||||||||||
Sbjct: 151 gggtacatcttgcaccctccgcagcc 126



to top

>gb|AF329968.1|AF329968 Avicennia marina class I type 2 metallothionein mRNA, complete cds
          Length = 666

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 347 gggtacatcttgcaccctccgcagcc 372
           ||||||||||||||||||||||||||
Sbjct: 164 gggtacatcttgcaccctccgcagcc 139



to top

>dbj|AB176565.1| Pisum sativum MET mRNA for type 2 metallothionein, complete cds
          Length = 527

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 350 tacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||||||||||||||||   ||||||||||||
Sbjct: 155 tacatcttgcaccctccgcagccagagccgcacttgca 118



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 185 ttgcaggtgcacgggttgcaggtgcagtt 213
           ||||||||||| |||||||| ||||||||
Sbjct: 308 ttgcaggtgcaagggttgcaagtgcagtt 280



to top

>gb|AY833717.1| Codonopsis lanceolata metallothionein-like protein type 2 (MTII)
           mRNA, complete cds
          Length = 585

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 180 atcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgca 228
           |||| ||||||||||| |||| ||||||||||||||  || ||||||||
Sbjct: 319 atcatttgcaggtgcatgggtcgcaggtgcagttggccccacacttgca 271



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 347 gggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||||||||||||| || ||  |||||||||||||
Sbjct: 161 gggtacatcttgcaccctccacacccactgccgcacttgca 121



to top

>emb|X68600.1|HVPZE40 H. vulgare pZE40 gene
          Length = 551

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 351 acatcttgcaccctccgcagccgttgccgcact 383
           ||||||||||||| ||||||||| |||||||||
Sbjct: 106 acatcttgcacccgccgcagccggtgccgcact 74



to top

>emb|X95709.1|CANMT2MET C.arietinum mRNA for class I type 2 metallothionein (clone:
           CanMT-2)
          Length = 654

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 185 ttgcaggtgcacgggttgcaggtgcagtt 213
           ||||||||||| |||||||||||||||||
Sbjct: 285 ttgcaggtgcaagggttgcaggtgcagtt 257



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 347 gggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||||||| ||||| |||||  ||||||| |||||
Sbjct: 129 gggtacatcttgcagcctccacagccactgccgcatttgca 89



to top

>gb|AY962830.1| Prunus armeniaca metallothionein-like protein mRNA, complete cds
          Length = 466

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 347 gggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||  ||||||||| |||||| |||||||||||||
Sbjct: 119 gggtacatcccgcaccctccacagccgctgccgcacttgca 79



to top

>gb|AY578087.1| Prunus armeniaca metallothionein-like protein mRNA, complete cds
          Length = 466

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 347 gggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||  ||||||||| |||||| |||||||||||||
Sbjct: 119 gggtacatcccgcaccctccacagccgctgccgcacttgca 79



to top

>dbj|AB126057.1| Codonopsis lanceolata mRNA for metallothionein 2, complete cds
          Length = 631

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 180 atcacttgcaggtgcacgggttgcaggtgcagttggggccgcacttgca 228
           |||| ||||||||||| |||| ||||||||||||||  || ||||||||
Sbjct: 305 atcatttgcaggtgcatgggtcgcaggtgcagttggccccacacttgca 257



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 347 gggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||||||||||||| || ||  |||||||||||||
Sbjct: 147 gggtacatcttgcaccctccacacccactgccgcacttgca 107



to top

>emb|AJ309387.1|ABE309387 Atropa belladonna mRNA for putative metallothionein-like protein
           type 2B
          Length = 541

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 347 gggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||||||| ||||| ||||| |||||||| |||||
Sbjct: 80  gggtacatcttgcatcctccacagccattgccgcatttgca 40



to top

>gb|U97494.1|PAU97494 Prunus armeniaca metallothionein-like protein mRNA, complete cds
          Length = 691

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 347 gggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||  ||||||||| |||||| |||||||||||||
Sbjct: 141 gggtacatcccgcaccctccacagccgctgccgcacttgca 101



to top

>ref|NM_188286.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 189

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 201 tgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           |||||| |||| ||| |||||||||||| |||||||||||
Sbjct: 166 tgcaggagcagctggtgccgcacttgcagccgccgttctc 127



to top

>gb|AY389559.1| Hyacinthus orientalis metallothionein-like protein (MT) mRNA,
           partial cds
          Length = 481

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 185 ttgcaggtgcacgggttgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||||||||| ||||  |||||||||||||  || ||||||||||| || |||||
Sbjct: 290 ttgcaggtgcatgggtcacaggtgcagttggatccacacttgcaccctccattctc 235



to top

>dbj|AB175808.1| Oryza barthii met2 gene for metallothionein, complete cds,
           strain:w607
          Length = 906

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 201 tgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           |||||| |||| ||| |||||||||||| |||||||||||
Sbjct: 866 tgcaggagcagctggtgccgcacttgcagccgccgttctc 827



to top

>dbj|AB175807.1| Oryza rufipogon met2 gene for metallothionein, complete cds,
           strain:sn
          Length = 910

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 201 tgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           |||||| |||| ||| |||||||||||| |||||||||||
Sbjct: 864 tgcaggagcagctggtgccgcacttgcagccgccgttctc 825



to top

>dbj|AB175806.1| Oryza rufipogon met2 gene for metallothionein, complete cds,
           strain:lv61
          Length = 910

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 201 tgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           |||||| |||| ||| |||||||||||| |||||||||||
Sbjct: 864 tgcaggagcagctggtgccgcacttgcagccgccgttctc 825



to top

>dbj|AB175805.1| Oryza rufipogon met2 gene for metallothionein, complete cds,
           strain:yg2a
          Length = 912

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 201 tgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           |||||| |||| ||| |||||||||||| |||||||||||
Sbjct: 866 tgcaggagcagctggtgccgcacttgcagccgccgttctc 827



to top

>dbj|AB175804.1| Oryza rufipogon met2 gene for metallothionein, complete cds,
           strain:ct51
          Length = 913

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 201 tgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           |||||| |||| ||| |||||||||||| |||||||||||
Sbjct: 867 tgcaggagcagctggtgccgcacttgcagccgccgttctc 828



to top

>dbj|AB175803.1| Oryza rufipogon met2 gene for metallothionein, complete cds,
           strain:w1976
          Length = 912

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 201 tgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           |||||| |||| ||| |||||||||||| |||||||||||
Sbjct: 866 tgcaggagcagctggtgccgcacttgcagccgccgttctc 827



to top

>dbj|AB175802.1| Oryza rufipogon met2 gene for metallothionein, complete cds,
           strain:w1956
          Length = 913

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 201 tgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           |||||| |||| ||| |||||||||||| |||||||||||
Sbjct: 867 tgcaggagcagctggtgccgcacttgcagccgccgttctc 828



to top

>dbj|AB175801.1| Oryza rufipogon met2 gene for metallothionein, complete cds,
           strain:w630
          Length = 912

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 201 tgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           |||||| |||| ||| |||||||||||| |||||||||||
Sbjct: 866 tgcaggagcagctggtgccgcacttgcagccgccgttctc 827



to top

>dbj|AB175800.1| Oryza rufipogon met2 gene for metallothionein, complete cds,
           strain:w149
          Length = 912

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 201 tgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           |||||| |||| ||| |||||||||||| |||||||||||
Sbjct: 867 tgcaggagcagctggtgccgcacttgcagccgccgttctc 828



to top

>dbj|AB175799.1| Oryza rufipogon met2 gene for metallothionein, complete cds,
           strain:w120
          Length = 909

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 201 tgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           |||||| |||| ||| |||||||||||| |||||||||||
Sbjct: 863 tgcaggagcagctggtgccgcacttgcagccgccgttctc 824



to top

>dbj|AB175798.1| Oryza rufipogon met2 gene for metallothionein, complete cds,
           strain:w593
          Length = 909

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 201 tgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           |||||| |||| ||| |||||||||||| |||||||||||
Sbjct: 863 tgcaggagcagctggtgccgcacttgcagccgccgttctc 824



to top

>dbj|AB175797.1| Oryza rufipogon met2 gene for metallothionein, complete cds,
           strain:w108
          Length = 912

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 201 tgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           |||||| |||| ||| |||||||||||| |||||||||||
Sbjct: 866 tgcaggagcagctggtgccgcacttgcagccgccgttctc 827



to top

>gb|L77966.1|TOMMTB Lycopersicon esculentum metallothionein II-like protein (MTB) gene,
           complete cds
          Length = 2479

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 360 accctccgcagccgttgccgcacttgca 387
           ||||||| ||||||||||||||||||||
Sbjct: 996 accctccacagccgttgccgcacttgca 969



to top

>emb|BX823125.1|CNS0A703 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB91ZF08 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 497

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcactt 384
           |||||||||| ||||| ||||| || ||||||||||||||
Sbjct: 89  cagggtacattttgcaacctccacaaccgttgccgcactt 50



to top

>dbj|AP003197.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1015E06
          Length = 164583

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                     
Query: 201   tgcaggtgcagttggggccgcacttgcacccgccgttctc 240
             |||||| |||| ||| |||||||||||| |||||||||||
Sbjct: 75266 tgcaggagcagctggtgccgcacttgcagccgccgttctc 75227



to top

>dbj|AK120350.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013065G09, full
           insert sequence
          Length = 550

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 201 tgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           |||||| |||| ||| |||||||||||| |||||||||||
Sbjct: 243 tgcaggagcagctggtgccgcacttgcagccgccgttctc 204



to top

>emb|Z26492.1|TRMT1AMR T.repens TrMT1A mRNA for metallothionein-like protein
          Length = 437

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 352 catcttgcaccctccgcagccgttgccgcacttgca 387
           ||||||||| ||||| ||||| ||||||||||||||
Sbjct: 133 catcttgcagcctccacagccattgccgcacttgca 98



to top

>emb|AJ297968.1|ABE297968 Atropa belladonna mRNA for methallothioneine-like protein (mt2B
           gene)
          Length = 544

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 347 gggtacatcttgcaccctccgcagccgttgccgcacttgc 386
           |||||||||||||| ||||| |||||  ||||||||||||
Sbjct: 83  gggtacatcttgcatcctccacagccagtgccgcacttgc 44



to top

>gb|AF147786.1|AF147786 Oryza sativa metallothionein-like protein (ML2) mRNA, complete cds
          Length = 498

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 201 tgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           |||||| |||| ||| |||||||||||| |||||||||||
Sbjct: 231 tgcaggagcagctggtgccgcacttgcagccgccgttctc 192



to top

>dbj|AK058313.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-A03, full
           insert sequence
          Length = 565

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 201 tgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           |||||| |||| ||| |||||||||||| |||||||||||
Sbjct: 242 tgcaggagcagctggtgccgcacttgcagccgccgttctc 203



to top

>gb|AF001396.1|OSAF001396 Oryza sativa metallothionein-like protein mRNA, complete cds
          Length = 532

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 201 tgcaggtgcagttggggccgcacttgcacccgccgttctc 240
           |||||| |||| ||| |||||||||||| |||||||||||
Sbjct: 228 tgcaggagcagctggtgccgcacttgcagccgccgttctc 189



to top

>ref|NM_120316.1| Arabidopsis thaliana MT2B (METALLOTHIONEIN 2B) AT5G02380 (MT2B)
           mRNA, complete cds
          Length = 522

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||| | ||||| |||||||| || ||||||||||||||
Sbjct: 162 cagggtaccttttgcaacctccgcaaccattgccgcacttgca 120



to top

>gb|AF339712.1| Arabidopsis thaliana putative metallothionein 2b protein
           (At5g02380) mRNA, complete cds
          Length = 284

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||| | ||||| |||||||| || ||||||||||||||
Sbjct: 82  cagggtaccttttgcaacctccgcaaccattgccgcacttgca 40



to top

>gb|AF324665.2| Arabidopsis thaliana AT5g02380 (AT5g02380/T1E22_140) mRNA, complete
           cds
          Length = 571

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||| | ||||| |||||||| || ||||||||||||||
Sbjct: 162 cagggtaccttttgcaacctccgcaaccattgccgcacttgca 120



to top

>emb|BX830194.1|CNS0A1F2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB65ZE01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 497

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||| | ||||| |||||||| || ||||||||||||||
Sbjct: 131 cagggtaccttttgcaacctccgcaaccattgccgcacttgca 89



to top

>emb|BX829647.1|CNS0A1H4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB27ZD07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 449

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||| | ||||| |||||||| || ||||||||||||||
Sbjct: 132 cagggtaccttttgcaacctccgcaaccattgccgcacttgca 90



to top

>emb|BX833573.1|CNS0A0MR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL62ZH01 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 515

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||| | ||||| |||||||| || ||||||||||||||
Sbjct: 129 cagggtaccttttgcaacctccgcaaccattgccgcacttgca 87



to top

>gb|BT004570.1| Arabidopsis thaliana At5g02380 gene, complete cds
          Length = 234

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||| | ||||| |||||||| || ||||||||||||||
Sbjct: 82  cagggtaccttttgcaacctccgcaaccattgccgcacttgca 40



to top

>gb|AY101566.1| Sparganophilus tamesis 28S ribosomal RNA gene, partial sequence
          Length = 690

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 231 cgccgttctcggcggcggcggcc 253
           |||||||||||||||||||||||
Sbjct: 435 cgccgttctcggcggcggcggcc 457



to top

>emb|AJ130886.1|FSY130886 Fagus sylvatica mRNA for metallothionein-like protein
          Length = 628

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           ||||||||  |||||| ||||| |||||| |||||||||||||
Sbjct: 122 cagggtacgccttgcatcctccacagccgctgccgcacttgca 80



to top

>gb|AY833008.1| Oryza officinalis metallothionein-like protein (MT1) mRNA, complete
           cds
          Length = 525

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 202 gcaggtgcagttggggccgcacttgcacccgccgttctc 240
           ||||| |||||||| |||||||||||| ||| |||||||
Sbjct: 226 gcaggcgcagttggtgccgcacttgcagccgtcgttctc 188



to top

>gb|L02306.1|RCCMETAL Ricinus communis metallothionein (RCMIT) mRNA, complete cds
          Length = 571

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 345 cagggtacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||| ||||||||||| || || || |||||||||||||||||
Sbjct: 109 caggatacatcttgcatccgccacaaccgttgccgcacttgca 67



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 191 gtgcacgggttgcaggtgcagttggggccgcacttgca 228
           ||||| ||||||||||||||||||  ||| ||||||||
Sbjct: 260 gtgcaagggttgcaggtgcagttgtcgccacacttgca 223



to top

>gb|CP000027.1| Dehalococcoides ethenogenes 195, complete genome
          Length = 1469720

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 365    ccgcagccgttgccgcacttgc 386
              ||||||||||||||||||||||
Sbjct: 426286 ccgcagccgttgccgcacttgc 426265



to top

>gb|BT017417.1| Zea mays clone EL01N0401C05.c mRNA sequence
          Length = 665

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 208 gcagttggggccgcacttgcacccgccgttctcggcggcggcggcc 253
           |||||||  ||||||||||||||| |||||||| ||  ||||||||
Sbjct: 278 gcagttgccgccgcacttgcacccaccgttctcagctccggcggcc 233



to top

>ref|XM_361587.1| Magnaporthe grisea 70-15 hypothetical protein (MG04061.4) partial
            mRNA
          Length = 5295

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 307  ggaggaggtggcggtggtgctc 328
            ||||||||||||||||||||||
Sbjct: 3149 ggaggaggtggcggtggtgctc 3128



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
               sequence
          Length = 29644043

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 231     cgccgttctcggcggcggcggcctcg 256
               |||||| |||||||||||||||||||
Sbjct: 5062964 cgccgtgctcggcggcggcggcctcg 5062939



to top

>dbj|AP005124.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OSJNBa0049I08
          Length = 144379

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 231    cgccgttctcggcggcggcggcctcg 256
              |||||| |||||||||||||||||||
Sbjct: 104653 cgccgtgctcggcggcggcggcctcg 104628



to top

>dbj|AP003743.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1118_E12
          Length = 119691

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 231   cgccgttctcggcggcggcggcctcg 256
             |||||| |||||||||||||||||||
Sbjct: 19131 cgccgtgctcggcggcggcggcctcg 19106



to top

>dbj|AB176563.1| Vicia faba MET mRNA for type 2 metallothionein, complete cds
          Length = 508

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 350 tacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||||||| ||||||||   ||||||||||||
Sbjct: 161 tacatcttgcacccgccgcagccagagccgcacttgca 124



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 185 ttgcaggtgcacgggttgcaggtgcagtt 213
           |||||||| || |||||||||||||||||
Sbjct: 314 ttgcaggtacatgggttgcaggtgcagtt 286



to top

>emb|X77254.1|VFMTIRNA V.faba MTI mRNA
          Length = 433

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 350 tacatcttgcaccctccgcagccgttgccgcacttgca 387
           |||||||||||||| ||||||||   ||||||||||||
Sbjct: 114 tacatcttgcacccgccgcagccagagccgcacttgca 77



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 185 ttgcaggtgcacgggttgcaggtgcagtt 213
           |||||||| || |||||||||||||||||
Sbjct: 267 ttgcaggtacatgggttgcaggtgcagtt 239



to top

>emb|Z68309.1|LEMEPT512 L.esculentum mRNA for Metallothionein-like protein (512bp)
          Length = 512

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 362 cctccgcagccgttgccgcacttgca 387
           ||||| ||||||||||||||||||||
Sbjct: 147 cctccacagccgttgccgcacttgca 122



to top

>gb|AF136924.1|AF136924 Fragaria x ananassa metallothionein-like protein mRNA, complete cds
          Length = 550

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 181 tcacttgcaggtgcacgggttgcaggtgcagttg 214
           ||||||||| ||||| |||| |||||||||||||
Sbjct: 245 tcacttgcaagtgcaagggtcgcaggtgcagttg 212



to top

>gb|AF389451.1| Tiger frog virus, complete genome
          Length = 105057

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 294   tgacgagggcctgggaggaggtggcggtgg 323
             |||||||| ||| |||||||||||||||||
Sbjct: 77030 tgacgaggaccttggaggaggtggcggtgg 77059



to top

>gb|AY667624.1| Gossypium hirsutum metallothionein-like protein (met-1) mRNA,
           complete cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 340 catcccagggtacatcttgcaccctccgcagccg 373
           |||| |||||||||||||||| || |||||||||
Sbjct: 162 catctcagggtacatcttgcaaccgccgcagccg 129



to top

>gb|L47746.1|PIAEMB30R Picea glauca metallothionein-like protein (EMB30) mRNA, complete
           cds
          Length = 389

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 208 gcagttggggccgcacttgca 228
           |||||||||||||||||||||
Sbjct: 198 gcagttggggccgcacttgca 178



to top

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 239     tcggcggcggcggcctcgaac 259
               |||||||||||||||||||||
Sbjct: 5676851 tcggcggcggcggcctcgaac 5676871



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 234     cgttctcggcggcggcggcc 253
               ||||||||||||||||||||
Sbjct: 5902144 cgttctcggcggcggcggcc 5902163



to top

>gb|AC153918.4| Mus musculus  BAC RP23-89M16 (Roswell Park Cancer Institute (C57BL/6J
            Female) Mouse BAC Library) complete sequence
          Length = 232574

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 133  caggtccgtccatccatccat 153
            |||||||||||||||||||||
Sbjct: 9091 caggtccgtccatccatccat 9071



to top

>dbj|AK104075.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-028-B05, full
           insert sequence
          Length = 459

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 355 cttgcaccctccgcagccgttgccgcact 383
           |||||| || |||||||||||||||||||
Sbjct: 98  cttgcatccgccgcagccgttgccgcact 70



to top

>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence
          Length = 2094509

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 238     ctcggcggcggcggcctcgaa 258
               |||||||||||||||||||||
Sbjct: 1045225 ctcggcggcggcggcctcgaa 1045205



to top

>dbj|AK062796.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-107-C08, full
           insert sequence
          Length = 518

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 355 cttgcaccctccgcagccgttgccgcact 383
           |||||| || |||||||||||||||||||
Sbjct: 163 cttgcatccgccgcagccgttgccgcact 135



to top

>emb|AJ555613.1|HVU555613 Hordeum vulgare subsp. vulgare mRNA for metallothionein-like
           protein type 3 (mt-3a gene)
          Length = 334

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 201 tgcaggtgcagttggggccgcacttgcac 229
           ||||||||||| ||| |||||||||||||
Sbjct: 206 tgcaggtgcagctggtgccgcacttgcac 178



to top

>gb|AC135861.5| Mus musculus BAC clone RP23-179J18 from 6, complete sequence
          Length = 202869

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 133    caggtccgtccatccatccat 153
              |||||||||||||||||||||
Sbjct: 183979 caggtccgtccatccatccat 183959



to top

>emb|Z14124.1|SSAPOAIG S.scrofa apoAI gene
          Length = 3641

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 297 cgagggcctgggaggaggtgg 317
           |||||||||||||||||||||
Sbjct: 843 cgagggcctgggaggaggtgg 863



to top

>gb|L00626.1|PIGAPAI Pig apolipoprotein A-1 gene, complete cds
          Length = 3333

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 297 cgagggcctgggaggaggtgg 317
           |||||||||||||||||||||
Sbjct: 18  cgagggcctgggaggaggtgg 38



to top

>dbj|AB002820.1| Oryza sativa mRNA for RicMT, complete cds
          Length = 500

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 355 cttgcaccctccgcagccgttgccgcact 383
           |||||| || |||||||||||||||||||
Sbjct: 145 cttgcatccgccgcagccgttgccgcact 117



to top

>emb|AJ309103.1|PPI309103 Pinus pinaster partial mRNA for putative metallothionein-like
           protein
          Length = 258

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 208 gcagttggggccgcacttgca 228
           |||||||||||||||||||||
Sbjct: 73  gcagttggggccgcacttgca 53



to top

>ref|NM_188514.1| Oryza sativa (japonica cultivar-group), Ozsa8183 predicted mRNA
          Length = 693

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 238 ctcggcggcggcggcctcga 257
           ||||||||||||||||||||
Sbjct: 102 ctcggcggcggcggcctcga 83



to top

>ref|XM_468477.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 657

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 238 ctcggcggcggcggcctcga 257
           ||||||||||||||||||||
Sbjct: 483 ctcggcggcggcggcctcga 464



to top

>ref|XM_464392.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 579

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 234 cgttctcggcggcggcggcctcga 257
           ||||||||||||||||||| ||||
Sbjct: 305 cgttctcggcggcggcggcgtcga 328



to top

>ref|XM_463738.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 405

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 306 gggaggaggtggcggtggtg 325
           ||||||||||||||||||||
Sbjct: 340 gggaggaggtggcggtggtg 359



to top

>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence
          Length = 3510148

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 238     ctcggcggcggcggcctcga 257
               ||||||||||||||||||||
Sbjct: 1257895 ctcggcggcggcggcctcga 1257914



to top

>gb|AY389609.1| Hyacinthus orientalis unknown mRNA
          Length = 392

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 185 ttgcaggtgcacgggttgcaggtgcagttggggccgcacttgca 228
           ||||||||||| ||||  |||||||||||||  || ||||||||
Sbjct: 202 ttgcaggtgcatgggtcacaggtgcagttggatccacacttgca 159



to top

>gb|AY389604.1| Hyacinthus orientalis type 2 metallothionein-like protein mRNA,
           partial cds
          Length = 442

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 185 ttgcaggtgcacgggttgcaggtgcagttggggccgcacttgca 228
           ||||||||||| ||||  |||||||||||||  || ||||||||
Sbjct: 255 ttgcaggtgcatgggtcacaggtgcagttggatccacacttgca 212



to top

>gb|AY389576.1| Hyacinthus orientalis metallothionein 2 (MT2) mRNA, partial cds
          Length = 499

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 185 ttgcaggtgcacgggttgcaggtgcagttggggccgcacttgca 228
           ||||||||||| ||||  |||||||||||||  || ||||||||
Sbjct: 304 ttgcaggtgcatgggtcacaggtgcagttggatccacacttgca 261



to top

>ref|XM_324215.1| Neurospora crassa OR74A hypothetical protein (NCU04859.1) partial
           mRNA
          Length = 3984

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 236 ttctcggcggcggcggcctcgaac 259
           ||||||||||||||||| ||||||
Sbjct: 194 ttctcggcggcggcggcatcgaac 171



to top

>ref|XM_954023.1| Neurospora crassa OR74A hypothetical protein (NCU04859.1) partial
           mRNA
          Length = 3984

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 236 ttctcggcggcggcggcctcgaac 259
           ||||||||||||||||| ||||||
Sbjct: 194 ttctcggcggcggcggcatcgaac 171



to top

>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 238     ctcggcggcggcggcctcga 257
               ||||||||||||||||||||
Sbjct: 2247460 ctcggcggcggcggcctcga 2247441



to top

>gb|BT012848.1| Lycopersicon esculentum clone 113926R, mRNA sequence
          Length = 433

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 345 cagggtacatcttgcaccctccgc 368
           |||||||||| |||||||||||||
Sbjct: 147 cagggtacatgttgcaccctccgc 124



to top

>gb|AF540910.1| Foot-and-mouth disease virus SAT 2 clone ZIM/7/83, complete genome
          Length = 8173

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 183 acttgcaggtgcacgggttg 202
           ||||||||||||||||||||
Sbjct: 637 acttgcaggtgcacgggttg 618



to top

>gb|AC011436.7|ATAC011436 Arabidopsis thaliana chromosome III BAC F3L24 genomic sequence,
             complete sequence
          Length = 106688

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 360   accctccgcagccgttgccgcacttgca 387
             ||||||| || |||||||||||||||||
Sbjct: 86705 accctccacaaccgttgccgcacttgca 86732



to top

>gb|AC115119.5| Mus musculus BAC clone RP23-87M19 from 18, complete sequence
          Length = 174491

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 136   gtccgtccatccatccatgc 155
             ||||||||||||||||||||
Sbjct: 37154 gtccgtccatccatccatgc 37135



to top

>gb|AC122027.1| Mus musculus BAC clone RP24-390L20 from 1, complete sequence
          Length = 150136

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 136   gtccgtccatccatccatgc 155
             ||||||||||||||||||||
Sbjct: 93144 gtccgtccatccatccatgc 93163



to top

>gb|AY370020.1| Trichoderma viride strain YNUCC0183 endo-1,4-beta-xylanase (XYL1)
           gene, complete cds
          Length = 786

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 99  ggctactactactcgtactg 118
           ||||||||||||||||||||
Sbjct: 133 ggctactactactcgtactg 152



to top

>gb|AY320048.1| Trichoderma viride strain YNUCC0183 endo-1,4-beta-xylanase mRNA,
           complete cds
          Length = 672

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 99  ggctactactactcgtactg 118
           ||||||||||||||||||||
Sbjct: 133 ggctactactactcgtactg 152



to top

>emb|AL034550.31|HS1184F4 Human DNA sequence from clone RP5-1184F4 on chromosome 20q11.1-11.23
             Contains the 3' end of the ASXL1 gene for additional sex
             combs like 1 (Drosophila), the C20orf112 gene for a novel
             protein similar to nucleolar protein 4 (NOL4), a novel
             gene and three CpG islands, complete sequence
          Length = 118873

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 299   agggcctgggaggaggtggc 318
             ||||||||||||||||||||
Sbjct: 33224 agggcctgggaggaggtggc 33205



to top

>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence
          Length = 4074542

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 238     ctcggcggcggcggcctcga 257
               ||||||||||||||||||||
Sbjct: 2127223 ctcggcggcggcggcctcga 2127242



to top

>emb|AL939108.1|SCO939108 Streptomyces coelicolor A3(2) complete genome; segment 5/29
          Length = 339650

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 241    ggcggcggcggcctcgaacg 260
              ||||||||||||||||||||
Sbjct: 247676 ggcggcggcggcctcgaacg 247695



to top

>emb|AL731595.1|OSJN00238 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0041M21,
              complete sequence
          Length = 151218

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 240    cggcggcggcggcctcgaac 259
              ||||||||||||||||||||
Sbjct: 129392 cggcggcggcggcctcgaac 129411



to top

>emb|AL162874.1|ATT1E22 Arabidopsis thaliana DNA chromosome 5, BAC clone T1E22 (ESSA project)
          Length = 96575

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 360   accctccgcagccgttgccgcacttgca 387
             |||||||||| || ||||||||||||||
Sbjct: 56047 accctccgcaaccattgccgcacttgca 56074



to top

>emb|AJ289860.2|LFL289860 Lampetra fluviatilis partial mRNA for keratin gamma
          Length = 2012

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 304 ctgggaggaggtggcggtgg 323
           ||||||||||||||||||||
Sbjct: 379 ctgggaggaggtggcggtgg 398



to top

>emb|AJ843996.1| Plantago major mRNA for metallothionein 4 (mt4 gene)
          Length = 473

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 364 tccgcagccgttgccgcacttgca 387
           |||||||||| |||||||||||||
Sbjct: 130 tccgcagccgctgccgcacttgca 107



to top

>emb|AJ843993.1| Plantago major mRNA for metallothionein 1 (mt1 gene)
          Length = 570

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 364 tccgcagccgttgccgcacttgca 387
           |||||||||| |||||||||||||
Sbjct: 205 tccgcagccgctgccgcacttgca 182



to top

>emb|BX571771.5| Zebrafish DNA sequence from clone CH211-160F8 in linkage group 21,
              complete sequence
          Length = 162245

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 136    gtccgtccatccatccatgc 155
              ||||||||||||||||||||
Sbjct: 121758 gtccgtccatccatccatgc 121739



to top

>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 235     gttctcggcggcggcggcct 254
               ||||||||||||||||||||
Sbjct: 1478799 gttctcggcggcggcggcct 1478780



to top

>emb|AL954696.17| Zebrafish DNA sequence from clone CH211-234K4, complete sequence
          Length = 149858

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 136    gtccgtccatccatccatgc 155
              ||||||||||||||||||||
Sbjct: 107074 gtccgtccatccatccatgc 107093



to top

>emb|BX323849.10| Zebrafish DNA sequence from clone DKEY-107K2 in linkage group 7, complete
              sequence
          Length = 156579

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 136    gtccgtccatccatccatgc 155
              ||||||||||||||||||||
Sbjct: 146603 gtccgtccatccatccatgc 146584



to top

>gb|AE005792.1| Caulobacter crescentus CB15 section 118 of 359 of the complete genome
          Length = 13493

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 236   ttctcggcggcggcggcctc 255
             ||||||||||||||||||||
Sbjct: 12483 ttctcggcggcggcggcctc 12502



to top

>gb|AE005987.1| Caulobacter crescentus CB15 section 313 of 359 of the complete genome
          Length = 10029

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 238  ctcggcggcggcggcctcga 257
            ||||||||||||||||||||
Sbjct: 8871 ctcggcggcggcggcctcga 8890



to top

>tpg|BK002407.1| TPA: TPA_inf: Drosophila melanogaster HDC12548 (HDC12548) gene,
           complete cds
          Length = 288

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 306 gggaggaggtggcggtggtg 325
           ||||||||||||||||||||
Sbjct: 256 gggaggaggtggcggtggtg 237



to top

>gb|CP000133.1| Rhizobium etli CFN 42, complete genome
          Length = 4381608

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 231     cgccgttctcggcggcggcg 250
               ||||||||||||||||||||
Sbjct: 1267323 cgccgttctcggcggcggcg 1267342



to top

>dbj|AB175912.1| Oryza barthii met5 gene for metallothionein, complete cds,
           strain:w607
          Length = 655

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 360 accctccgcagccgttgccgcact 383
           |||| |||||||||||||||||||
Sbjct: 283 acccgccgcagccgttgccgcact 260



to top

>dbj|AB175911.1| Oryza rufipogon met5 gene for metallothionein, complete cds,
           strain:sn
          Length = 655

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 360 accctccgcagccgttgccgcact 383
           |||| |||||||||||||||||||
Sbjct: 283 acccgccgcagccgttgccgcact 260



to top

>dbj|AB175910.1| Oryza rufipogon met5 gene for metallothionein, complete cds,
           strain:cb22
          Length = 546

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 360 accctccgcagccgttgccgcact 383
           |||| |||||||||||||||||||
Sbjct: 182 acccgccgcagccgttgccgcact 159



to top

>dbj|AB175909.1| Oryza rufipogon met5 gene for metallothionein, complete cds,
           strain:yg2a
          Length = 560

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 360 accctccgcagccgttgccgcact 383
           |||| |||||||||||||||||||
Sbjct: 182 acccgccgcagccgttgccgcact 159



to top

>dbj|AB175908.1| Oryza rufipogon met5 gene for metallothionein, complete cds,
           strain:ct56
          Length = 554

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 360 accctccgcagccgttgccgcact 383
           |||| |||||||||||||||||||
Sbjct: 182 acccgccgcagccgttgccgcact 159



to top

>dbj|AB175907.1| Oryza rufipogon met5 gene for metallothionein, complete cds,
           strain:w1976
          Length = 655

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 360 accctccgcagccgttgccgcact 383
           |||| |||||||||||||||||||
Sbjct: 283 acccgccgcagccgttgccgcact 260



to top

>dbj|AB175906.1| Oryza rufipogon met5 gene for metallothionein, complete cds,
           strain:w1972
          Length = 554

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 360 accctccgcagccgttgccgcact 383
           |||| |||||||||||||||||||
Sbjct: 182 acccgccgcagccgttgccgcact 159



to top

>dbj|AB175905.1| Oryza rufipogon met5 gene for metallothionein, complete cds,
           strain:w1967
          Length = 554

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 360 accctccgcagccgttgccgcact 383
           |||| |||||||||||||||||||
Sbjct: 182 acccgccgcagccgttgccgcact 159



to top

>dbj|AB175904.1| Oryza rufipogon met5 gene for metallothionein, complete cds,
           strain:w1965
          Length = 655

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 360 accctccgcagccgttgccgcact 383
           |||| |||||||||||||||||||
Sbjct: 283 acccgccgcagccgttgccgcact 260



to top

>dbj|AB175903.1| Oryza rufipogon met5 gene for metallothionein, complete cds,
           strain:w1964
          Length = 554

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 360 accctccgcagccgttgccgcact 383
           |||| |||||||||||||||||||
Sbjct: 182 acccgccgcagccgttgccgcact 159



to top

>dbj|AB175902.1| Oryza rufipogon met5 gene for metallothioneein, complete cds,
           strain:w1962
          Length = 655

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 360 accctccgcagccgttgccgcact 383
           |||| |||||||||||||||||||
Sbjct: 283 acccgccgcagccgttgccgcact 260



to top

>dbj|AB175901.1| Oryza rufipogon met5 gene for metallothionein, complete cds,
           strain:w1956
          Length = 655

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 360 accctccgcagccgttgccgcact 383
           |||| |||||||||||||||||||
Sbjct: 283 acccgccgcagccgttgccgcact 260



to top

>dbj|AB175900.1| Oryza rufipogon met5 gene for metallothionein, complete cds,
           strain:w630
          Length = 554

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 360 accctccgcagccgttgccgcact 383
           |||| |||||||||||||||||||
Sbjct: 182 acccgccgcagccgttgccgcact 159



to top

>dbj|AB175899.1| Oryza rufipogon met5 gene for metallothionein, complete cds,
           strain:w149
          Length = 554

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 360 accctccgcagccgttgccgcact 383
           |||| |||||||||||||||||||
Sbjct: 182 acccgccgcagccgttgccgcact 159



to top

>dbj|AB175898.1| Oryza rufipogon met5 gene for metallothionein, complete cds,
           strain:w120
          Length = 541

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 360 accctccgcagccgttgccgcact 383
           |||| |||||||||||||||||||
Sbjct: 182 acccgccgcagccgttgccgcact 159



to top

>dbj|AB175897.1| Oryza rufipogon met5 gene for metallothionein, complete cds,
           strain:w593
          Length = 654

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 360 accctccgcagccgttgccgcact 383
           |||| |||||||||||||||||||
Sbjct: 283 acccgccgcagccgttgccgcact 260



to top

>dbj|AB175896.1| Oryza rufipogon met5 gene for metallothionein, complete cds,
           strain:w108
          Length = 655

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 360 accctccgcagccgttgccgcact 383
           |||| |||||||||||||||||||
Sbjct: 283 acccgccgcagccgttgccgcact 260



to top

>gb|AF322486.1|AF322486 Cryptocercus punctulatus 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 316

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 234 cgttctcggcggcggcggcc 253
           ||||||||||||||||||||
Sbjct: 59  cgttctcggcggcggcggcc 78



to top

>gb|AC009512.6| Drosophila melanogaster, chromosome 3R, region 85B-85B, BAC clone
             BACR01F13, complete sequence
          Length = 167467

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 306   gggaggaggtggcggtggtg 325
             ||||||||||||||||||||
Sbjct: 16207 gggaggaggtggcggtggtg 16226



to top

>gb|AC146538.2| Gasterosteus aculeatus clone CH213-118G22, complete sequence
          Length = 211945

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 136    gtccgtccatccatccatgc 155
              ||||||||||||||||||||
Sbjct: 129569 gtccgtccatccatccatgc 129550



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 240      cggcggcggcggcctcgaac 259
                ||||||||||||||||||||
Sbjct: 13135579 cggcggcggcggcctcgaac 13135598


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,255,986
Number of Sequences: 3902068
Number of extensions: 3255986
Number of successful extensions: 100757
Number of sequences better than 10.0: 289
Number of HSP's better than 10.0 without gapping: 292
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 98904
Number of HSP's gapped (non-prelim): 1848
length of query: 388
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 366
effective length of database: 17,147,199,772
effective search space: 6275875116552
effective search space used: 6275875116552
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top