ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal37h14
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|S68729.1| LHC Ib-20=light-harvesting complex I [Hordeum vulga... 335 3e-89
2gb|AF287276.1|AF287276 Hordeum vulgare chlorophyll a/b-binding p... 70 3e-09
3gb|AC019013.2|AC019013 Genomic Sequence For Arabidopsis thaliana... 46 0.043
4gb|AC007852.9| Drosophila melanogaster clone BACR33A10, complete... 42 0.68
5gb|AC007588.5| Drosophila melanogaster clone BACR30O03, complete... 42 0.68
6gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome 42 0.68
7gb|AC159237.2| Mus musculus BAC clone RP24-464G10 from chromosom... 42 0.68
8gb|AF276663.1|AF276663 Drosophila melanogaster comb (cg) gene, c... 42 0.68
9emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid compl... 42 0.68
10gb|AE003815.4| Drosophila melanogaster chromosome 2R, section 35... 42 0.68
11gb|AC127582.4| Mus musculus BAC clone RP24-89J3 from 12, complet... 42 0.68
12gb|AC024608.4| Mus musculus strain C57BL6/J chromosome 5 clone R... 40 2.7
13ref|XM_535195.2| PREDICTED: Canis familiaris similar to inter-al... 40 2.7
14emb|BX469902.7| Zebrafish DNA sequence from clone CH211-277G23 i... 40 2.7
15dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 40 2.7
16gb|AY109341.1| Zea mays CL4601_3 mRNA sequence 40 2.7

>gb|S68729.1| LHC Ib-20=light-harvesting complex I [Hordeum vulgare=barley,
           Prato, mRNA Chloroplast, 939 nt]
          Length = 939

 Score =  335 bits (169), Expect = 3e-89
 Identities = 200/208 (96%), Gaps = 8/208 (3%)
 Strand = Plus / Minus

                                                                       
Query: 4   ctccgtcggaagccatgggcgaatccacaaggacaaagttt-accaccggaactttaaga 62
           ||||||||||||||||||||||||||||||||||||||||| |||||||||||      |
Sbjct: 862 ctccgtcggaagccatgggcgaatccacaaggacaaagtttcaccaccggaac------a 809

                                                                       
Query: 63  ttacaacacgtttttgcactgccacctactcctccacactttgtacatcctcagcacccc 122
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 808 ttacaacacgtttttgcactgccacctactcctccacactttgtacatcctcagcacccc 749

                                                                       
Query: 123 aaaataataattcagaccacctgaaacctccttggtcggtgaaatcgacggatttattgg 182
           |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 748 aaaataataattcagaccacct-aaacctccttggtcggtgaaatcgacggatttattgg 690

                                       
Query: 183 ccggagatggtctggatgatggtgttgt 210
           ||||||||||||||||||||||||||||
Sbjct: 689 ccggagatggtctggatgatggtgttgt 662



to top

>gb|AF287276.1|AF287276 Hordeum vulgare chlorophyll a/b-binding protein precursor (Lhca4)
           mRNA, partial cds; nuclear gene for chloroplast product
          Length = 687

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 176 ttattggccggagatggtctggatgatggtgttgt 210
           |||||||||||||||||||||||||||||||||||
Sbjct: 687 ttattggccggagatggtctggatgatggtgttgt 653



to top

>gb|AC019013.2|AC019013 Genomic Sequence For Arabidopsis thaliana, Clone T5E15, Chromosome V,
             complete sequence
          Length = 114056

 Score = 46.1 bits (23), Expect = 0.043
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 87    cctactcctccacactttgtaca 109
             |||||||||||||||||||||||
Sbjct: 37526 cctactcctccacactttgtaca 37504



to top

>gb|AC007852.9| Drosophila melanogaster clone BACR33A10, complete sequence
          Length = 186333

 Score = 42.1 bits (21), Expect = 0.68
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 81    ctgccacctactcctccacac 101
             |||||||||||||||||||||
Sbjct: 11776 ctgccacctactcctccacac 11756



to top

>gb|AC007588.5| Drosophila melanogaster clone BACR30O03, complete sequence
          Length = 165177

 Score = 42.1 bits (21), Expect = 0.68
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 81    ctgccacctactcctccacac 101
             |||||||||||||||||||||
Sbjct: 60657 ctgccacctactcctccacac 60677



to top

>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 42.1 bits (21), Expect = 0.68
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 191    ggtctggatgatggtgttgtc 211
              |||||||||||||||||||||
Sbjct: 172999 ggtctggatgatggtgttgtc 172979



to top

>gb|AC159237.2| Mus musculus BAC clone RP24-464G10 from chromosome 12, complete
             sequence
          Length = 222209

 Score = 42.1 bits (21), Expect = 0.68
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 114   cagcaccccaaaataataatt 134
             |||||||||||||||||||||
Sbjct: 97909 cagcaccccaaaataataatt 97929



to top

>gb|AF276663.1|AF276663 Drosophila melanogaster comb (cg) gene, complete cds, alternatively
            spliced
          Length = 9504

 Score = 42.1 bits (21), Expect = 0.68
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 81   ctgccacctactcctccacac 101
            |||||||||||||||||||||
Sbjct: 4304 ctgccacctactcctccacac 4324



to top

>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence
          Length = 2094509

 Score = 42.1 bits (21), Expect = 0.68
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 188    gatggtctggatgatggtgtt 208
              |||||||||||||||||||||
Sbjct: 631602 gatggtctggatgatggtgtt 631582



to top

>gb|AE003815.4| Drosophila melanogaster chromosome 2R, section 35 of 73 of the complete
             sequence
          Length = 229685

 Score = 42.1 bits (21), Expect = 0.68
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 81    ctgccacctactcctccacac 101
             |||||||||||||||||||||
Sbjct: 31518 ctgccacctactcctccacac 31538



to top

>gb|AC127582.4| Mus musculus BAC clone RP24-89J3 from 12, complete sequence
          Length = 217949

 Score = 42.1 bits (21), Expect = 0.68
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 114  cagcaccccaaaataataatt 134
            |||||||||||||||||||||
Sbjct: 9849 cagcaccccaaaataataatt 9829



to top

>gb|AC024608.4| Mus musculus strain C57BL6/J chromosome 5 clone RP23-333I24, complete
              sequence
          Length = 215829

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 108    catcctcagcaccccaaaat 127
              ||||||||||||||||||||
Sbjct: 132164 catcctcagcaccccaaaat 132183



to top

>ref|XM_535195.2| PREDICTED: Canis familiaris similar to inter-alpha globulin
           inhibitor H2 polypeptide (LOC478011), mRNA
          Length = 2941

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 190 tggtctggatgatggtgttg 209
           ||||||||||||||||||||
Sbjct: 377 tggtctggatgatggtgttg 358



to top

>emb|BX469902.7| Zebrafish DNA sequence from clone CH211-277G23 in linkage group 9,
             complete sequence
          Length = 179135

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 117   caccccaaaataataattca 136
             ||||||||||||||||||||
Sbjct: 16903 caccccaaaataataattca 16922



to top

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 183     ccggagatggtctggatgatggtg 206
               ||||||||||||||||||| ||||
Sbjct: 5018847 ccggagatggtctggatgagggtg 5018824



to top

>gb|AY109341.1| Zea mays CL4601_3 mRNA sequence
          Length = 1460

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 191 ggtctggatgatggtgttgt 210
           ||||||||||||||||||||
Sbjct: 280 ggtctggatgatggtgttgt 299


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,039,852
Number of Sequences: 3902068
Number of extensions: 2039852
Number of successful extensions: 135218
Number of sequences better than 10.0: 16
Number of HSP's better than 10.0 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 135121
Number of HSP's gapped (non-prelim): 96
length of query: 211
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 189
effective length of database: 17,147,199,772
effective search space: 3240820756908
effective search space used: 3240820756908
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top