>gb|AY054380.1| Hordeum patagonicum clone HpaLTR-INS Sukkula retrotransposon long
            terminal repeat, complete sequence
          Length = 7731

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 100/122 (81%), Gaps = 1/122 (0%)
 Strand = Plus / Minus

                                                                        
Query: 466  cagagcggcgagggaagtccataggttcgaggacgggcgccagggctggatccggggg-c 524
            ||||||||||  |||||||||  || ||| |||||||| ||| ||| ||||  ||||| |
Sbjct: 1357 cagagcggcggcggaagtccaaggggtcggggacgggcaccacggccggattaggggggc 1298

                                                                        
Query: 525  gtctgcaccatgcctggccgcgaaatcggtcgaggttgaccatggcaacagcggtggagc 584
             ||||| |||| ||||||||||  | ||||| |||  ||||||||||||||||| |||||
Sbjct: 1297 ttctgctccattcctggccgcgggaccggtcaaggccgaccatggcaacagcggcggagc 1238

              
Query: 585  tc 586
            ||
Sbjct: 1237 tc 1236

>gb|CP000088.1| Thermobifida fusca YX, complete genome
          Length = 3642249

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 427     aggcggcgcggcgacgggggtt 448
               ||||||||||||||||||||||
Sbjct: 1667806 aggcggcgcggcgacgggggtt 1667785

>gb|AF334829.1| Homo sapiens mitochondrial RNA-processing endoribonuclease RNA (RMRP)
             gene, complete sequence
          Length = 187856

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 521   gggcgtctgcaccatgcctggc 542
             ||||||||||||||||||||||
Sbjct: 15033 gggcgtctgcaccatgcctggc 15012

>emb|BX255950.7| Zebrafish DNA sequence from clone CH211-250K6 in linkage group 5,
              complete sequence
          Length = 151104

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 72     cacatcattaggagaggatact 93
              ||||||||||||||||||||||
Sbjct: 131968 cacatcattaggagaggatact 131947

>emb|AL133410.32| Human DNA sequence from clone RP11-112J3 on chromosome 9p13.1-13.3
             Contains the 3' end of the CA9 gene for carbonic anhydrase
             IX (MN), the TPM2 gene for tropomyosin 2 (beta) (DA1,
             TMSB, AMCD1), the TLN1 gene for talin 1 (TLN, KIAA1027),
             the CREB3 gene for cAMP responsive element binding protein
             3 (luman) (LZIP, LUMAN, MGC15333, MGC19782), the GBA2 gene
             for glucosidase, beta (bile acid) 2 (AD035, KIAA1605,
             MGC16895, DKFZp762K054), a novel gene (KIAA0258), five
             novel genes, the NPR2 gene for natriuretic peptide
             receptor B/guanylate cyclase B (atrionatriuretic peptide
             receptor B) (NPRB, ANPRB, GUC2B, NPRBi), the SPAG8 gene
             for sperm associated antigen 8 (SMP1, BS-84, HSD-1,
             hSMP-1, MGC26201), the HINT2 gene for Histidine triad
             nucleotide binding protein 2, the gene for NAG-5 protein
             (LOC51754), an olfactory receptor pseudogene, the gene for
             a novel seven transmembrane helix receptor, a NADH
             dehydrogenase (ubiquinone) 1 alpha subcomplex, 5,13kDa
             (B13, NUFM, UQOR13, FLJ12147, CI-13KD-B) (NDUFA5)
             pseudogene and six CpG islands, complete sequence
          Length = 195379

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 521   gggcgtctgcaccatgcctggc 542
             ||||||||||||||||||||||
Sbjct: 96310 gggcgtctgcaccatgcctggc 96331

>gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, complete sequence
          Length = 4895836

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 211     cgaactgctcgttctcgacga 231
               |||||||||||||||||||||
Sbjct: 1195913 cgaactgctcgttctcgacga 1195933

>gb|AC152104.2| Ostreococcus sp. CCE9901 clone JGIACFB-9A2, complete sequence
          Length = 37168

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 421   ggtgcgaggcggcgcggcga 440
             ||||||||||||||||||||
Sbjct: 17125 ggtgcgaggcggcgcggcga 17144

>emb|BX640401.2| Chicken DNA sequence from clone WAG-106I4, complete sequence
          Length = 104753

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 500   gggcgccagggctggatccg 519
             ||||||||||||||||||||
Sbjct: 25117 gggcgccagggctggatccg 25136

>emb|AL354949.10| Human DNA sequence from clone RP11-82L20 on chromosome 1 Contains part of
              the NEGR1 gene for neuronal growth regulator 1 and a novel
              gene, complete sequence
          Length = 180569

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 10     atatagataattacaaactg 29
              ||||||||||||||||||||
Sbjct: 133986 atatagataattacaaactg 134005

>emb|BX640438.1| Bordetella bronchiseptica strain RB50, complete genome; segment 2/16
          Length = 347786

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 425   cgaggcggcgcggcgacggg 444
             ||||||||||||||||||||
Sbjct: 16099 cgaggcggcgcggcgacggg 16118

>emb|BX640424.1| Bordetella parapertussis strain 12822, complete genome; segment 2/14
          Length = 349146

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 425   cgaggcggcgcggcgacggg 444
             ||||||||||||||||||||
Sbjct: 19809 cgaggcggcgcggcgacggg 19828

>dbj|AP007154.1| Aspergillus oryzae RIB40 genomic DNA, SC001
          Length = 2005935

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 557   aggttgaccatggcaacagc 576
             ||||||||||||||||||||
Sbjct: 55110 aggttgaccatggcaacagc 55129

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 424      gcgaggcggcgcggcgacgg 443
                ||||||||||||||||||||
Sbjct: 16454101 gcgaggcggcgcggcgacgg 16454120

>dbj|AP005419.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
              clone:P0046G12
          Length = 189391

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 424    gcgaggcggcgcggcgacgg 443
              ||||||||||||||||||||
Sbjct: 142648 gcgaggcggcgcggcgacgg 142667

>dbj|AK063205.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-112-C12, full
           insert sequence
          Length = 966

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 424 gcgaggcggcgcggcgacgg 443
           ||||||||||||||||||||
Sbjct: 55  gcgaggcggcgcggcgacgg 36


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,363,890
Number of Sequences: 3902068
Number of extensions: 3363890
Number of successful extensions: 119324
Number of sequences better than 10.0: 15
Number of HSP's better than 10.0 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 119163
Number of HSP's gapped (non-prelim): 161
length of query: 586
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 563
effective length of database: 17,143,297,704
effective search space: 9651676607352
effective search space used: 9651676607352
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)