ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbaal8g17 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC140301.3| Mus musculus BAC clone RP23-435M8 from 5, complete sequence Length = 197633 Score = 48.1 bits (24), Expect = 0.039 Identities = 24/24 (100%) Strand = Plus / Plus Query: 149 aaatggaataaattgttttaagta 172 |||||||||||||||||||||||| Sbjct: 90563 aaatggaataaattgttttaagta 90586
>gb|BC067272.1| Homo sapiens fragile X mental retardation, autosomal homolog 2, mRNA (cDNA clone MGC:75052 IMAGE:6204341), complete cds Length = 2948 Score = 44.1 bits (22), Expect = 0.61 Identities = 22/22 (100%) Strand = Plus / Minus Query: 344 ggagggaggaggaggagctctc 365 |||||||||||||||||||||| Sbjct: 1568 ggagggaggaggaggagctctc 1547
>gb|BC051907.1| Homo sapiens fragile X mental retardation, autosomal homolog 2, mRNA (cDNA clone MGC:60375 IMAGE:6149976), complete cds Length = 2813 Score = 44.1 bits (22), Expect = 0.61 Identities = 22/22 (100%) Strand = Plus / Minus Query: 344 ggagggaggaggaggagctctc 365 |||||||||||||||||||||| Sbjct: 1454 ggagggaggaggaggagctctc 1433
>ref|NM_014757.3| Homo sapiens mastermind-like 1 (Drosophila) (MAML1), mRNA Length = 5745 Score = 44.1 bits (22), Expect = 0.61 Identities = 22/22 (100%) Strand = Plus / Minus Query: 341 ttgggagggaggaggaggagct 362 |||||||||||||||||||||| Sbjct: 4042 ttgggagggaggaggaggagct 4021
>emb|AL390060.14| Human DNA sequence from clone RP11-56H2 on chromosome Xp11.22-11.3 Contains a pseudogene similar to part of p30 (nuclear protein p30), a novel gene and a CpG island, complete sequence Length = 135378 Score = 44.1 bits (22), Expect = 0.61 Identities = 22/22 (100%) Strand = Plus / Plus Query: 79 aacaaaatatggtggggaaaaa 100 |||||||||||||||||||||| Sbjct: 86283 aacaaaatatggtggggaaaaa 86304
>gb|AC113426.2| Homo sapiens chromosome 5 clone RP11-718N2, complete sequence Length = 179627 Score = 44.1 bits (22), Expect = 0.61 Identities = 22/22 (100%) Strand = Plus / Minus Query: 341 ttgggagggaggaggaggagct 362 |||||||||||||||||||||| Sbjct: 164963 ttgggagggaggaggaggagct 164942
>gb|BT009817.1| Homo sapiens fragile X mental retardation, autosomal homolog 2 mRNA, complete cds Length = 2022 Score = 44.1 bits (22), Expect = 0.61 Identities = 22/22 (100%) Strand = Plus / Minus Query: 344 ggagggaggaggaggagctctc 365 |||||||||||||||||||||| Sbjct: 1258 ggagggaggaggaggagctctc 1237
>gb|AC099536.3| Homo sapiens chromosome 3 clone RP11-27C2, complete sequence Length = 170561 Score = 44.1 bits (22), Expect = 0.61 Identities = 22/22 (100%) Strand = Plus / Minus Query: 659 ctttctagttgtgaagatgatg 680 |||||||||||||||||||||| Sbjct: 48498 ctttctagttgtgaagatgatg 48477
>emb|AL766848.1|SAG766848 Streptococcus agalactiae NEM316 complete genome, segment 6 Length = 233050 Score = 44.1 bits (22), Expect = 0.61 Identities = 25/26 (96%) Strand = Plus / Plus Query: 633 cagaagcatccttgatcatctcttca 658 ||||||||||||||||||| |||||| Sbjct: 204347 cagaagcatccttgatcatttcttca 204372
>emb|AL590450.1|CNS07EGH chromosome XI of strain GB-M1 of Encephalitozoon cuniculi (Microspora) Length = 267509 Score = 44.1 bits (22), Expect = 0.61 Identities = 22/22 (100%) Strand = Plus / Minus Query: 339 ctttgggagggaggaggaggag 360 |||||||||||||||||||||| Sbjct: 28434 ctttgggagggaggaggaggag 28413
>ref|NM_004860.2| Homo sapiens fragile X mental retardation, autosomal homolog 2 (FXR2), mRNA Length = 2895 Score = 44.1 bits (22), Expect = 0.61 Identities = 22/22 (100%) Strand = Plus / Minus Query: 344 ggagggaggaggaggagctctc 365 |||||||||||||||||||||| Sbjct: 1485 ggagggaggaggaggagctctc 1464
>gb|AC021118.6| Homo sapiens BAC clone RP11-332D24 from 4, complete sequence Length = 194612 Score = 44.1 bits (22), Expect = 0.61 Identities = 22/22 (100%) Strand = Plus / Minus Query: 153 ggaataaattgttttaagtact 174 |||||||||||||||||||||| Sbjct: 14751 ggaataaattgttttaagtact 14730
>gb|AC008393.7| Homo sapiens chromosome 5 clone CTC-241N9, complete sequence Length = 166847 Score = 44.1 bits (22), Expect = 0.61 Identities = 22/22 (100%) Strand = Plus / Minus Query: 341 ttgggagggaggaggaggagct 362 |||||||||||||||||||||| Sbjct: 34958 ttgggagggaggaggaggagct 34937
>dbj|AK148794.1| Mus musculus 2 days neonate sympathetic ganglion cDNA, RIKEN full-length enriched library, clone:7120447A22 product:unclassifiable, full insert sequence Length = 3661 Score = 44.1 bits (22), Expect = 0.61 Identities = 22/22 (100%) Strand = Plus / Minus Query: 343 gggagggaggaggaggagctct 364 |||||||||||||||||||||| Sbjct: 636 gggagggaggaggaggagctct 615
>dbj|AK042485.1| Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A630095O16 product:unclassifiable, full insert sequence Length = 3301 Score = 44.1 bits (22), Expect = 0.61 Identities = 22/22 (100%) Strand = Plus / Minus Query: 343 gggagggaggaggaggagctct 364 |||||||||||||||||||||| Sbjct: 1305 gggagggaggaggaggagctct 1284
>gb|AF343879.1|AF343879 Streptococcus agalactiae peptide chain release factor 1 gene, complete cds Length = 1389 Score = 44.1 bits (22), Expect = 0.61 Identities = 25/26 (96%) Strand = Plus / Minus Query: 633 cagaagcatccttgatcatctcttca 658 ||||||||||||||||||| |||||| Sbjct: 248 cagaagcatccttgatcatttcttca 223
>gb|AF221759.1|AF221759 Homo sapiens Mam1 mRNA, partial cds Length = 5085 Score = 44.1 bits (22), Expect = 0.61 Identities = 22/22 (100%) Strand = Plus / Minus Query: 341 ttgggagggaggaggaggagct 362 |||||||||||||||||||||| Sbjct: 3409 ttgggagggaggaggaggagct 3388
>gb|BC047937.1| Homo sapiens mastermind-like 1 (Drosophila), mRNA (cDNA clone IMAGE:6065699), with apparent retained intron Length = 5437 Score = 44.1 bits (22), Expect = 0.61 Identities = 22/22 (100%) Strand = Plus / Minus Query: 341 ttgggagggaggaggaggagct 362 |||||||||||||||||||||| Sbjct: 3707 ttgggagggaggaggaggagct 3686
>gb|AY888834.1| Synthetic construct Homo sapiens clone FLH109732.01X fragile X mental retardation autosomal-like 2 (FXR2) mRNA, complete cds Length = 2022 Score = 44.1 bits (22), Expect = 0.61 Identities = 22/22 (100%) Strand = Plus / Minus Query: 344 ggagggaggaggaggagctctc 365 |||||||||||||||||||||| Sbjct: 1258 ggagggaggaggaggagctctc 1237
>gb|AY888833.1| Synthetic construct Homo sapiens clone FLH109737.01X fragile X mental retardation autosomal-like 2 (FXR2) mRNA, complete cds Length = 2022 Score = 44.1 bits (22), Expect = 0.61 Identities = 22/22 (100%) Strand = Plus / Minus Query: 344 ggagggaggaggaggagctctc 365 |||||||||||||||||||||| Sbjct: 1258 ggagggaggaggaggagctctc 1237
>gb|AY888832.1| Synthetic construct Homo sapiens clone FLH109736.01X fragile X mental retardation autosomal-like 2 (FXR2) mRNA, complete cds Length = 2022 Score = 44.1 bits (22), Expect = 0.61 Identities = 22/22 (100%) Strand = Plus / Minus Query: 344 ggagggaggaggaggagctctc 365 |||||||||||||||||||||| Sbjct: 1258 ggagggaggaggaggagctctc 1237
>dbj|D83785.1| Homo sapiens mRNA for KIAA0200 gene, partial cds Length = 5713 Score = 44.1 bits (22), Expect = 0.61 Identities = 22/22 (100%) Strand = Plus / Minus Query: 341 ttgggagggaggaggaggagct 362 |||||||||||||||||||||| Sbjct: 4041 ttgggagggaggaggaggagct 4020
>gb|BC020090.1| Homo sapiens fragile X mental retardation, autosomal homolog 2, mRNA (cDNA clone MGC:21187 IMAGE:4385430), complete cds Length = 2928 Score = 44.1 bits (22), Expect = 0.61 Identities = 22/22 (100%) Strand = Plus / Minus Query: 344 ggagggaggaggaggagctctc 365 |||||||||||||||||||||| Sbjct: 1577 ggagggaggaggaggagctctc 1556
>gb|AC007421.12|AC007421 Homo sapiens chromosome 17, clone hRPC.1030_O_14, complete sequence Length = 95240 Score = 44.1 bits (22), Expect = 0.61 Identities = 22/22 (100%) Strand = Plus / Minus Query: 344 ggagggaggaggaggagctctc 365 |||||||||||||||||||||| Sbjct: 78698 ggagggaggaggaggagctctc 78677
>gb|AC119950.13| Mus musculus chromosome 12, clone RP24-447F7, complete sequence Length = 174067 Score = 44.1 bits (22), Expect = 0.61 Identities = 22/22 (100%) Strand = Plus / Plus Query: 343 gggagggaggaggaggagctct 364 |||||||||||||||||||||| Sbjct: 61260 gggagggaggaggaggagctct 61281
>gb|U31501.1|HSU31501 Human fragile X mental retardation syndrome related protein (FXR2) mRNA, complete cds Length = 2902 Score = 44.1 bits (22), Expect = 0.61 Identities = 22/22 (100%) Strand = Plus / Minus Query: 344 ggagggaggaggaggagctctc 365 |||||||||||||||||||||| Sbjct: 1485 ggagggaggaggaggagctctc 1464
>gb|AF020503.1|AF020503 Homo sapiens FRA3B common fragile region, diadenosine triphosphate hydrolase (FHIT) gene, exon 5 Length = 206880 Score = 44.1 bits (22), Expect = 0.61 Identities = 22/22 (100%) Strand = Plus / Minus Query: 659 ctttctagttgtgaagatgatg 680 |||||||||||||||||||||| Sbjct: 32988 ctttctagttgtgaagatgatg 32967
>gb|AC016876.10| Homo sapiens chromosome 17, clone RP11-186B7, complete sequence Length = 60268 Score = 44.1 bits (22), Expect = 0.61 Identities = 22/22 (100%) Strand = Plus / Minus Query: 344 ggagggaggaggaggagctctc 365 |||||||||||||||||||||| Sbjct: 897 ggagggaggaggaggagctctc 876
>gb|BC103721.1| Homo sapiens sorting nexin 11, transcript variant 2, mRNA (cDNA clone MGC:111019 IMAGE:6162638), complete cds Length = 2139 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 353 aggaggagctctccctcaccg 373 ||||||||||||||||||||| Sbjct: 638 aggaggagctctccctcaccg 658
>gb|AC156570.2| Mus musculus BAC clone RP23-242N11 from chromosome 3, complete sequence Length = 198738 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 499 cccagctttaccagacatgct 519 ||||||||||||||||||||| Sbjct: 69031 cccagctttaccagacatgct 69011
>ref|XM_614374.2| PREDICTED: Bos taurus similar to Sorting nexin-11 (LOC534567), mRNA Length = 1129 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 353 aggaggagctctccctcaccg 373 ||||||||||||||||||||| Sbjct: 856 aggaggagctctccctcaccg 876
>gb|BC000768.2| Homo sapiens sorting nexin 11, transcript variant 1, mRNA (cDNA clone MGC:2818 IMAGE:2963905), complete cds Length = 2151 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 353 aggaggagctctccctcaccg 373 ||||||||||||||||||||| Sbjct: 649 aggaggagctctccctcaccg 669
>ref|NM_152244.1| Homo sapiens sorting nexin 11 (SNX11), transcript variant 1, mRNA Length = 2402 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 353 aggaggagctctccctcaccg 373 ||||||||||||||||||||| Sbjct: 919 aggaggagctctccctcaccg 939
>ref|NM_013323.2| Homo sapiens sorting nexin 11 (SNX11), transcript variant 2, mRNA Length = 2315 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 353 aggaggagctctccctcaccg 373 ||||||||||||||||||||| Sbjct: 832 aggaggagctctccctcaccg 852
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 345 gagggaggaggaggagctctccctc 369 |||||||||||||||||||| |||| Sbjct: 2996707 gagggaggaggaggagctctgcctc 2996683
>gb|AC141481.4| Mus musculus BAC clone RP23-145E16 from chromosome 15, complete sequence Length = 195197 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 515 atgctaataactgttgcatgatgag 539 |||||||||||||||||| |||||| Sbjct: 165138 atgctaataactgttgcaggatgag 165114
>gb|AC130840.3| Mus musculus BAC clone RP24-443G4 from chromosome 3, complete sequence Length = 175133 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 499 cccagctttaccagacatgct 519 ||||||||||||||||||||| Sbjct: 52913 cccagctttaccagacatgct 52893
>gb|AC164633.2| Mus musculus chromosome 15, clone RP24-374C19, complete sequence Length = 157653 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 515 atgctaataactgttgcatgatgag 539 |||||||||||||||||| |||||| Sbjct: 144531 atgctaataactgttgcaggatgag 144555
>gb|BT007994.1| Synthetic construct Homo sapiens sorting nexin 11 mRNA, partial cds Length = 813 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 353 aggaggagctctccctcaccg 373 ||||||||||||||||||||| Sbjct: 565 aggaggagctctccctcaccg 585
>gb|BT006723.1| Homo sapiens sorting nexin 11 mRNA, complete cds Length = 813 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 353 aggaggagctctccctcaccg 373 ||||||||||||||||||||| Sbjct: 565 aggaggagctctccctcaccg 585
>gb|AC105730.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0011L14, complete sequence Length = 117974 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 345 gagggaggaggaggagctctccctc 369 |||||||||||||||||||| |||| Sbjct: 99554 gagggaggaggaggagctctgcctc 99578
>dbj|AK091852.1| Homo sapiens cDNA FLJ34533 fis, clone HLUNG2008247, highly similar to Homo sapiens sorting nexin 11 (SNX11) mRNA Length = 2300 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 353 aggaggagctctccctcaccg 373 ||||||||||||||||||||| Sbjct: 817 aggaggagctctccctcaccg 837
>emb|CR593364.1| full-length cDNA clone CS0DK007YF06 of HeLa cells Cot 25-normalized of Homo sapiens (human) Length = 2122 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 353 aggaggagctctccctcaccg 373 ||||||||||||||||||||| Sbjct: 642 aggaggagctctccctcaccg 662
>dbj|AK023932.1| Homo sapiens cDNA FLJ13870 fis, clone THYRO1001313, highly similar to Homo sapiens sorting nexin 11 (SNX11) mRNA Length = 2402 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 353 aggaggagctctccctcaccg 373 ||||||||||||||||||||| Sbjct: 919 aggaggagctctccctcaccg 939
>gb|AF121861.1|AF121861 Homo sapiens sorting nexin 11 (SNX11) mRNA, complete cds Length = 2333 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 353 aggaggagctctccctcaccg 373 ||||||||||||||||||||| Sbjct: 852 aggaggagctctccctcaccg 872
>gb|AC025765.6| Homo sapiens chromosome 5 clone CTB-57H20, complete sequence Length = 218515 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 249 aggcaaatgtagcatcagaaa 269 ||||||||||||||||||||| Sbjct: 45370 aggcaaatgtagcatcagaaa 45350
>gb|AC134233.3| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0016I15, complete sequence Length = 166282 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 345 gagggaggaggaggagctctccctc 369 |||||||||||||||||||| |||| Sbjct: 134173 gagggaggaggaggagctctgcctc 134149
>gb|AC025040.7|AC025040 Homo sapiens chromosome 15 clone CTD-2647E9 map 15q21.1, complete sequence Length = 173394 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 265 agaaatgacaccagaaaactgctct 289 |||||||||| |||||||||||||| Sbjct: 100142 agaaatgacagcagaaaactgctct 100166
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 90 gtggggaaaaagaaatgcatg 110 ||||||||||||||||||||| Sbjct: 2214605 gtggggaaaaagaaatgcatg 2214585
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 345 gagggaggaggaggagctctccctc 369 |||||||||||||||||||| |||| Sbjct: 2996797 gagggaggaggaggagctctgcctc 2996773
>emb|AL731602.3|OSJN00251 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0059H15, complete sequence Length = 149181 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 90 gtggggaaaaagaaatgcatg 110 ||||||||||||||||||||| Sbjct: 129233 gtggggaaaaagaaatgcatg 129213
>gb|AC122134.4| Homo sapiens BAC clone RP11-309M7 from 2, complete sequence Length = 15049 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 40 caaggaacacactggagatgc 60 ||||||||||||||||||||| Sbjct: 11285 caaggaacacactggagatgc 11265
>gb|AF186997.6| Homo sapiens chromosome 8 clone CTA-398F10 map p22-p21, complete sequence Length = 162504 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 96 aaaaagaaatgcatgggggca 116 ||||||||||||||||||||| Sbjct: 73833 aaaaagaaatgcatgggggca 73813
>gb|AC006468.10| Homo sapiens chromosome 17, clone RP5-159F22, complete sequence Length = 91672 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 353 aggaggagctctccctcaccg 373 ||||||||||||||||||||| Sbjct: 59954 aggaggagctctccctcaccg 59934
>gb|AC103957.8| Homo sapiens chromosome 8, clone CTA-398F10, complete sequence Length = 162398 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 96 aaaaagaaatgcatgggggca 116 ||||||||||||||||||||| Sbjct: 88673 aaaaagaaatgcatgggggca 88693
>gb|AY891369.1| Synthetic construct Homo sapiens clone FLH024094.01L sorting nexin 11 (SNX11) mRNA, partial cds Length = 813 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 353 aggaggagctctccctcaccg 373 ||||||||||||||||||||| Sbjct: 565 aggaggagctctccctcaccg 585
>gb|AY888711.1| Synthetic construct Homo sapiens clone FLH024098.01X sorting nexin 11 (SNX11) mRNA, complete cds Length = 813 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 353 aggaggagctctccctcaccg 373 ||||||||||||||||||||| Sbjct: 565 aggaggagctctccctcaccg 585
>gb|AY888710.1| Synthetic construct Homo sapiens clone FLH024097.01X sorting nexin 11 (SNX11) mRNA, complete cds Length = 813 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 353 aggaggagctctccctcaccg 373 ||||||||||||||||||||| Sbjct: 565 aggaggagctctccctcaccg 585
>gb|AC161167.13| Mus musculus chromosome 18, clone RP24-338L8, complete sequence Length = 136966 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 340 tttgggagggaggaggaggag 360 ||||||||||||||||||||| Sbjct: 40087 tttgggagggaggaggaggag 40067
>emb|AL731612.3|OSJN00254 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0070D17, complete sequence Length = 163376 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 90 gtggggaaaaagaaatgcatg 110 ||||||||||||||||||||| Sbjct: 39612 gtggggaaaaagaaatgcatg 39592
>dbj|AP004503.1| Lotus japonicus genomic DNA, chromosome 5, clone:LjT02M03, TM0034a, complete sequence Length = 83232 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 72 caagagaaacaaaatatggtg 92 ||||||||||||||||||||| Sbjct: 15547 caagagaaacaaaatatggtg 15567
>emb|AL713989.20| Mouse DNA sequence from clone RP23-5I4 on chromosome 5, complete sequence Length = 215210 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 340 tttgggagggaggaggaggag 360 ||||||||||||||||||||| Sbjct: 37090 tttgggagggaggaggaggag 37070
>gb|AC121298.10| Mus musculus chromosome 5, clone RP23-377E6, complete sequence Length = 194045 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 343 gggagggaggaggaggagct 362 |||||||||||||||||||| Sbjct: 97947 gggagggaggaggaggagct 97966
>ref|XM_528662.1| PREDICTED: Pan troglodytes similar to Immunoglobulin lambda-like polypeptide 1 precursor (Immunoglobulin-related 14.1 protein) (Immunoglobulin omega polypeptide) (Lambda 5) (CD179b antigen) (LOC473291), mRNA Length = 2016 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 344 ggagggaggaggaggagctc 363 |||||||||||||||||||| Sbjct: 1106 ggagggaggaggaggagctc 1125
>gb|AC137611.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0020H14, complete sequence Length = 185623 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 348 ggaggaggaggagctctccc 367 |||||||||||||||||||| Sbjct: 124253 ggaggaggaggagctctccc 124272
>gb|CP000099.1| Methanosarcina barkeri str. fusaro chromosome 1, complete sequence Length = 4837408 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 426 tgatgctgaggcttttgtct 445 |||||||||||||||||||| Sbjct: 988942 tgatgctgaggcttttgtct 988923
>ref|XM_364715.1| Magnaporthe grisea 70-15 hypothetical protein (MG09560.4) partial mRNA Length = 3738 Score = 40.1 bits (20), Expect = 9.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 322 gcaacaaggttgcaaagctttggg 345 |||||||||||||| ||||||||| Sbjct: 362 gcaacaaggttgcacagctttggg 385
>ref|XM_366131.1| Magnaporthe grisea 70-15 hypothetical protein (MG10351.4) partial mRNA Length = 1563 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 359 agctctccctcaccgttgct 378 |||||||||||||||||||| Sbjct: 878 agctctccctcaccgttgct 897
>gb|DQ493941.1| Magnaporthe grisea 70-15 clone 69K09 telomere region, partial sequence Length = 46711 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 359 agctctccctcaccgttgct 378 |||||||||||||||||||| Sbjct: 16810 agctctccctcaccgttgct 16829
>ref|NM_010236.1| Mus musculus folylpolyglutamyl synthetase (Fpgs), mRNA Length = 2216 Score = 40.1 bits (20), Expect = 9.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 335 aaagctttgggagggaggaggagg 358 ||||| |||||||||||||||||| Sbjct: 2098 aaagcattgggagggaggaggagg 2075
>gb|DQ002407.1| Zea mays copia retrotransposon opie1, gypsy retrotransposon grande1, xilon1 retrotransposon, helitron B73_14578, gypsy retrotransposon huck1 and ruda retrotransposon, complete sequence Length = 152384 Score = 40.1 bits (20), Expect = 9.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 344 ggagggaggaggaggagctctccc 367 ||||||||||||||||||| |||| Sbjct: 87923 ggagggaggaggaggagctttccc 87900
>gb|BC005484.1| Mus musculus folylpolyglutamyl synthetase, mRNA (cDNA clone MGC:7296 IMAGE:3485401), complete cds Length = 2215 Score = 40.1 bits (20), Expect = 9.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 335 aaagctttgggagggaggaggagg 358 ||||| |||||||||||||||||| Sbjct: 2088 aaagcattgggagggaggaggagg 2065
>gb|AC127573.4| Mus musculus BAC clone RP24-231H7 from chromosome 9, complete sequence Length = 148263 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 40 caaggaacacactggagatg 59 |||||||||||||||||||| Sbjct: 66160 caaggaacacactggagatg 66141
>gb|AC126439.3| Mus musculus BAC clone RP24-290I17 from chromosome 14, complete sequence Length = 163978 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 654 cttcactttctagttgtgaa 673 |||||||||||||||||||| Sbjct: 104747 cttcactttctagttgtgaa 104766
>gb|AC111647.10| Rattus norvegicus 4 BAC CH230-103E9 (Children's Hospital Oakland Research Institute) complete sequence Length = 232538 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 97 aaaagaaatgcatgggggca 116 |||||||||||||||||||| Sbjct: 5210 aaaagaaatgcatgggggca 5191
>emb|AL590639.9| Human DNA sequence from clone RP11-496H15 on chromosome 1 Contains the 3' end of the gene for retinoid binding protein 7 (CRBPIV), the 5' end of the UBE4B gene for ubiquitination factor E4B (UFD2 homolog, yeast), a pseudogene similar to part of ribosomal protein L21 (RPL21) and a pseudogene similar to part of phosphoglycerate mutase, complete sequence Length = 96075 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 71 ccaagagaaacaaaatatgg 90 |||||||||||||||||||| Sbjct: 46651 ccaagagaaacaaaatatgg 46632
>ref|XM_785136.1| PREDICTED: Strongylocentrotus purpuratus similar to Structural maintenance of chromosome 2-like 1 protein (Chromosome-associated protein E) (hCAP-E) (XCAP-E homolog) (LOC585303), partial mRNA Length = 279 Score = 40.1 bits (20), Expect = 9.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 635 gaagcatccttgatcatctcttca 658 ||||||||||||||| |||||||| Sbjct: 218 gaagcatccttgatcttctcttca 195
>emb|AL078622.7|HSDJ925J7 Human DNA sequence from clone RP5-925J7 on chromosome 22, complete sequence Length = 98447 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 342 tgggagggaggaggaggagc 361 |||||||||||||||||||| Sbjct: 88263 tgggagggaggaggaggagc 88244
>ref|XM_775232.1| PREDICTED: Strongylocentrotus purpuratus similar to Structural maintenance of chromosome 2-like 1 protein (Chromosome-associated protein E) (XCAP-E homolog) (FGF-inducible protein 16) (LOC574836), mRNA Length = 2571 Score = 40.1 bits (20), Expect = 9.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 635 gaagcatccttgatcatctcttca 658 ||||||||||||||| |||||||| Sbjct: 1283 gaagcatccttgatcttctcttca 1260
>emb|AL772148.6| Zebrafish DNA sequence from clone CH211-153C20 in linkage group 24 Contains part of a novel gene similar to human DECR2 (peroxisomal 2,4-dienoyl CoA reductase 2), a novel gene similar to human KIAA0665, a novel gene similar to human KIAA0683, a novel gene similar to human KIAA0590, part of a novel gene and three CpG islands, complete sequence Length = 161218 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 69 ttccaagagaaacaaaatat 88 |||||||||||||||||||| Sbjct: 22579 ttccaagagaaacaaaatat 22560
>emb|BX294098.11| Zebrafish DNA sequence from clone CH211-254P12 in linkage group 24, complete sequence Length = 152545 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 69 ttccaagagaaacaaaatat 88 |||||||||||||||||||| Sbjct: 10694 ttccaagagaaacaaaatat 10713
>emb|AL627097.6| Mouse DNA sequence from clone RP23-59B16 on chromosome 11 Contains a novel pseudogene, the Zfp287 gene for zinc finger protein 287, three novel genes (4921522H14Rik), a WD repeat and SOCS box containing protein 2 pseudogene (LOC213946), the gene for a novel protein (MGC39058) and the 5' end of the Trim16 gene for tripartite motif protein 16, complete sequence Length = 161686 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 458 ccaaccttgtcttctcctgt 477 |||||||||||||||||||| Sbjct: 62307 ccaaccttgtcttctcctgt 62288
>gb|AC114321.2| Homo sapiens chromosome 5 clone RP11-710L15, complete sequence Length = 158109 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 ttgtcttctcctgtgttgct 483 |||||||||||||||||||| Sbjct: 111944 ttgtcttctcctgtgttgct 111925
>emb|AL121750.22|HSJ323A24 Human DNA sequence from clone RP3-323A24 on chromosome 4, complete sequence Length = 149969 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 345 gagggaggaggaggagctct 364 |||||||||||||||||||| Sbjct: 29186 gagggaggaggaggagctct 29167
>gb|AC067745.7| Homo sapiens chromosome 10 clone RP11-417C21, complete sequence Length = 156140 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 641 tccttgatcatctcttcact 660 |||||||||||||||||||| Sbjct: 152857 tccttgatcatctcttcact 152876
>gb|AC093561.2| Homo sapiens chromosome 1 clone RP11-401A10, complete sequence Length = 184330 Score = 40.1 bits (20), Expect = 9.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 645 tgatcatctcttcactttctagtt 668 ||||| |||||||||||||||||| Sbjct: 119186 tgatcctctcttcactttctagtt 119163
>gb|AC099791.2| Homo sapiens chromosome 1 clone RP11-430G17, complete sequence Length = 239704 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 644 ttgatcatctcttcactttc 663 |||||||||||||||||||| Sbjct: 7071 ttgatcatctcttcactttc 7052
>gb|AC008499.8| Homo sapiens chromosome 5 clone CTC-438O3, complete sequence Length = 244525 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 ttgtcttctcctgtgttgct 483 |||||||||||||||||||| Sbjct: 9615 ttgtcttctcctgtgttgct 9596
>dbj|AK157040.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched library, clone:F830114J03 product:folylpolyglutamyl synthetase, full insert sequence Length = 2223 Score = 40.1 bits (20), Expect = 9.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 335 aaagctttgggagggaggaggagg 358 ||||| |||||||||||||||||| Sbjct: 2106 aaagcattgggagggaggaggagg 2083
>gb|AC099605.9| Mus musculus chromosome 18, clone RP23-349G24, complete sequence Length = 203175 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 328 aggttgcaaagctttgggag 347 |||||||||||||||||||| Sbjct: 102832 aggttgcaaagctttgggag 102813
>gb|AC159643.2| Mus musculus BAC clone RP23-384H10 from chromosome 12, complete sequence Length = 200939 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 453 ctgagccaaccttgtcttct 472 |||||||||||||||||||| Sbjct: 197473 ctgagccaaccttgtcttct 197492
>dbj|AK041952.1| Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A630048J24 product:folylpolyglutamyl synthetase, full insert sequence Length = 2405 Score = 40.1 bits (20), Expect = 9.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 335 aaagctttgggagggaggaggagg 358 ||||| |||||||||||||||||| Sbjct: 2288 aaagcattgggagggaggaggagg 2265
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 ttgggagggaggaggaggag 360 |||||||||||||||||||| Sbjct: 16582260 ttgggagggaggaggaggag 16582241
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 348 ggaggaggaggagctctccc 367 |||||||||||||||||||| Sbjct: 21570397 ggaggaggaggagctctccc 21570416
>gb|AC023274.2|AC023274 Homo sapiens clone RP11-307L15, complete sequence Length = 137682 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 551 ttttgtacttcgtcacacgt 570 |||||||||||||||||||| Sbjct: 20238 ttttgtacttcgtcacacgt 20257
>gb|AC157586.2| Mus musculus BAC clone RP24-406D13 from chromosome 9, complete sequence Length = 218664 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 40 caaggaacacactggagatg 59 |||||||||||||||||||| Sbjct: 20044 caaggaacacactggagatg 20063
>gb|U78169.1| Homo sapiens cAMP-regulated guanine nucleotide exchange factor I mRNA, complete cds, alternatively spliced Length = 4109 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 342 tgggagggaggaggaggagc 361 |||||||||||||||||||| Sbjct: 3325 tgggagggaggaggaggagc 3344
>gb|AC160211.1| Genomic seqeunce for Zea mays BAC clone ZMMBBb0448F23, complete sequence Length = 132549 Score = 40.1 bits (20), Expect = 9.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 344 ggagggaggaggaggagctctccc 367 ||||||||||||||||||| |||| Sbjct: 129480 ggagggaggaggaggagctttccc 129503
>gb|AC007562.4|AC007562 Homo sapiens BAC clone RP11-497C14 from Y, complete sequence Length = 137077 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 551 ttttgtacttcgtcacacgt 570 |||||||||||||||||||| Sbjct: 80236 ttttgtacttcgtcacacgt 80217
>gb|AC022148.6| Homo sapiens chromosome 19 clone CTD-3064H18, complete sequence Length = 196954 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 85 atatggtggggaaaaagaaa 104 |||||||||||||||||||| Sbjct: 136975 atatggtggggaaaaagaaa 136994
>gb|AC004241.2| Homo sapiens 12 PAC RP3-197B17 (Roswell Park Cancer Institute Human PAC Library) complete sequence Length = 136877 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 342 tgggagggaggaggaggagc 361 |||||||||||||||||||| Sbjct: 112940 tgggagggaggaggaggagc 112921
>ref|NG_004755.1| Homo sapiens chromosome Y palindromes P1, P2, P3 and inverted repeat IR2 (P1-P2-P3-IR2@) on chromosome Y Length = 4538292 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 551 ttttgtacttcgtcacacgt 570 |||||||||||||||||||| Sbjct: 3780156 ttttgtacttcgtcacacgt 3780137 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 551 ttttgtacttcgtcacacgt 570 |||||||||||||||||||| Sbjct: 2268207 ttttgtacttcgtcacacgt 2268226
>gb|AF546188.1| Contiguous genomic DNA sequence comprising the 19-kDa-zein gene family from Zea mays, complete sequence Length = 203363 Score = 40.1 bits (20), Expect = 9.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 344 ggagggaggaggaggagctctccc 367 ||||||||||||||||||| |||| Sbjct: 26697 ggagggaggaggaggagctttccc 26674
>dbj|AP004728.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0583E12 Length = 152449 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 ttgggagggaggaggaggag 360 |||||||||||||||||||| Sbjct: 78240 ttgggagggaggaggaggag 78221
>dbj|AK106590.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-111-G04, full insert sequence Length = 1953 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 348 ggaggaggaggagctctccc 367 |||||||||||||||||||| Sbjct: 83 ggaggaggaggagctctccc 64
>emb|Z74617.1|HS86C3 Human DNA sequence from cosmid L86C3, Huntington's Disease Region, chromosome 4p16.3 contains alpha-adducin exon 4, ESTs Length = 36383 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 345 gagggaggaggaggagctct 364 |||||||||||||||||||| Sbjct: 25716 gagggaggaggaggagctct 25697
>gb|AC005932.1|AC005932 Homo sapiens chromosome 19, cosmid R31317, complete sequence Length = 41696 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 212 caacctggcatgacatcctc 231 |||||||||||||||||||| Sbjct: 3426 caacctggcatgacatcctc 3445
>gb|U33557.1|MMU33557 Mus musculus folylpolyglutamate synthetase precursor (Fpgs) mRNA, complete cds Length = 2247 Score = 40.1 bits (20), Expect = 9.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 335 aaagctttgggagggaggaggagg 358 ||||| |||||||||||||||||| Sbjct: 2122 aaagcattgggagggaggaggagg 2099
>gb|U32197.1|MMU32197 Mus musculus folylpolyglutamate synthetase mRNA, nuclear gene encoding cytosolic and mitochondrial protein, complete cds Length = 2216 Score = 40.1 bits (20), Expect = 9.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 335 aaagctttgggagggaggaggagg 358 ||||| |||||||||||||||||| Sbjct: 2098 aaagcattgggagggaggaggagg 2075
>gb|AC164107.3| Mus musculus BAC clone RP23-461D6 from chromosome 14, complete sequence Length = 181095 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 343 gggagggaggaggaggagct 362 |||||||||||||||||||| Sbjct: 133482 gggagggaggaggaggagct 133463 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 343 gggagggaggaggaggagct 362 |||||||||||||||||||| Sbjct: 132529 gggagggaggaggaggagct 132510
>gb|AC147596.5| Gallus gallus BAC clone CH261-29A2 from chromosome unknown, complete sequence Length = 190789 Score = 40.1 bits (20), Expect = 9.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 600 ggactgcagcattttccccctcca 623 |||||||||||| ||||||||||| Sbjct: 154701 ggactgcagcatgttccccctcca 154678
>emb|AL772271.11| Mouse DNA sequence from clone RP23-17P12 on chromosome 2, complete sequence Length = 204136 Score = 40.1 bits (20), Expect = 9.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 335 aaagctttgggagggaggaggagg 358 ||||| |||||||||||||||||| Sbjct: 97589 aaagcattgggagggaggaggagg 97612
>emb|CT030154.8| Mouse DNA sequence from clone RP23-387H3 on chromosome 12, complete sequence Length = 213294 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 453 ctgagccaaccttgtcttct 472 |||||||||||||||||||| Sbjct: 97519 ctgagccaaccttgtcttct 97500
>emb|AL805948.9| Mouse DNA sequence from clone RP23-18C13 on chromosome 2, complete sequence Length = 204871 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 85 atatggtggggaaaaagaaa 104 |||||||||||||||||||| Sbjct: 91207 atatggtggggaaaaagaaa 91188
>emb|AL772157.4| Mouse DNA sequence from clone RP23-471M20 on chromosome 4, complete sequence Length = 107293 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 573 cagtacaaggcaatgcctga 592 |||||||||||||||||||| Sbjct: 97396 cagtacaaggcaatgcctga 97415
>emb|AL731805.8| Mouse DNA sequence from clone RP23-358E19 on chromosome 11, complete sequence Length = 111002 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 342 tgggagggaggaggaggagc 361 |||||||||||||||||||| Sbjct: 13211 tgggagggaggaggaggagc 13192 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 8,401,165 Number of Sequences: 3902068 Number of extensions: 8401165 Number of successful extensions: 200602 Number of sequences better than 10.0: 116 Number of HSP's better than 10.0 without gapping: 116 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 199851 Number of HSP's gapped (non-prelim): 751 length of query: 697 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 674 effective length of database: 17,143,297,704 effective search space: 11554582652496 effective search space used: 11554582652496 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
