ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal36f16
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1tpe|BN000093.1|HVA000093 TPA: TPA_exp: Hordeum vulgare mRNA for ... 942 0.0
2emb|AJ496571.2|HVU496571 Hordeum vulgare partial mRNA for putati... 660 0.0
3gb|AY841792.1| Triticum aestivum cysteine protease (CP) mRNA, co... 601 e-169
4gb|BT008950.1| Triticum aestivum clone wdk1c.pk009.j19:fis, full... 573 e-160
5gb|DQ344624.1| Triticum aestivum vacuolar ATP synthase subunit E... 289 4e-75
6ref|XM_507484.1| PREDICTED Oryza sativa (japonica cultivar-group... 172 7e-40
7ref|XM_507483.1| PREDICTED Oryza sativa (japonica cultivar-group... 172 7e-40
8ref|XM_465566.1| Oryza sativa (japonica cultivar-group), mRNA 172 7e-40
9ref|XM_507482.1| PREDICTED Oryza sativa (japonica cultivar-group... 172 7e-40
10ref|XM_506801.2| PREDICTED Oryza sativa (japonica cultivar-group... 172 7e-40
11dbj|AK061947.1| Oryza sativa (japonica cultivar-group) cDNA clon... 172 7e-40
12dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 172 7e-40
13dbj|AP004852.3| Oryza sativa (japonica cultivar-group) genomic D... 172 7e-40
14dbj|AK099269.1| Oryza sativa (japonica cultivar-group) cDNA clon... 172 7e-40
15dbj|AK098908.1| Oryza sativa (japonica cultivar-group) cDNA clon... 172 7e-40
16dbj|AK071907.1| Oryza sativa (japonica cultivar-group) cDNA clon... 172 7e-40
17gb|BT017759.1| Zea mays clone EL01N0501D06.c mRNA sequence 165 2e-37
18emb|X82185.1|ZMCYSPRO Z.mays mRNA for cysteine proteinase 165 2e-37
19gb|AY104312.1| Zea mays PCO074362 mRNA sequence 165 2e-37
20dbj|D45402.1|MZECP Corn mRNA for cysteine proteinase, clone CCP,... 165 2e-37
21ref|XM_471773.1| Oryza sativa (japonica cultivar-group), predic... 157 4e-35
22emb|AL663007.2|OSJN00206 Oryza sativa genomic DNA, chromosome 4,... 157 4e-35
23dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 157 4e-35
24dbj|AK121305.1| Oryza sativa (japonica cultivar-group) cDNA clon... 157 4e-35
25dbj|AK119670.1| Oryza sativa (japonica cultivar-group) cDNA clon... 157 4e-35
26dbj|AK071948.1| Oryza sativa (japonica cultivar-group) cDNA clon... 149 1e-32
27gb|AF462226.1| Narcissus pseudonarcissus putative cysteine prote... 125 1e-25
28gb|AY504968.1| Iris hollandica putative cysteine protease 3 (CYS... 92 2e-15
29gb|AF242373.1|AF242373 Ipomoea batatas cysteine protease (SPCP2)... 92 2e-15
30gb|AF411121.1| Sandersonia aurantiaca cysteine proteinase precur... 90 8e-15
31gb|AF138266.1|AF138266 Ipomoea batatas papain-like cysteine prot... 88 3e-14
32gb|AF138265.1|AF138265 Ipomoea batatas papain-like cysteine prot... 88 3e-14
33gb|AF138264.1|AF138264 Ipomoea batatas papain-like cysteine prot... 88 3e-14
34gb|AF216785.1|AF216785 Ipomoea batatas papain-like cysteine prot... 88 3e-14
35gb|AF216784.1|AF216784 Ipomoea batatas papain-like cysteine prot... 88 3e-14
36gb|AF216783.1|AF216783 Ipomoea batatas papain-like cysteine prot... 88 3e-14
37dbj|AB161375.1| Aster tripolium CysP mRNA for cysteine protease,... 78 3e-11
38ref|NM_120069.3| Arabidopsis thaliana RD19 (RESPONSIVE TO DEHYDR... 76 1e-10
39ref|NM_120068.3| Arabidopsis thaliana ATPase AT4G39080 mRNA, com... 76 1e-10
40emb|Z99953.1|PVZ99953 Phaseolus vulgaris Moldavian encoding cyst... 76 1e-10
41gb|AY133844.1| Arabidopsis thaliana clone U11713 putative cystei... 76 1e-10
42gb|AY080598.1| Arabidopsis thaliana putative cysteine proteinase... 76 1e-10
43emb|AL161594.2|ATCHRIV90 Arabidopsis thaliana DNA chromosome 4, ... 76 1e-10
44emb|AL035679.1|ATF19H22 Arabidopsis thaliana DNA chromosome 4, B... 76 1e-10
45dbj|AK220782.1| Arabidopsis thaliana mRNA for drought-inducible ... 76 1e-10
46emb|BX828077.1|CNS0A48A Arabidopsis thaliana Full-length cDNA Co... 76 1e-10
47emb|BX826350.1|CNS0A43C Arabidopsis thaliana Full-length cDNA Co... 76 1e-10
48gb|AY087621.1| Arabidopsis thaliana clone 37132 mRNA, complete s... 76 1e-10
49dbj|D13042.1|ATHRD19A Arabidopsis thaliana rd19A gene for thiol ... 76 1e-10
50gb|AY373974.1| Ipomoea batatas cysteine proteinase precursor, mR... 66 1e-07
51gb|AF082181.1|AF082181 Solanum melongena cysteine proteinase pre... 62 2e-06
52gb|AY800120.1| Populus tomentosa cysteine proteinase (CP) mRNA, ... 60 7e-06
53gb|AF454959.1| Brassica oleracea senescence-associated cysteine ... 60 7e-06
54gb|U68221.1|BNU68221 Brassica napus cysteine protease (LSC790) m... 60 7e-06
55dbj|AB038598.1| Vigna mungo mRNA for cysteine protease, complete... 60 7e-06
56gb|AY662991.1| Petunia x hybrida cysteine proteinase (CP5) mRNA,... 58 3e-05
57emb|X03971.1|CPCPROR Carica papaya mRNA 3'region for cysteine pr... 58 3e-05
58gb|AY110841.1| Zea mays CL908_1 mRNA sequence 58 3e-05
59dbj|AP006110.1| Lotus japonicus genomic DNA, chromosome 1, clone... 58 3e-05
60gb|M95060.1|MZEORFA Zea mays putative thiol protease homolog mRN... 58 3e-05
61emb|AJ844006.1| Plantago major partial mRNA for cysteine proteas... 56 1e-04
62dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 56 1e-04
63dbj|AP005396.3| Oryza sativa (japonica cultivar-group) genomic D... 56 1e-04
64dbj|AK108733.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
65gb|L38514.1|TRBRANGB Trypanosoma rangeli (clone 3) rangelipain g... 56 1e-04
66gb|L38513.1|TRBRANGA Trypanosoma rangeli (clone 2) rangelipain g... 56 1e-04
67gb|L38512.1|TRBRANG Trypanosoma rangeli (clone 1) rangelipain ge... 56 1e-04
68gb|AY662989.1| Petunia x hybrida cysteine proteinase (CP3) mRNA,... 54 5e-04
69emb|Z32795.1|GMCYSEND G.max (Fiskeby V) mRNA for cysteine endope... 54 5e-04
70ref|XM_312033.2| Anopheles gambiae str. PEST ENSANGP00000022503 ... 54 5e-04
71ref|XM_312034.2| Anopheles gambiae str. PEST ENSANGP00000018713 ... 54 5e-04
72gb|AF167986.1|AF167986 Glycine max putative cysteine proteinase ... 54 5e-04
73ref|NM_117715.2| Arabidopsis thaliana cysteine-type endopeptidas... 52 0.002
74ref|NM_187324.2| Oryza sativa (japonica cultivar-group), mRNA 52 0.002
75ref|XM_476390.1| Oryza sativa (japonica cultivar-group), mRNA 52 0.002
76gb|BT018299.1| Zea mays clone EL01T0206B09.c mRNA sequence 52 0.002
77gb|AC145324.3| Oryza sativa (japonica cultivar-group) chromosome... 52 0.002
78gb|BT000733.1| Arabidopsis thaliana clone RAFL08-11-G18 (R11350)... 52 0.002
79emb|Z97340.2|ATFCA5 Arabidopsis thaliana DNA chromosome 4, ESSA ... 52 0.002
80emb|Z13964.1|NTCYP8 N.tabacum mRNA for pre-pro-cysteine proteinase 52 0.002
81emb|Z13959.1|NTCYP7 N.tabacum mRNA for pre-pro-cysteine proteinase 52 0.002
82emb|X80876.1|OSCYSPRO O.sativa mRNA for cysteine protease 52 0.002
83emb|AL161543.2|ATCHRIV43 Arabidopsis thaliana DNA chromosome 4, ... 52 0.002
84gb|AY136316.1| Arabidopsis thaliana cysteine proteinase (At4g161... 52 0.002
85gb|AY129473.1| Arabidopsis thaliana AT4g16190/dl4135w mRNA, comp... 52 0.002
86gb|DQ084023.1| Nicotiana benthamiana cysteine proteinase glycina... 52 0.002
87gb|AY039556.1| Arabidopsis thaliana AT4g16190/dl4135w mRNA, comp... 52 0.002
88dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
89dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
90emb|BX828277.1|CNS0A2YD Arabidopsis thaliana Full-length cDNA Co... 52 0.002
91emb|BX827724.1|CNS0A2XO Arabidopsis thaliana Full-length cDNA Co... 52 0.002
92dbj|AP004299.2| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
93dbj|AP004342.5| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
94dbj|AK071495.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.002
95dbj|AK063422.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.002
96dbj|AP003759.2| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
97dbj|AB090880.1| Aster tripolium mRNA for thiol protease, complet... 52 0.002
98dbj|AB004648.1| Oryza sativa (japonica cultivar-group) RepA gene... 52 0.002
99gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 52 0.002
100gb|AY919606.1| Theileria orientalis cysteine protease 3 gene, co... 50 0.007
101gb|AY919605.1| Theileria orientalis cysteine protease 1 gene, co... 50 0.007
102gb|AY912450.1| Theileria orientalis tocp1 variant tocp5 gene, pa... 50 0.007
103gb|AY912448.1| Theileria orientalis tocp1 variant tocp3 mRNA, co... 50 0.007
104gb|BT014429.1| Lycopersicon esculentum clone 133747F, mRNA sequence 50 0.007
105emb|Z99955.1|PVZ99955 Phaseolus vulgaris Moldavian encoding cyst... 50 0.007
106dbj|AB159780.1| Theileria orientalis ToCP 1 mRNA for cysteine pr... 50 0.007
107gb|AY850168.1| Cloning vector pQ-CPB recombinant cysteine protea... 48 0.028
108ref|XM_813485.1| Trypanosoma cruzi strain CL Brener cysteine pep... 48 0.028
109ref|XM_813486.1| Trypanosoma cruzi strain CL Brener cruzipain pr... 48 0.028
110ref|XM_800858.1| Trypanosoma cruzi strain CL Brener cysteine pep... 48 0.028
111ref|XM_815081.1| Trypanosoma cruzi strain CL Brener cysteine pep... 48 0.028
112ref|XM_799143.1| Trypanosoma cruzi strain CL Brener cruzipain pr... 48 0.028
113emb|Z97022.1|HVZ97022 Hordeum vulgare gene encoding cysteine pro... 48 0.028
114emb|AJ512653.1|LGU512653 Leishmania guyanensis partial cpb gene ... 48 0.028
115gb|AF314929.1|AF314929 Trypanosoma cruzi strain Y cruzipain gene... 48 0.028
116gb|AY112673.1| Trypanosoma cruzi repeated HaeIII genomic fragmen... 48 0.028
117gb|AF265226.1|AF265226 Trypanosoma cruzi strain TUL cruzipain ge... 48 0.028
118gb|U32430.1|TAU32430 Triticum aestivum thiol protease mRNA, comp... 48 0.028
119gb|M90067.1|TRBCYSPRNS Trypanosoma cruzi cysteine proteinase gen... 48 0.028
120gb|AF004594.1|AF004594 Trypanosoma cruzi cysteine protease (cp) ... 48 0.028
121emb|X54414.1|TCCRUZIP T. cruzi mRNA for cysteine proteinase (cru... 48 0.028
122gb|M69121.1|TRBTUL2TAN Trypanosoma cruzi tandem cysteine protein... 48 0.028
123gb|M84342.1|TRBCYSPROA Trypanosoma cruzi cruzain protein gene, c... 48 0.028
124gb|M27305.1|TRBCYPAA Trypanosoma cruzi cysteine protease gene, p... 48 0.028
125ref|NM_127715.2| Arabidopsis thaliana cysteine-type endopeptidas... 46 0.11
126ref|XM_463580.1| Oryza sativa (japonica cultivar-group), predic... 46 0.11
127gb|BT014316.1| Lycopersicon esculentum clone 133569F, mRNA sequence 46 0.11
128ref|XM_797951.1| Trypanosoma cruzi strain CL Brener cysteine pep... 46 0.11
129ref|XM_800491.1| Trypanosoma cruzi strain CL Brener cysteine pep... 46 0.11
130emb|X74359.1|ATTHIPRO A.thaliana mRNA for putative thiol protease 46 0.11
131dbj|AP003380.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.11
132gb|AC006841.7| Arabidopsis thaliana chromosome 2 clone F3K23 map... 46 0.11
133dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.11
134gb|AY089044.1| Arabidopsis thaliana clone 21453 mRNA, complete s... 46 0.11
135dbj|AP006531.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.11
136dbj|AP006170.2| Oryza sativa (japonica cultivar-group) genomic D... 46 0.11
137dbj|AK175856.1| Arabidopsis thaliana mRNA for putative cysteine ... 46 0.11
138gb|AF099203.1|AF099203 Oryza sativa cysteine endopeptidase precu... 46 0.11
139gb|AY109437.1| Zea mays CL903_-1 mRNA sequence 46 0.11
140gb|AF006198.1|AF006198 Giardia muris cysteine protease (GMCP1) m... 46 0.11
141gb|AC172870.1| Brassica rapa subsp. pekinensis clone KBrH004A06,... 46 0.11
142dbj|D76415.1| Rice seedling mRNA for cysteine proteinase, comple... 46 0.11
143dbj|AB004819.1| Oryza sativa Rep1 gene for cysteine endopeptidas... 46 0.11
144gb|AY728269.1| Paragonimus westermani westerpain-1 gene, complet... 44 0.44
145ref|XM_467463.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.44
146gb|AC106834.9| Mus musculus chromosome 19, clone RP24-132H7, com... 44 0.44
147gb|AC103947.20| Mus musculus chromosome 19, clone RP23-261A21, c... 44 0.44
148emb|Z30338.1|VSCYSPROT V.sativa mRNA for cysteine proteinase 44 0.44
149emb|X54358.1|PSCC15A P.sativum mRNA of cDNA clone 15a 44 0.44
150emb|AJ242994.1|NTA242994 Nicotiana tabacum mRNA for putative pre... 44 0.44
151gb|AC148242.14| Medicago truncatula clone mth2-18f6, complete se... 44 0.44
152ref|NM_137062.2| Drosophila melanogaster CG6347-RA (CG6347), mRNA 44 0.44
153gb|AC099008.1| Drosophila melanogaster, chromosome 2R, region 50... 44 0.44
154gb|AY069609.1| Drosophila melanogaster LD36817 full insert cDNA 44 0.44
155gb|AY017414.1| Nicotiana tabacum CPR2-like cysteine proteinase g... 44 0.44
156gb|AY144442.1| Sorghum bicolor BAC 95A23/98N8.1 Rph region, part... 44 0.44
157gb|AY161277.1| Vicia faba pre-pro cysteine proteinase gene, comp... 44 0.44
158dbj|AP004047.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.44
159dbj|AB091669.1| Pandalus borealis PbCys mRNA for crustapain, com... 44 0.44
160gb|AF217446.1|AF217446 Babesia equi cysteine protease Cys2 mRNA,... 44 0.44
161dbj|AK104296.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.44
162gb|AF139913.1|AF139913 Trypanosoma congolense cysteine protease ... 44 0.44
163dbj|AK060534.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.44
164gb|AC005977.3|AC005977 Drosophila melanogaster, chromosome 2R, r... 44 0.44
165gb|AE003817.3| Drosophila melanogaster chromosome 2R, section 33... 44 0.44
166gb|U59465.1|VFU59465 Vicia faba pre-pro-cysteine proteinase (VFC... 44 0.44
167gb|AY728270.1| Paragonimus westermani westerpain-10 gene, comple... 42 1.7
168gb|DQ079995.1| Drosophila simulans male accessory gland protein ... 42 1.7
169gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 42 1.7
170emb|Z97023.1|HVZ97023 Hordeum vulgare mRNA encoding cysteine end... 42 1.7
171emb|Z97021.1|HVZ97021 Hordeum vulgare gene encoding cysteine end... 42 1.7
172emb|X05167.1|HVLEU Barley gene for thiol protease aleurain 42 1.7
173gb|AC099770.11| Mus musculus Strain C57BL6/J chromosome 5 BAC, R... 42 1.7
174gb|AC107315.1| Genomic sequence for Oryza sativa, Nipponbare str... 42 1.7
175dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
176gb|AF314930.1|AF314930 Trypanosoma cruzi strain Ynull cruzipain ... 42 1.7
177gb|AC137698.1| Genomic sequence for Oryza sativa, Nipponbare str... 42 1.7
178gb|AY099317.1| Trypanosoma cruzi clone CL Brener cysteine protei... 42 1.7
179gb|U94591.1|HVU94591 Hordeum vulgare cysteine proteinase precurs... 42 1.7
180dbj|D21124.1|PWSNTP Paragonimus westermani mRNA for neutral thio... 42 1.7
181ref|XM_507329.1| PREDICTED Oryza sativa (japonica cultivar-group... 40 6.8
182ref|XM_483741.1| Oryza sativa (japonica cultivar-group), mRNA 40 6.8
183gb|CP000069.1| Trypanosoma brucei chromosome 6, complete sequence 40 6.8
184gb|AC073906.6| Trypanosoma brucei chromosome 6 clone RPCI93-3A7,... 40 6.8
185gb|AY253445.1| Triticum aestivum P9346A1-2-5-1 putative thiol pr... 40 6.8
186ref|XM_540519.2| PREDICTED: Canis familiaris similar to tumor pr... 40 6.8
187ref|XM_821191.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cys... 40 6.8
188ref|XM_821190.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cys... 40 6.8
189ref|XM_821189.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cys... 40 6.8
190ref|XM_821188.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cys... 40 6.8
191ref|XM_821187.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cys... 40 6.8
192ref|XM_821186.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cys... 40 6.8
193ref|XM_821185.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cys... 40 6.8
194ref|XM_821184.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cys... 40 6.8
195ref|XM_821183.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cys... 40 6.8
196ref|XM_821182.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cys... 40 6.8
197ref|XM_821181.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cys... 40 6.8
198emb|AJ879460.1| Leishmania donovani infantum partial cpbE gene f... 40 6.8
199emb|AJ879459.1| Leishmania donovani donovani partial cpbF gene f... 40 6.8
200emb|AJ879458.1| Leishmania donovani infantum partial cpbE gene f... 40 6.8
201emb|AJ879457.1| Leishmania donovani archibaldi partial cpbA gene... 40 6.8
202emb|AJ879456.1| Leishmania donovani infantum partial cpbA gene f... 40 6.8
203emb|AJ879455.1| Leishmania donovani infantum partial cpbA gene f... 40 6.8
204emb|AL356858.19| Human DNA sequence from clone RP11-357K9 on chr... 40 6.8
205emb|Z14028.1|LECYSPRO L.esculentum mRNA encoding pre-pro-cystein... 40 6.8
206emb|X99936.1|ZMSEE1 Z.mays mRNA for cysteine proteinase, See1 40 6.8
207emb|X16465.1|TBCYSPRO Trypanosoma brucei mRNA for cysteine prote... 40 6.8
208emb|X54353.1|TBCSTPRO Trypanosome mRNA for a cysteine protease 40 6.8
209emb|AJ628943.1| Leishmania infantum cpb gene for cathepsin L-lik... 40 6.8
210emb|AJ628942.1| Leishmania infantum hd gene for histone deacetyl... 40 6.8
211emb|AJ512654.1|LMA512654 Leishmania major partial cpb gene for c... 40 6.8
212emb|AJ420286.1|LIN420286 Leishmania infantum cpb gene for cystei... 40 6.8
213emb|AJ297265.1|TBR297265 Trypanosoma brucei rhodesiense partial ... 40 6.8
214emb|AJ245868.1|MSA245868 Medicago sativa mRNA for cysteine prote... 40 6.8
215emb|CR860490.1| Pongo pygmaeus mRNA; cDNA DKFZp469F0716 (from cl... 40 6.8
216gb|AC023728.5| Drosophila melanogaster X BAC RP98-6J12 (Roswell ... 40 6.8
217dbj|AB226127.1| Aspergillus oryzae cDNA, contig sequence: AoEST2984 40 6.8
218dbj|AP007169.1| Aspergillus oryzae RIB40 genomic DNA, SC038 40 6.8
219gb|AC087182.12| Oryza sativa chromosome 10 BAC OSJNBa0029C15 gen... 40 6.8
220gb|AF309626.1|AF309626 Leishmania donovani clone Ld-A cysteine p... 40 6.8
221gb|AC155939.6| Mus musculus 10 BAC RP24-418P10 (Roswell Park Can... 40 6.8
222gb|AF004592.2|AF004592 Leishmania donovani chagasi amastigote-sp... 40 6.8
223dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.8
224dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.8
225gb|AF217087.1|AF217087 Leishmania chagasi cathepsin L-like cyste... 40 6.8
226ref|XM_574585.1| PREDICTED: Rattus norvegicus similar to transme... 40 6.8
227dbj|AP006171.2| Oryza sativa (japonica cultivar-group) genomic D... 40 6.8
228gb|AF265227.1|AF265227 Trypanosoma cruzi strain TCC cruzipain ge... 40 6.8
229dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 40 6.8
230dbj|AP003928.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.8
231dbj|AK105612.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.8
232dbj|AK099308.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.8
233dbj|AK072235.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.8
234gb|AY111351.1| Zea mays CL1876_2 mRNA sequence 40 6.8
235gb|AY106223.1| Zea mays PCO114759 mRNA sequence 40 6.8
236gb|AE003440.3| Drosophila melanogaster chromosome X, section 24 ... 40 6.8
237gb|AY896791.1| Leishmania infantum strain MHOM/PA/78/WR285 cathe... 40 6.8
238gb|AY896788.1| Leishmania donovani strain IMAR/KE/62/LRC-L57 cat... 40 6.8
239gb|AY896787.1| Leishmania donovani strain MHOM/CN/00/WangJie1 ca... 40 6.8
240gb|AY896786.1| Leishmania donovani strain MHOM/KE/67/MRC(L)3 cat... 40 6.8
241gb|AY896785.1| Leishmania donovani strain MHOM/ET/00/HUSSEN cath... 40 6.8
242gb|AY896784.1| Leishmania donovani strain MHOM/SD/82/GILANI cath... 40 6.8
243gb|AY896783.1| Leishmania donovani strain MHOM/ET/67/HU3 catheps... 40 6.8
244gb|AY896782.1| Leishmania infantum strain MHOM/MA/67/ITMAP263 ca... 40 6.8
245gb|AY896781.1| Leishmania infantum strain MHOM/FR/78/LEM75 cathe... 40 6.8
246gb|AY896780.1| Leishmania infantum strain MHOM/FR/85/LEM663 cath... 40 6.8
247gb|AY896779.1| Leishmania infantum strain MHOM/FR/82/LEM356 cath... 40 6.8
248gb|AY896778.1| Leishmania infantum strain MHOM/ES/81/BCN1 cathep... 40 6.8
249gb|AY896777.1| Leishmania infantum strain MHOM/FR/85/LEM716 cath... 40 6.8
250gb|AY896776.1| Leishmania infantum strain MHOM/FR/87/LEM1098 cat... 40 6.8
251gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 40 6.8
252gb|U95090.1|HSU95090 Homo sapiens chromosome 19 cosmid F19541, c... 40 6.8
253gb|U43706.1|LMU43706 Leishmania major cathepsin L-like protease ... 40 6.8
254gb|U41454.1|TCU41454 Trypanosoma cruzi cysteine protease cruzipa... 40 6.8
255gb|U41444.1|TCU41444 Trypanosoma cruzi cysteine protease cruzipa... 40 6.8
256gb|U71380.1|GMU71380 Glycine max thiol protease isoform A mRNA, ... 40 6.8
257gb|U71379.1|GMU71379 Glycine max thiol protease isoform B mRNA, ... 40 6.8
258dbj|D45403.1|MZECYPA Corn mRNA for cysteine proteinase, clone CC... 40 6.8

>tpe|BN000093.1|HVA000093 TPA: TPA_exp: Hordeum vulgare mRNA for putative cysteine proteinase
            precursor (sf42 gene)
          Length = 1438

 Score =  942 bits (475), Expect = 0.0
 Identities = 500/506 (98%), Gaps = 2/506 (0%)
 Strand = Plus / Minus

                                                                        
Query: 1    gaagttctttagcc-cat-aaaatagcgtgtggcaaacatcacatgcatgggcgtagcaa 58
            |||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 1401 gaagttctttagccacatcaaaatagcgtgtggcaaacatcacatgcatgggcgtagcaa 1342

                                                                        
Query: 59   atggagcagatgcataagttatacagcaagcatactgttgcggcttcgcatctccgctgc 118
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1341 atggagcagatgcataagttatacagcaagcatactgttgcggcttcgcatctccgctgc 1282

                                                                        
Query: 119  tgataagcgacgatggagcctagcgactactaggtattaaagtttcattctagcgataca 178
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1281 tgataagcgacgatggagcctagcgactactaggtattaaagtttcattctagcgataca 1222

                                                                        
Query: 179  tagaaaccaagatcgactccaggagggccgccgatcagatcagaacagatcagacaagag 238
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 1221 tagaaaccaagatcgactccaggagggccgccgatcagatcagaacagatcagaccagag 1162

                                                                        
Query: 239  cctactcctccttcgaggagtgtgtggcggacaccgtggagaccatggagtcgacgccgc 298
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1161 cctactcctccttcgaggagtgtgtggcggacaccgtggagaccatggagtcgacgccgc 1102

                                                                        
Query: 299  acttgttgcgcacgttggagcccctgcagatcttgtagtaccccttgtccntccagttct 358
            ||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||
Sbjct: 1101 acttgttgcgcacgttggagcccctgcagatcttgtagtaccccttgtccccccagttct 1042

                                                                        
Query: 359  cgccccacgagttcttgatgatccagtatggcttctccttgaagcgggaaggcgcaaagc 418
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 1041 cgccccacgagttcttgatgatccagtatggcttctccttgaagcgggaaggcgcgaagc 982

                                                                        
Query: 419  cggacgccccgtaaccgacgagaaggacaccgtggtcaaggtgcctgccgcagatgtatg 478
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 981  cggacgccccgtaaccgacgagaaggacaccgtggtcaaggtgcctgccgcagatgtatg 922

                                      
Query: 479  ggcatgacactcctccgatgtatgtc 504
            ||||||||||||||||||||||||||
Sbjct: 921  ggcatgacactcctccgatgtatgtc 896



to top

>emb|AJ496571.2|HVU496571 Hordeum vulgare partial mRNA for putative cysteine proteinase (sf42
           gene)
          Length = 397

 Score =  660 bits (333), Expect = 0.0
 Identities = 355/360 (98%), Gaps = 2/360 (0%)
 Strand = Plus / Minus

                                                                       
Query: 1   gaagttctttagcc-cat-aaaatagcgtgtggcaaacatcacatgcatgggcgtagcaa 58
           |||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 360 gaagttctttagccacatcaaaatagcgtgtggcaaacatcacatgcatgggcgtagcaa 301

                                                                       
Query: 59  atggagcagatgcataagttatacagcaagcatactgttgcggcttcgcatctccgctgc 118
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 300 atggagcagatgcataagttatacagcaagcatactgttgcggcttcgcatctccgctgc 241

                                                                       
Query: 119 tgataagcgacgatggagcctagcgactactaggtattaaagtttcattctagcgataca 178
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 240 tgataagcgacgatggagcctagcgactactaggtattaaagtttcattctagcgataca 181

                                                                       
Query: 179 tagaaaccaagatcgactccaggagggccgccgatcagatcagaacagatcagacaagag 238
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 180 tagaaaccaagatcgactccaggagggccgccgatcagatcagaacagatcagaccagag 121

                                                                       
Query: 239 cctactcctccttcgaggagtgtgtggcggacaccgtggagaccatggagtcgacgccgc 298
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 120 cctactcctccttcgaggagtgtgtggcggacaccgtggagaccatggagtcgacgccgc 61

                                                                       
Query: 299 acttgttgcgcacgttggagcccctgcagatcttgtagtaccccttgtccntccagttct 358
           ||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||
Sbjct: 60  acttgttgcgcacgttggagcccctgcagatcttgtagtaccccttgtccccccagttct 1



to top

>gb|AY841792.1| Triticum aestivum cysteine protease (CP) mRNA, complete cds
          Length = 1525

 Score =  601 bits (303), Expect = e-169
 Identities = 429/470 (91%), Gaps = 16/470 (3%)
 Strand = Plus / Minus

                                                                        
Query: 40   acatgcatgggcgtagcaaatggagcagatgcataagttatacagcaagcatactgttgc 99
            |||||||||| ||||||||||  |||| ||||| |||||||||||||||||| |||||||
Sbjct: 1421 acatgcatgg-cgtagcaaatttagcaaatgcacaagttatacagcaagcattctgttgc 1363

                                                                        
Query: 100  ggcttcgcatctccgctgctgata----agcgacgatggagcctagc-gactactaggta 154
            |||||||||||| |||||||||||    | ||||||||||||||||| ||||||||||||
Sbjct: 1362 ggcttcgcatcttcgctgctgataccacaacgacgatggagcctagccgactactaggta 1303

                                                                        
Query: 155  ttaaagtttcattctagcgatacatagaaaccaagatcgactccaggagggccgccgatc 214
            |||||||||| |||||||||||||  |||||||||||||||||||||||||| |||||||
Sbjct: 1302 ttaaagtttctttctagcgatacaccgaaaccaagatcgactccaggagggctgccgatc 1243

                                                                        
Query: 215  agatcagaacagatcagacaagagcctactcctccttcgaggagtgtgtggcggacaccg 274
            | ||||||||          |||||||||||||||||||||| ||| |||||||||||||
Sbjct: 1242 acatcagaac----------agagcctactcctccttcgaggcgtgcgtggcggacaccg 1193

                                                                        
Query: 275  tggagaccatggagtcgacgccgcacttgttgcgcacgttggagcccctgcagatcttgt 334
            ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 1192 tggagaccatggagtcgacgccgcacttgtttcgcacgttggagcccctgcagatcttgt 1133

                                                                        
Query: 335  agtaccccttgtccntccagttctcgccccacgagttcttgatgatccagtatggcttct 394
            |||| |||||||||  ||||||||||||||| |||||||||||||||||||| |||||||
Sbjct: 1132 agtaacccttgtccccccagttctcgccccatgagttcttgatgatccagtagggcttct 1073

                                                                        
Query: 395  ccttgaagcgggaaggcgcaaagccggacgccccgtaaccgacgagaaggacaccgtggt 454
            ||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||
Sbjct: 1072 ccttgaagcgggaaggcgcgaagccggacgccccgtagccgacgagaaggacaccgtggt 1013

                                                              
Query: 455  caaggtgcctgccgcagatgtatgggcatgacactcctccgatgtatgtc 504
            | |||||||||||||| |||||||||||||||||||| ||||||||||||
Sbjct: 1012 cgaggtgcctgccgcatatgtatgggcatgacactccgccgatgtatgtc 963



to top

>gb|BT008950.1| Triticum aestivum clone wdk1c.pk009.j19:fis, full insert mRNA
           sequence
          Length = 935

 Score =  573 bits (289), Expect = e-160
 Identities = 430/474 (90%), Gaps = 15/474 (3%)
 Strand = Plus / Minus

                                                                       
Query: 40  acatgcatgggcgtagcaaatggagcagatgcataagttatacagcaagcatactgttgc 99
           |||||||||| ||||||||||  |||| |||||||||||||||||||||||| || ||||
Sbjct: 844 acatgcatgg-cgtagcaaatttagcaaatgcataagttatacagcaagcattctattgc 786

                                                                       
Query: 100 ggcttcgcatctccgctgctgata----agcgacgatggagcctagc-gactactaggta 154
           | |||||||||| |||||||||||    | ||||||||||||||||| |||||||| |||
Sbjct: 785 gacttcgcatcttcgctgctgataccacaacgacgatggagcctagccgactactacgta 726

                                                                       
Query: 155 ttaaagtttcattctagcgatacata----gaaaccaagatcgactccaggagggccgcc 210
           |||||||||| ||||||||||||| |    ||||||||||||||| ||||||||||||||
Sbjct: 725 ttaaagtttctttctagcgatacacacaccgaaaccaagatcgacaccaggagggccgcc 666

                                                                       
Query: 211 gatcagatcagaacagatcagacaagagcctactcctccttcgaggagtgtgtggcggac 270
           ||||||||||||     |||||| ||||||||||| ||||| |||| ||| |||||||||
Sbjct: 665 gatcagatcaga-----tcagaccagagcctactcgtccttggaggcgtgagtggcggac 611

                                                                       
Query: 271 accgtggagaccatggagtcgacgccgcacttgttgcgcacgttggagcccctgcagatc 330
           |||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||
Sbjct: 610 accgtggagaccatggagtcgacgccacacttgttgcgcacgttcgagcccctgcagatc 551

                                                                       
Query: 331 ttgtagtaccccttgtccntccagttctcgccccacgagttcttgatgatccagtatggc 390
           |||||||| |||||||||  ||||||||||||||| |||||||||||||||||||| |||
Sbjct: 550 ttgtagtaacccttgtccccccagttctcgccccatgagttcttgatgatccagtagggc 491

                                                                       
Query: 391 ttctccttgaagcgggaaggcgcaaagccggacgccccgtaaccgacgagaaggacaccg 450
           ||||||||||||||||||||||| ||||| ||||||||||| ||||||||||||||||||
Sbjct: 490 ttctccttgaagcgggaaggcgcgaagccagacgccccgtagccgacgagaaggacaccg 431

                                                                 
Query: 451 tggtcaaggtgcctgccgcagatgtatgggcatgacactcctccgatgtatgtc 504
           ||||| ||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 430 tggtcgaggtgcctgccgcagatgtatgggcatgacactccgccgatgtatgtc 377



to top

>gb|DQ344624.1| Triticum aestivum vacuolar ATP synthase subunit E (VATE) mRNA,
            complete cds
          Length = 1970

 Score =  289 bits (146), Expect = 4e-75
 Identities = 258/292 (88%), Gaps = 15/292 (5%)
 Strand = Plus / Plus

                                                                        
Query: 40   acatgcatgggcgtagcaaatggagcagatgcataagttatacagcaagcatactgttgc 99
            |||||||||| ||||||||||  |||| |||||||||||||||||||||||| || ||||
Sbjct: 1684 acatgcatgg-cgtagcaaatttagcaaatgcataagttatacagcaagcattctattgc 1742

                                                                        
Query: 100  ggcttcgcatctccgctgctgata----agcgacgatggagcctagc-gactactaggta 154
            | |||||||||| |||||||||||    | ||||||||||||||||| |||||||| |||
Sbjct: 1743 gacttcgcatcttcgctgctgataccacaacgacgatggagcctagccgactactacgta 1802

                                                                        
Query: 155  ttaaagtttcattctagcgatacata----gaaaccaagatcgactccaggagggccgcc 210
            |||||||||| ||||||||||||| |    ||||||||||||||| ||||||||||||||
Sbjct: 1803 ttaaagtttctttctagcgatacacacaccgaaaccaagatcgacaccaggagggccgcc 1862

                                                                        
Query: 211  gatcagatcagaacagatcagacaagagcctactcctccttcgaggagtgtgtggcggac 270
            ||||||||||||     |||||| ||||||||||| ||||| |||| ||| |||||||||
Sbjct: 1863 gatcagatcaga-----tcagaccagagcctactcgtccttggaggcgtgagtggcggac 1917

                                                                
Query: 271  accgtggagaccatggagtcgacgccgcacttgttgcgcacgttggagcccc 322
            |||||||||||||||||||||||||| ||||||||||||||||| |||||||
Sbjct: 1918 accgtggagaccatggagtcgacgccacacttgttgcgcacgttcgagcccc 1969



to top

>ref|XM_507484.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1371_D04.6 mRNA
          Length = 1523

 Score =  172 bits (87), Expect = 7e-40
 Identities = 215/258 (83%)
 Strand = Plus / Minus

                                                                        
Query: 246  ctccttcgaggagtgtgtggcggacaccgtggagaccatggagtcgacgccgcacttgtt 305
            |||||| |||| |||  |||| ||||| ||||||||||| || || ||||| || |||||
Sbjct: 1163 ctcctttgaggtgtggatggcagacacggtggagaccatagaatccacgccacatttgtt 1104

                                                                        
Query: 306  gcgcacgttggagcccctgcagatcttgtagtaccccttgtccntccagttctcgcccca 365
            ||| |||||||||||||||||||||||||||||||| |  ||   |||||||||||||||
Sbjct: 1103 gcggacgttggagcccctgcagatcttgtagtacccatgctctccccagttctcgcccca 1044

                                                                        
Query: 366  cgagttcttgatgatccagtatggcttctccttgaagcgggaaggcgcaaagccggacgc 425
             |||||||||||||||||||| | ||| ||||| | ||||   || ||||| || || ||
Sbjct: 1043 ggagttcttgatgatccagtaggccttatcctttaggcggattggagcaaaaccagatgc 984

                                                                        
Query: 426  cccgtaaccgacgagaaggacaccgtggtcaaggtgcctgccgcagatgtatgggcatga 485
             ||||| || |||||||| |||||||| |||||||||||||| |||||||| ||||| ||
Sbjct: 983  gccgtagccaacgagaagaacaccgtgatcaaggtgcctgccacagatgtacgggcacga 924

                              
Query: 486  cactcctccgatgtatgt 503
             || || || ||||||||
Sbjct: 923  aacaccaccaatgtatgt 906



to top

>ref|XM_507483.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1371_D04.6 mRNA
          Length = 1480

 Score =  172 bits (87), Expect = 7e-40
 Identities = 215/258 (83%)
 Strand = Plus / Minus

                                                                        
Query: 246  ctccttcgaggagtgtgtggcggacaccgtggagaccatggagtcgacgccgcacttgtt 305
            |||||| |||| |||  |||| ||||| ||||||||||| || || ||||| || |||||
Sbjct: 1165 ctcctttgaggtgtggatggcagacacggtggagaccatagaatccacgccacatttgtt 1106

                                                                        
Query: 306  gcgcacgttggagcccctgcagatcttgtagtaccccttgtccntccagttctcgcccca 365
            ||| |||||||||||||||||||||||||||||||| |  ||   |||||||||||||||
Sbjct: 1105 gcggacgttggagcccctgcagatcttgtagtacccatgctctccccagttctcgcccca 1046

                                                                        
Query: 366  cgagttcttgatgatccagtatggcttctccttgaagcgggaaggcgcaaagccggacgc 425
             |||||||||||||||||||| | ||| ||||| | ||||   || ||||| || || ||
Sbjct: 1045 ggagttcttgatgatccagtaggccttatcctttaggcggattggagcaaaaccagatgc 986

                                                                        
Query: 426  cccgtaaccgacgagaaggacaccgtggtcaaggtgcctgccgcagatgtatgggcatga 485
             ||||| || |||||||| |||||||| |||||||||||||| |||||||| ||||| ||
Sbjct: 985  gccgtagccaacgagaagaacaccgtgatcaaggtgcctgccacagatgtacgggcacga 926

                              
Query: 486  cactcctccgatgtatgt 503
             || || || ||||||||
Sbjct: 925  aacaccaccaatgtatgt 908



to top

>ref|XM_465566.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1386

 Score =  172 bits (87), Expect = 7e-40
 Identities = 215/258 (83%)
 Strand = Plus / Minus

                                                                        
Query: 246  ctccttcgaggagtgtgtggcggacaccgtggagaccatggagtcgacgccgcacttgtt 305
            |||||| |||| |||  |||| ||||| ||||||||||| || || ||||| || |||||
Sbjct: 1166 ctcctttgaggtgtggatggcagacacggtggagaccatagaatccacgccacatttgtt 1107

                                                                        
Query: 306  gcgcacgttggagcccctgcagatcttgtagtaccccttgtccntccagttctcgcccca 365
            ||| |||||||||||||||||||||||||||||||| |  ||   |||||||||||||||
Sbjct: 1106 gcggacgttggagcccctgcagatcttgtagtacccatgctctccccagttctcgcccca 1047

                                                                        
Query: 366  cgagttcttgatgatccagtatggcttctccttgaagcgggaaggcgcaaagccggacgc 425
             |||||||||||||||||||| | ||| ||||| | ||||   || ||||| || || ||
Sbjct: 1046 ggagttcttgatgatccagtaggccttatcctttaggcggattggagcaaaaccagatgc 987

                                                                        
Query: 426  cccgtaaccgacgagaaggacaccgtggtcaaggtgcctgccgcagatgtatgggcatga 485
             ||||| || |||||||| |||||||| |||||||||||||| |||||||| ||||| ||
Sbjct: 986  gccgtagccaacgagaagaacaccgtgatcaaggtgcctgccacagatgtacgggcacga 927

                              
Query: 486  cactcctccgatgtatgt 503
             || || || ||||||||
Sbjct: 926  aacaccaccaatgtatgt 909



to top

>ref|XM_507482.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1371_D04.6 mRNA
          Length = 1504

 Score =  172 bits (87), Expect = 7e-40
 Identities = 215/258 (83%)
 Strand = Plus / Minus

                                                                        
Query: 246  ctccttcgaggagtgtgtggcggacaccgtggagaccatggagtcgacgccgcacttgtt 305
            |||||| |||| |||  |||| ||||| ||||||||||| || || ||||| || |||||
Sbjct: 1167 ctcctttgaggtgtggatggcagacacggtggagaccatagaatccacgccacatttgtt 1108

                                                                        
Query: 306  gcgcacgttggagcccctgcagatcttgtagtaccccttgtccntccagttctcgcccca 365
            ||| |||||||||||||||||||||||||||||||| |  ||   |||||||||||||||
Sbjct: 1107 gcggacgttggagcccctgcagatcttgtagtacccatgctctccccagttctcgcccca 1048

                                                                        
Query: 366  cgagttcttgatgatccagtatggcttctccttgaagcgggaaggcgcaaagccggacgc 425
             |||||||||||||||||||| | ||| ||||| | ||||   || ||||| || || ||
Sbjct: 1047 ggagttcttgatgatccagtaggccttatcctttaggcggattggagcaaaaccagatgc 988

                                                                        
Query: 426  cccgtaaccgacgagaaggacaccgtggtcaaggtgcctgccgcagatgtatgggcatga 485
             ||||| || |||||||| |||||||| |||||||||||||| |||||||| ||||| ||
Sbjct: 987  gccgtagccaacgagaagaacaccgtgatcaaggtgcctgccacagatgtacgggcacga 928

                              
Query: 486  cactcctccgatgtatgt 503
             || || || ||||||||
Sbjct: 927  aacaccaccaatgtatgt 910



to top

>ref|XM_506801.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1371_D04.6 mRNA
          Length = 1486

 Score =  172 bits (87), Expect = 7e-40
 Identities = 215/258 (83%)
 Strand = Plus / Minus

                                                                        
Query: 246  ctccttcgaggagtgtgtggcggacaccgtggagaccatggagtcgacgccgcacttgtt 305
            |||||| |||| |||  |||| ||||| ||||||||||| || || ||||| || |||||
Sbjct: 1171 ctcctttgaggtgtggatggcagacacggtggagaccatagaatccacgccacatttgtt 1112

                                                                        
Query: 306  gcgcacgttggagcccctgcagatcttgtagtaccccttgtccntccagttctcgcccca 365
            ||| |||||||||||||||||||||||||||||||| |  ||   |||||||||||||||
Sbjct: 1111 gcggacgttggagcccctgcagatcttgtagtacccatgctctccccagttctcgcccca 1052

                                                                        
Query: 366  cgagttcttgatgatccagtatggcttctccttgaagcgggaaggcgcaaagccggacgc 425
             |||||||||||||||||||| | ||| ||||| | ||||   || ||||| || || ||
Sbjct: 1051 ggagttcttgatgatccagtaggccttatcctttaggcggattggagcaaaaccagatgc 992

                                                                        
Query: 426  cccgtaaccgacgagaaggacaccgtggtcaaggtgcctgccgcagatgtatgggcatga 485
             ||||| || |||||||| |||||||| |||||||||||||| |||||||| ||||| ||
Sbjct: 991  gccgtagccaacgagaagaacaccgtgatcaaggtgcctgccacagatgtacgggcacga 932

                              
Query: 486  cactcctccgatgtatgt 503
             || || || ||||||||
Sbjct: 931  aacaccaccaatgtatgt 914



to top

>dbj|AK061947.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-042-E05, full
            insert sequence
          Length = 1504

 Score =  172 bits (87), Expect = 7e-40
 Identities = 215/258 (83%)
 Strand = Plus / Minus

                                                                        
Query: 246  ctccttcgaggagtgtgtggcggacaccgtggagaccatggagtcgacgccgcacttgtt 305
            |||||| |||| |||  |||| ||||| ||||||||||| || || ||||| || |||||
Sbjct: 1167 ctcctttgaggtgtggatggcagacacggtggagaccatagaatccacgccacatttgtt 1108

                                                                        
Query: 306  gcgcacgttggagcccctgcagatcttgtagtaccccttgtccntccagttctcgcccca 365
            ||| |||||||||||||||||||||||||||||||| |  ||   |||||||||||||||
Sbjct: 1107 gcggacgttggagcccctgcagatcttgtagtacccatgctctccccagttctcgcccca 1048

                                                                        
Query: 366  cgagttcttgatgatccagtatggcttctccttgaagcgggaaggcgcaaagccggacgc 425
             |||||||||||||||||||| | ||| ||||| | ||||   || ||||| || || ||
Sbjct: 1047 ggagttcttgatgatccagtaggccttatcctttaggcggattggagcaaaaccagatgc 988

                                                                        
Query: 426  cccgtaaccgacgagaaggacaccgtggtcaaggtgcctgccgcagatgtatgggcatga 485
             ||||| || |||||||| |||||||| |||||||||||||| |||||||| ||||| ||
Sbjct: 987  gccgtagccaacgagaagaacaccgtgatcaaggtgcctgccacagatgtacgggcacga 928

                              
Query: 486  cactcctccgatgtatgt 503
             || || || ||||||||
Sbjct: 927  aacaccaccaatgtatgt 910



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  172 bits (87), Expect = 7e-40
 Identities = 215/258 (83%)
 Strand = Plus / Minus

                                                                            
Query: 246      ctccttcgaggagtgtgtggcggacaccgtggagaccatggagtcgacgccgcacttgtt 305
                |||||| |||| |||  |||| ||||| ||||||||||| || || ||||| || |||||
Sbjct: 15994671 ctcctttgaggtgtggatggcagacacggtggagaccatagaatccacgccacatttgtt 15994612

                                                                            
Query: 306      gcgcacgttggagcccctgcagatcttgtagtaccccttgtccntccagttctcgcccca 365
                ||| |||||||||||||||||||||||||||||||| |  ||   |||||||||||||||
Sbjct: 15994611 gcggacgttggagcccctgcagatcttgtagtacccatgctctccccagttctcgcccca 15994552

                                                                            
Query: 366      cgagttcttgatgatccagtatggcttctccttgaagcgggaaggcgcaaagccggacgc 425
                 |||||||||||||||||||| | ||| ||||| | ||||   || ||||| || || ||
Sbjct: 15994551 ggagttcttgatgatccagtaggccttatcctttaggcggattggagcaaaaccagatgc 15994492

                                                                            
Query: 426      cccgtaaccgacgagaaggacaccgtggtcaaggtgcctgccgcagatgtatgggcatga 485
                 ||||| || |||||||| |||||||| |||||||||||||| |||||||| ||||| ||
Sbjct: 15994491 gccgtagccaacgagaagaacaccgtgatcaaggtgcctgccacagatgtacgggcacga 15994432

                                  
Query: 486      cactcctccgatgtatgt 503
                 || || || ||||||||
Sbjct: 15994431 aacaccaccaatgtatgt 15994414



 Score = 44.1 bits (22), Expect = 0.44
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                              
Query: 351      ccagttctcgccccacgagttcttgatgat 380
                |||||||| ||||||||||||||| |||||
Sbjct: 29687801 ccagttcttgccccacgagttcttcatgat 29687772



to top

>dbj|AP004852.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1371_D04
          Length = 105468

 Score =  172 bits (87), Expect = 7e-40
 Identities = 215/258 (83%)
 Strand = Plus / Minus

                                                                         
Query: 246   ctccttcgaggagtgtgtggcggacaccgtggagaccatggagtcgacgccgcacttgtt 305
             |||||| |||| |||  |||| ||||| ||||||||||| || || ||||| || |||||
Sbjct: 25606 ctcctttgaggtgtggatggcagacacggtggagaccatagaatccacgccacatttgtt 25547

                                                                         
Query: 306   gcgcacgttggagcccctgcagatcttgtagtaccccttgtccntccagttctcgcccca 365
             ||| |||||||||||||||||||||||||||||||| |  ||   |||||||||||||||
Sbjct: 25546 gcggacgttggagcccctgcagatcttgtagtacccatgctctccccagttctcgcccca 25487

                                                                         
Query: 366   cgagttcttgatgatccagtatggcttctccttgaagcgggaaggcgcaaagccggacgc 425
              |||||||||||||||||||| | ||| ||||| | ||||   || ||||| || || ||
Sbjct: 25486 ggagttcttgatgatccagtaggccttatcctttaggcggattggagcaaaaccagatgc 25427

                                                                         
Query: 426   cccgtaaccgacgagaaggacaccgtggtcaaggtgcctgccgcagatgtatgggcatga 485
              ||||| || |||||||| |||||||| |||||||||||||| |||||||| ||||| ||
Sbjct: 25426 gccgtagccaacgagaagaacaccgtgatcaaggtgcctgccacagatgtacgggcacga 25367

                               
Query: 486   cactcctccgatgtatgt 503
              || || || ||||||||
Sbjct: 25366 aacaccaccaatgtatgt 25349



to top

>dbj|AK099269.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023020I09, full
            insert sequence
          Length = 1385

 Score =  172 bits (87), Expect = 7e-40
 Identities = 215/258 (83%)
 Strand = Plus / Minus

                                                                        
Query: 246  ctccttcgaggagtgtgtggcggacaccgtggagaccatggagtcgacgccgcacttgtt 305
            |||||| |||| |||  |||| ||||| ||||||||||| || || ||||| || |||||
Sbjct: 1165 ctcctttgaggtgtggatggcagacacggtggagaccatagaatccacgccacatttgtt 1106

                                                                        
Query: 306  gcgcacgttggagcccctgcagatcttgtagtaccccttgtccntccagttctcgcccca 365
            ||| |||||||||||||||||||||||||||||||| |  ||   |||||||||||||||
Sbjct: 1105 gcggacgttggagcccctgcagatcttgtagtacccatgctctccccagttctcgcccca 1046

                                                                        
Query: 366  cgagttcttgatgatccagtatggcttctccttgaagcgggaaggcgcaaagccggacgc 425
             |||||||||||||||||||| | ||| ||||| | ||||   || ||||| || || ||
Sbjct: 1045 ggagttcttgatgatccagtaggccttatcctttaggcggattggagcaaaaccagatgc 986

                                                                        
Query: 426  cccgtaaccgacgagaaggacaccgtggtcaaggtgcctgccgcagatgtatgggcatga 485
             ||||| || |||||||| |||||||| |||||||||||||| |||||||| ||||| ||
Sbjct: 985  gccgtagccaacgagaagaacaccgtgatcaaggtgcctgccacagatgtacgggcacga 926

                              
Query: 486  cactcctccgatgtatgt 503
             || || || ||||||||
Sbjct: 925  aacaccaccaatgtatgt 908



to top

>dbj|AK098908.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002F17, full
            insert sequence
          Length = 1480

 Score =  172 bits (87), Expect = 7e-40
 Identities = 215/258 (83%)
 Strand = Plus / Minus

                                                                        
Query: 246  ctccttcgaggagtgtgtggcggacaccgtggagaccatggagtcgacgccgcacttgtt 305
            |||||| |||| |||  |||| ||||| ||||||||||| || || ||||| || |||||
Sbjct: 1165 ctcctttgaggtgtggatggcagacacggtggagaccatagaatccacgccacatttgtt 1106

                                                                        
Query: 306  gcgcacgttggagcccctgcagatcttgtagtaccccttgtccntccagttctcgcccca 365
            ||| |||||||||||||||||||||||||||||||| |  ||   |||||||||||||||
Sbjct: 1105 gcggacgttggagcccctgcagatcttgtagtacccatgctctccccagttctcgcccca 1046

                                                                        
Query: 366  cgagttcttgatgatccagtatggcttctccttgaagcgggaaggcgcaaagccggacgc 425
             |||||||||||||||||||| | ||| ||||| | ||||   || ||||| || || ||
Sbjct: 1045 ggagttcttgatgatccagtaggccttatcctttaggcggattggagcaaaaccagatgc 986

                                                                        
Query: 426  cccgtaaccgacgagaaggacaccgtggtcaaggtgcctgccgcagatgtatgggcatga 485
             ||||| || |||||||| |||||||| |||||||||||||| |||||||| ||||| ||
Sbjct: 985  gccgtagccaacgagaagaacaccgtgatcaaggtgcctgccacagatgtacgggcacga 926

                              
Query: 486  cactcctccgatgtatgt 503
             || || || ||||||||
Sbjct: 925  aacaccaccaatgtatgt 908



to top

>dbj|AK071907.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013063O07, full
            insert sequence
          Length = 1486

 Score =  172 bits (87), Expect = 7e-40
 Identities = 215/258 (83%)
 Strand = Plus / Minus

                                                                        
Query: 246  ctccttcgaggagtgtgtggcggacaccgtggagaccatggagtcgacgccgcacttgtt 305
            |||||| |||| |||  |||| ||||| ||||||||||| || || ||||| || |||||
Sbjct: 1171 ctcctttgaggtgtggatggcagacacggtggagaccatagaatccacgccacatttgtt 1112

                                                                        
Query: 306  gcgcacgttggagcccctgcagatcttgtagtaccccttgtccntccagttctcgcccca 365
            ||| |||||||||||||||||||||||||||||||| |  ||   |||||||||||||||
Sbjct: 1111 gcggacgttggagcccctgcagatcttgtagtacccatgctctccccagttctcgcccca 1052

                                                                        
Query: 366  cgagttcttgatgatccagtatggcttctccttgaagcgggaaggcgcaaagccggacgc 425
             |||||||||||||||||||| | ||| ||||| | ||||   || ||||| || || ||
Sbjct: 1051 ggagttcttgatgatccagtaggccttatcctttaggcggattggagcaaaaccagatgc 992

                                                                        
Query: 426  cccgtaaccgacgagaaggacaccgtggtcaaggtgcctgccgcagatgtatgggcatga 485
             ||||| || |||||||| |||||||| |||||||||||||| |||||||| ||||| ||
Sbjct: 991  gccgtagccaacgagaagaacaccgtgatcaaggtgcctgccacagatgtacgggcacga 932

                              
Query: 486  cactcctccgatgtatgt 503
             || || || ||||||||
Sbjct: 931  aacaccaccaatgtatgt 914



to top

>gb|BT017759.1| Zea mays clone EL01N0501D06.c mRNA sequence
          Length = 1131

 Score =  165 bits (83), Expect = 2e-37
 Identities = 121/134 (90%)
 Strand = Plus / Minus

                                                                       
Query: 265 gcggacaccgtggagaccatggagtcgacgccgcacttgttgcgcacgttggagcccctg 324
           |||||||| || ||||||||||| |||||||||||||||||||| |||||||| ||||||
Sbjct: 808 gcggacacggtagagaccatggaatcgacgccgcacttgttgcgaacgttggaacccctg 749

                                                                       
Query: 325 cagatcttgtagtaccccttgtccntccagttctcgccccacgagttcttgatgatccag 384
           || ||||||||||| || || |||  ||||||||||||||||||||||||||||||||||
Sbjct: 748 catatcttgtagtatccgttctccccccagttctcgccccacgagttcttgatgatccag 689

                         
Query: 385 tatggcttctcctt 398
           || ||||| |||||
Sbjct: 688 taaggcttgtcctt 675



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 445 acaccgtggtcaaggtgcctgccgcagatgtatgggcatgacactcctccgatgtatgtc 504
           ||||| ||||||||||||||||| |||||||||||||||||||| |||||||||||||||
Sbjct: 628 acaccatggtcaaggtgcctgccacagatgtatgggcatgacacgcctccgatgtatgtc 569



to top

>emb|X82185.1|ZMCYSPRO Z.mays mRNA for cysteine proteinase
          Length = 693

 Score =  165 bits (83), Expect = 2e-37
 Identities = 121/134 (90%)
 Strand = Plus / Minus

                                                                       
Query: 265 gcggacaccgtggagaccatggagtcgacgccgcacttgttgcgcacgttggagcccctg 324
           |||||||| || ||||||||||| |||||||||||||||||||| |||||||| ||||||
Sbjct: 416 gcggacacggtagagaccatggaatcgacgccgcacttgttgcgaacgttggaacccctg 357

                                                                       
Query: 325 cagatcttgtagtaccccttgtccntccagttctcgccccacgagttcttgatgatccag 384
           || ||||||||||| || || |||  ||||||||||||||||||||||||||||||||||
Sbjct: 356 catatcttgtagtatccgttctccccccagttctcgccccacgagttcttgatgatccag 297

                         
Query: 385 tatggcttctcctt 398
           || ||||| |||||
Sbjct: 296 taaggcttgtcctt 283



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 445 acaccgtggtcaaggtgcctgccgcagatgtatgggcatgacactcctccgatgtatgtc 504
           ||||| ||||||||||||||||| |||||||||||||||||||| |||||||||||||||
Sbjct: 236 acaccatggtcaaggtgcctgccacagatgtatgggcatgacacgcctccgatgtatgtc 177



to top

>gb|AY104312.1| Zea mays PCO074362 mRNA sequence
          Length = 2610

 Score =  165 bits (83), Expect = 2e-37
 Identities = 121/134 (90%)
 Strand = Plus / Minus

                                                                        
Query: 265  gcggacaccgtggagaccatggagtcgacgccgcacttgttgcgcacgttggagcccctg 324
            |||||||| || ||||||||||| |||||||||||||||||||| |||||||| ||||||
Sbjct: 1178 gcggacacggtagagaccatggaatcgacgccgcacttgttgcgaacgttggaacccctg 1119

                                                                        
Query: 325  cagatcttgtagtaccccttgtccntccagttctcgccccacgagttcttgatgatccag 384
            || ||||||||||| || || |||  ||||||||||||||||||||||||||||||||||
Sbjct: 1118 catatcttgtagtatccgttctccccccagttctcgccccacgagttcttgatgatccag 1059

                          
Query: 385  tatggcttctcctt 398
            || ||||| |||||
Sbjct: 1058 taaggcttgtcctt 1045



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 445 acaccgtggtcaaggtgcctgccgcagatgtatgggcatgacactcctccgatgtatgtc 504
           ||||| ||||||||||||||||| |||||||||||||||||||| |||||||||||||||
Sbjct: 998 acaccatggtcaaggtgcctgccacagatgtatgggcatgacacgcctccgatgtatgtc 939



to top

>dbj|D45402.1|MZECP Corn mRNA for cysteine proteinase, clone CCP, complete cds
          Length = 1311

 Score =  165 bits (83), Expect = 2e-37
 Identities = 121/134 (90%)
 Strand = Plus / Minus

                                                                        
Query: 265  gcggacaccgtggagaccatggagtcgacgccgcacttgttgcgcacgttggagcccctg 324
            |||||||| || ||||||||||| |||||||||||||||||||| |||||||| ||||||
Sbjct: 1117 gcggacacggtagagaccatggaatcgacgccgcacttgttgcgaacgttggaacccctg 1058

                                                                        
Query: 325  cagatcttgtagtaccccttgtccntccagttctcgccccacgagttcttgatgatccag 384
            || ||||||||||| || || |||  ||||||||||||||||||||||||||||||||||
Sbjct: 1057 catatcttgtagtatccgttctccccccagttctcgccccacgagttcttgatgatccag 998

                          
Query: 385  tatggcttctcctt 398
            || ||||| |||||
Sbjct: 997  taaggcttgtcctt 984



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 445 acaccgtggtcaaggtgcctgccgcagatgtatgggcatgacactcctccgatgtatgtc 504
           ||||| ||||||||||||||||| |||||||||||||||||||| |||||||||||||||
Sbjct: 937 acaccatggtcaaggtgcctgccacagatgtatgggcatgacacgcctccgatgtatgtc 878



to top

>ref|XM_471773.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1146

 Score =  157 bits (79), Expect = 4e-35
 Identities = 159/186 (85%)
 Strand = Plus / Minus

                                                                        
Query: 319  cccctgcagatcttgtagtaccccttgtccntccagttctcgccccacgagttcttgatg 378
            |||||||||||||||||||||||||| |||  ||||||||||||||||||||||||||||
Sbjct: 1064 cccctgcagatcttgtagtaccccttctccccccagttctcgccccacgagttcttgatg 1005

                                                                        
Query: 379  atccagtatggcttctccttgaagcgggaaggcgcaaagccggacgccccgtaaccgacg 438
            |||||||| ||||||||||||||||||   || ||  | || | ||  ||||| || || 
Sbjct: 1004 atccagtacggcttctccttgaagcggatcggtgcgtatcctgccgatccgtagccaaca 945

                                                                        
Query: 439  agaaggacaccgtggtcaaggtgcctgccgcagatgtatgggcatgacactcctccgatg 498
            || |||||||| |||||||||||||| || |||||| | ||||| ||||| || ||||||
Sbjct: 944  aggaggacaccatggtcaaggtgcctcccacagatgaaggggcacgacacgccgccgatg 885

                  
Query: 499  tatgtc 504
            ||||||
Sbjct: 884  tatgtc 879



to top

>emb|AL663007.2|OSJN00206 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0054B09,
             complete sequence
          Length = 146506

 Score =  157 bits (79), Expect = 4e-35
 Identities = 159/186 (85%)
 Strand = Plus / Minus

                                                                         
Query: 319   cccctgcagatcttgtagtaccccttgtccntccagttctcgccccacgagttcttgatg 378
             |||||||||||||||||||||||||| |||  ||||||||||||||||||||||||||||
Sbjct: 21996 cccctgcagatcttgtagtaccccttctccccccagttctcgccccacgagttcttgatg 21937

                                                                         
Query: 379   atccagtatggcttctccttgaagcgggaaggcgcaaagccggacgccccgtaaccgacg 438
             |||||||| ||||||||||||||||||   || ||  | || | ||  ||||| || || 
Sbjct: 21936 atccagtacggcttctccttgaagcggatcggtgcgtatcctgccgatccgtagccaaca 21877

                                                                         
Query: 439   agaaggacaccgtggtcaaggtgcctgccgcagatgtatgggcatgacactcctccgatg 498
             || |||||||| |||||||||||||| || |||||| | ||||| ||||| || ||||||
Sbjct: 21876 aggaggacaccatggtcaaggtgcctcccacagatgaaggggcacgacacgccgccgatg 21817

                   
Query: 499   tatgtc 504
             ||||||
Sbjct: 21816 tatgtc 21811



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  157 bits (79), Expect = 4e-35
 Identities = 159/186 (85%)
 Strand = Plus / Minus

                                                                            
Query: 319      cccctgcagatcttgtagtaccccttgtccntccagttctcgccccacgagttcttgatg 378
                |||||||||||||||||||||||||| |||  ||||||||||||||||||||||||||||
Sbjct: 14184230 cccctgcagatcttgtagtaccccttctccccccagttctcgccccacgagttcttgatg 14184171

                                                                            
Query: 379      atccagtatggcttctccttgaagcgggaaggcgcaaagccggacgccccgtaaccgacg 438
                |||||||| ||||||||||||||||||   || ||  | || | ||  ||||| || || 
Sbjct: 14184170 atccagtacggcttctccttgaagcggatcggtgcgtatcctgccgatccgtagccaaca 14184111

                                                                            
Query: 439      agaaggacaccgtggtcaaggtgcctgccgcagatgtatgggcatgacactcctccgatg 498
                || |||||||| |||||||||||||| || |||||| | ||||| ||||| || ||||||
Sbjct: 14184110 aggaggacaccatggtcaaggtgcctcccacagatgaaggggcacgacacgccgccgatg 14184051

                      
Query: 499      tatgtc 504
                ||||||
Sbjct: 14184050 tatgtc 14184045



to top

>dbj|AK121305.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023111H18, full
            insert sequence
          Length = 1981

 Score =  157 bits (79), Expect = 4e-35
 Identities = 159/186 (85%)
 Strand = Plus / Minus

                                                                        
Query: 319  cccctgcagatcttgtagtaccccttgtccntccagttctcgccccacgagttcttgatg 378
            |||||||||||||||||||||||||| |||  ||||||||||||||||||||||||||||
Sbjct: 1632 cccctgcagatcttgtagtaccccttctccccccagttctcgccccacgagttcttgatg 1573

                                                                        
Query: 379  atccagtatggcttctccttgaagcgggaaggcgcaaagccggacgccccgtaaccgacg 438
            |||||||| ||||||||||||||||||   || ||  | || | ||  ||||| || || 
Sbjct: 1572 atccagtacggcttctccttgaagcggatcggtgcgtatcctgccgatccgtagccaaca 1513

                                                                        
Query: 439  agaaggacaccgtggtcaaggtgcctgccgcagatgtatgggcatgacactcctccgatg 498
            || |||||||| |||||||||||||| || |||||| | ||||| ||||| || ||||||
Sbjct: 1512 aggaggacaccatggtcaaggtgcctcccacagatgaaggggcacgacacgccgccgatg 1453

                  
Query: 499  tatgtc 504
            ||||||
Sbjct: 1452 tatgtc 1447



to top

>dbj|AK119670.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-149-H07, full
            insert sequence
          Length = 1523

 Score =  157 bits (79), Expect = 4e-35
 Identities = 213/258 (82%)
 Strand = Plus / Minus

                                                                        
Query: 246  ctccttcgaggagtgtgtggcggacaccgtggagaccatggagtcgacgccgcacttgtt 305
            |||||| |||| |||  |||| ||||| ||||||||||| || || ||||| || |||||
Sbjct: 1163 ctcctttgaggtgtggatggcagacacggtggagaccatagaatccacgccacatttgtt 1104

                                                                        
Query: 306  gcgcacgttggagcccctgcagatcttgtagtaccccttgtccntccagttctcgcccca 365
             || ||||||||||||||||||| |||||||||||| |  ||   |||||||||||||||
Sbjct: 1103 acggacgttggagcccctgcagaccttgtagtacccatgctctccccagttctcgcccca 1044

                                                                        
Query: 366  cgagttcttgatgatccagtatggcttctccttgaagcgggaaggcgcaaagccggacgc 425
             |||||||||||||||||||| | ||| ||||| | ||||   || ||||| || || ||
Sbjct: 1043 ggagttcttgatgatccagtaggccttatcctttaggcggattggagcaaaaccagatgc 984

                                                                        
Query: 426  cccgtaaccgacgagaaggacaccgtggtcaaggtgcctgccgcagatgtatgggcatga 485
             ||||| || |||||||| |||||||| |||||||||||||| |||||||| ||||| ||
Sbjct: 983  gccgtagccaacgagaagaacaccgtgatcaaggtgcctgccacagatgtacgggcacga 924

                              
Query: 486  cactcctccgatgtatgt 503
             || || || ||||||||
Sbjct: 923  aacaccaccaatgtatgt 906



to top

>dbj|AK071948.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013078J21, full
            insert sequence
          Length = 1334

 Score =  149 bits (75), Expect = 1e-32
 Identities = 158/186 (84%)
 Strand = Plus / Minus

                                                                        
Query: 319  cccctgcagatcttgtagtaccccttgtccntccagttctcgccccacgagttcttgatg 378
            |||||||||||||||||||||||||| |||  |||||||||||||| |||||||||||||
Sbjct: 1075 cccctgcagatcttgtagtaccccttctccccccagttctcgccccgcgagttcttgatg 1016

                                                                        
Query: 379  atccagtatggcttctccttgaagcgggaaggcgcaaagccggacgccccgtaaccgacg 438
            |||||||| ||||||||||||||||||   || ||  | || | ||  ||||| || || 
Sbjct: 1015 atccagtacggcttctccttgaagcggatcggtgcgtatcctgccgatccgtagccaaca 956

                                                                        
Query: 439  agaaggacaccgtggtcaaggtgcctgccgcagatgtatgggcatgacactcctccgatg 498
            || |||||||| |||||||||||||| || |||||| | ||||| ||||| || ||||||
Sbjct: 955  aggaggacaccatggtcaaggtgcctcccacagatgaaggggcacgacacgccgccgatg 896

                  
Query: 499  tatgtc 504
            ||||||
Sbjct: 895  tatgtc 890



to top

>gb|AF462226.1| Narcissus pseudonarcissus putative cysteine proteinase mRNA,
           partial cds
          Length = 631

 Score =  125 bits (63), Expect = 1e-25
 Identities = 152/182 (83%)
 Strand = Plus / Minus

                                                                       
Query: 323 tgcagatcttgtagtaccccttgtccntccagttctcgccccacgagttcttgatgatcc 382
           |||||||||||||||| ||||| ||   ||| ||||||||||||||||||||||||||||
Sbjct: 337 tgcagatcttgtagtaacccttctcaccccaattctcgccccacgagttcttgatgatcc 278

                                                                       
Query: 383 agtatggcttctccttgaagcgggaaggcgcaaagccggacgccccgtaaccgacgagaa 442
           |||||||||| |||||||| |||   || ||  |||| || |  |||||||| |||||||
Sbjct: 277 agtatggcttttccttgaatcggatgggagcccagcccgaggagccgtaacccacgagaa 218

                                                                       
Query: 443 ggacaccgtggtcaaggtgcctgccgcagatgtatgggcatgacactcctccgatgtatg 502
           | |||||||| || | |||| | ||||| ||||| ||||| ||||| || ||||||||||
Sbjct: 217 gcacaccgtgatctaagtgctttccgcatatgtaagggcacgacacgcccccgatgtatg 158

             
Query: 503 tc 504
           ||
Sbjct: 157 tc 156



to top

>gb|AY504968.1| Iris hollandica putative cysteine protease 3 (CYS3) mRNA, complete
            cds
          Length = 1286

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                        
Query: 318  gcccctgcagatcttgtagtaccccttgtccntccagttctcgccccacgagttcttgat 377
            ||||||||||||||||||||| || || |||  |||| |||| |||||||||||||| ||
Sbjct: 1008 gcccctgcagatcttgtagtaaccattctccccccaggtctcaccccacgagttctttat 949

                                 
Query: 378  gatccagtatggcttctcctt 398
            ||||||||| |||||||||||
Sbjct: 948  gatccagtacggcttctcctt 928



to top

>gb|AF242373.1|AF242373 Ipomoea batatas cysteine protease (SPCP2) mRNA, complete cds
          Length = 1195

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 69/77 (89%)
 Strand = Plus / Minus

                                                                        
Query: 319  cccctgcagatcttgtagtaccccttgtccntccagttctcgccccacgagttcttgatg 378
            |||| |||||||||||||||||| || ||   |||| |||||||||||||||||||||||
Sbjct: 1036 ccccggcagatcttgtagtacccattctctccccagctctcgccccacgagttcttgatg 977

                             
Query: 379  atccagtatggcttctc 395
            ||||||||||| |||||
Sbjct: 976  atccagtatggtttctc 960



to top

>gb|AF411121.1| Sandersonia aurantiaca cysteine proteinase precursor (PRT22) mRNA,
            partial cds
          Length = 1310

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 74/84 (88%)
 Strand = Plus / Minus

                                                                        
Query: 322  ctgcagatcttgtagtaccccttgtccntccagttctcgccccacgagttcttgatgatc 381
            ||||| ||||||||||| || || ||   ||||||||| ||||| |||||||||||||||
Sbjct: 1016 ctgcaaatcttgtagtatccgttctctccccagttctctccccatgagttcttgatgatc 957

                                    
Query: 382  cagtatggcttctccttgaagcgg 405
            ||||||||||| ||||||||||||
Sbjct: 956  cagtatggcttttccttgaagcgg 933



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 464 tgccgcagatgtatgggcatgacactcc 491
           ||||||| ||||||||||| ||||||||
Sbjct: 874 tgccgcatatgtatgggcacgacactcc 847



to top

>gb|AF138266.1|AF138266 Ipomoea batatas papain-like cysteine proteinase isoform III
            (IBPCPIII) mRNA, complete cds
          Length = 1144

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 64/71 (90%)
 Strand = Plus / Minus

                                                                        
Query: 319  cccctgcagatcttgtagtaccccttgtccntccagttctcgccccacgagttcttgatg 378
            |||| |||||||||||||||||| || ||   |||| |||||||||||||||||||||||
Sbjct: 1046 ccccggcagatcttgtagtacccattctctccccagctctcgccccacgagttcttgatg 987

                       
Query: 379  atccagtatgg 389
            |||||||||||
Sbjct: 986  atccagtatgg 976



to top

>gb|AF138265.1|AF138265 Ipomoea batatas papain-like cysteine proteinase isoform II (IBPCPII)
            mRNA, complete cds
          Length = 1143

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 64/71 (90%)
 Strand = Plus / Minus

                                                                        
Query: 319  cccctgcagatcttgtagtaccccttgtccntccagttctcgccccacgagttcttgatg 378
            |||| |||||||||||||||||| || ||   |||| |||||||||||||||||||||||
Sbjct: 1046 ccccggcagatcttgtagtacccattctctccccagctctcgccccacgagttcttgatg 987

                       
Query: 379  atccagtatgg 389
            |||||||||||
Sbjct: 986  atccagtatgg 976



to top

>gb|AF138264.1|AF138264 Ipomoea batatas papain-like cysteine proteinase isoform I (IBPCPI)
            mRNA, complete cds
          Length = 1149

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 64/71 (90%)
 Strand = Plus / Minus

                                                                        
Query: 319  cccctgcagatcttgtagtaccccttgtccntccagttctcgccccacgagttcttgatg 378
            |||| |||||||||||||||||| || ||   |||| |||||||||||||||||||||||
Sbjct: 1052 ccccggcagatcttgtagtacccattctctccccagctctcgccccacgagttcttgatg 993

                       
Query: 379  atccagtatgg 389
            |||||||||||
Sbjct: 992  atccagtatgg 982



to top

>gb|AF216785.1|AF216785 Ipomoea batatas papain-like cysteine proteinase isoform III (PCPIII)
            gene, complete cds
          Length = 1473

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 64/71 (90%)
 Strand = Plus / Minus

                                                                        
Query: 319  cccctgcagatcttgtagtaccccttgtccntccagttctcgccccacgagttcttgatg 378
            |||| |||||||||||||||||| || ||   |||| |||||||||||||||||||||||
Sbjct: 1375 ccccggcagatcttgtagtacccattctctccccagctctcgccccacgagttcttgatg 1316

                       
Query: 379  atccagtatgg 389
            |||||||||||
Sbjct: 1315 atccagtatgg 1305



to top

>gb|AF216784.1|AF216784 Ipomoea batatas papain-like cysteine proteinase isoform II (PCPII)
            gene, complete cds
          Length = 1483

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 64/71 (90%)
 Strand = Plus / Minus

                                                                        
Query: 319  cccctgcagatcttgtagtaccccttgtccntccagttctcgccccacgagttcttgatg 378
            |||| |||||||||||||||||| || ||   |||| |||||||||||||||||||||||
Sbjct: 1386 ccccggcagatcttgtagtacccattctctccccagctctcgccccacgagttcttgatg 1327

                       
Query: 379  atccagtatgg 389
            |||||||||||
Sbjct: 1326 atccagtatgg 1316



to top

>gb|AF216783.1|AF216783 Ipomoea batatas papain-like cysteine proteinase isoform I (PCPI)
            gene, complete cds
          Length = 1474

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 64/71 (90%)
 Strand = Plus / Minus

                                                                        
Query: 319  cccctgcagatcttgtagtaccccttgtccntccagttctcgccccacgagttcttgatg 378
            |||| |||||||||||||||||| || ||   |||| |||||||||||||||||||||||
Sbjct: 1377 ccccggcagatcttgtagtacccattctctccccagctctcgccccacgagttcttgatg 1318

                       
Query: 379  atccagtatgg 389
            |||||||||||
Sbjct: 1317 atccagtatgg 1307



to top

>dbj|AB161375.1| Aster tripolium CysP mRNA for cysteine protease, complete cds
          Length = 1191

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 48/51 (94%)
 Strand = Plus / Minus

                                                               
Query: 351  ccagttctcgccccacgagttcttgatgatccagtatggcttctccttgaa 401
            ||||| ||| ||||| |||||||||||||||||||||||||||||||||||
Sbjct: 1003 ccagtcctctccccatgagttcttgatgatccagtatggcttctccttgaa 953



to top

>ref|NM_120069.3| Arabidopsis thaliana RD19 (RESPONSIVE TO DEHYDRATION 19);
            cysteine-type peptidase AT4G39090 (RD19) mRNA, complete
            cds
          Length = 2514

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                          
Query: 356  tctcgccccacgagttcttgatgatccagtatggcttctccttgaa 401
            |||| |||||||||||||||||||||||||| ||||||||||||||
Sbjct: 1156 tctctccccacgagttcttgatgatccagtaaggcttctccttgaa 1111



to top

>ref|NM_120068.3| Arabidopsis thaliana ATPase AT4G39080 mRNA, complete cds
          Length = 4147

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Plus

                                                          
Query: 356  tctcgccccacgagttcttgatgatccagtatggcttctccttgaa 401
            |||| |||||||||||||||||||||||||| ||||||||||||||
Sbjct: 3731 tctctccccacgagttcttgatgatccagtaaggcttctccttgaa 3776



to top

>emb|Z99953.1|PVZ99953 Phaseolus vulgaris Moldavian encoding cysteine proteinase precursor
            (clone cp41)
          Length = 1376

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                        
Query: 322  ctgcagatcttgtagtaccccttgtccntccagttctcgccccacgagttcttgatgatc 381
            ||||||||||||||||| || ||  |   ||||||||| |||||||||||||||||||||
Sbjct: 1031 ctgcagatcttgtagtatccattccctccccagttctccccccacgagttcttgatgatc 972

                             
Query: 382  cagtatggcttctcctt 398
            ||||| ||||| |||||
Sbjct: 971  cagtaaggcttttcctt 955



to top

>gb|AY133844.1| Arabidopsis thaliana clone U11713 putative cysteine proteinase RD19A
            (At4g39090) mRNA, complete cds
          Length = 1138

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                          
Query: 356  tctcgccccacgagttcttgatgatccagtatggcttctccttgaa 401
            |||| |||||||||||||||||||||||||| ||||||||||||||
Sbjct: 1000 tctctccccacgagttcttgatgatccagtaaggcttctccttgaa 955



to top

>gb|AY080598.1| Arabidopsis thaliana putative cysteine proteinase RD19A (At4g39090)
            mRNA, complete cds
          Length = 1249

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                          
Query: 356  tctcgccccacgagttcttgatgatccagtatggcttctccttgaa 401
            |||| |||||||||||||||||||||||||| ||||||||||||||
Sbjct: 1009 tctctccccacgagttcttgatgatccagtaaggcttctccttgaa 964



to top

>emb|AL161594.2|ATCHRIV90 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 90
          Length = 198987

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Plus

                                                            
Query: 356    tctcgccccacgagttcttgatgatccagtatggcttctccttgaa 401
              |||| |||||||||||||||||||||||||| ||||||||||||||
Sbjct: 130088 tctctccccacgagttcttgatgatccagtaaggcttctccttgaa 130133



to top

>emb|AL035679.1|ATF19H22 Arabidopsis thaliana DNA chromosome 4, BAC clone F19H22 (ESSA project)
          Length = 100469

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Plus

                                                           
Query: 356   tctcgccccacgagttcttgatgatccagtatggcttctccttgaa 401
             |||| |||||||||||||||||||||||||| ||||||||||||||
Sbjct: 92078 tctctccccacgagttcttgatgatccagtaaggcttctccttgaa 92123



to top

>dbj|AK220782.1| Arabidopsis thaliana mRNA for drought-inducible cysteine proteinase
           RD19A precursor, complete cds, clone: RAFL22-25-O05
          Length = 399

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 356 tctcgccccacgagttcttgatgatccagtatggcttctccttgaa 401
           |||| |||||||||||||||||||||||||| ||||||||||||||
Sbjct: 165 tctctccccacgagttcttgatgatccagtaaggcttctccttgaa 120



to top

>emb|BX828077.1|CNS0A48A Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH50ZA07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1179

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 356 tctcgccccacgagttcttgatgatccagtatggcttctccttgaa 401
           |||| |||||||||||||||||||||||||| ||||||||||||||
Sbjct: 994 tctctccccacgagttcttgatgatccagtaaggcttctccttgaa 949



to top

>emb|BX826350.1|CNS0A43C Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB18ZD12 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1186

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 356 tctcgccccacgagttcttgatgatccagtatggcttctccttgaa 401
           |||| |||||||||||||||||||||||||| ||||||||||||||
Sbjct: 996 tctctccccacgagttcttgatgatccagtaaggcttctccttgaa 951



to top

>gb|AY087621.1| Arabidopsis thaliana clone 37132 mRNA, complete sequence
          Length = 1461

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                          
Query: 356  tctcgccccacgagttcttgatgatccagtatggcttctccttgaa 401
            |||| |||||||||||||||||||||||||| ||||||||||||||
Sbjct: 1156 tctctccccacgagttcttgatgatccagtaaggcttctccttgaa 1111



to top

>dbj|D13042.1|ATHRD19A Arabidopsis thaliana rd19A gene for thiol protease, partial cds
          Length = 3255

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                          
Query: 356  tctcgccccacgagttcttgatgatccagtatggcttctccttgaa 401
            |||| |||||||||||||||||||||||||| ||||||||||||||
Sbjct: 2927 tctctccccacgagttcttgatgatccagtaaggcttctccttgaa 2882



to top

>gb|AY373974.1| Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds
          Length = 1309

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 71/84 (84%)
 Strand = Plus / Minus

                                                                        
Query: 318  gcccctgcagatcttgtagtaccccttgtccntccagttctcgccccacgagttcttgat 377
            |||||||||||||||||| || || |  ||   |||||| || ||||| || ||||||||
Sbjct: 1063 gcccctgcagatcttgtaatatccttcctctccccagttttctccccaagaattcttgat 1004

                                    
Query: 378  gatccagtatggcttctccttgaa 401
            ||||||||||||||| ||||||||
Sbjct: 1003 gatccagtatggcttgtccttgaa 980



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 472 atgtatgggcatgacactcctccgatgtatgtc 504
           ||||||||||| || ||||||||||||||||||
Sbjct: 906 atgtatgggcaggaaactcctccgatgtatgtc 874



to top

>gb|AF082181.1|AF082181 Solanum melongena cysteine proteinase precursor, mRNA, complete cds
          Length = 1426

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                        
Query: 319  cccctgcagatcttgtagtaccccttgtccntccagttctcgccccacgagttcttgatg 378
            ||||||||||||||||| || || |  ||   ||||||||| ||||| || |||||||||
Sbjct: 1046 cccctgcagatcttgtaataaccgtgttctccccagttctctccccaagaattcttgatg 987

                                  
Query: 379  atccagtatggcttctccttga 400
            |||||||| ||||| |||||||
Sbjct: 986  atccagtaaggcttttccttga 965



to top

>gb|AY800120.1| Populus tomentosa cysteine proteinase (CP) mRNA, complete cds
          Length = 1143

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                  
Query: 361  ccccacgagttcttgatgatccagtatggcttctcctt 398
            ||||| ||||||||||| ||||||||||||||||||||
Sbjct: 1016 ccccatgagttcttgataatccagtatggcttctcctt 979



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 475 tatgggcatgacactcctccgatgtatgt 503
           ||||||||||| |||||||| ||||||||
Sbjct: 902 tatgggcatgaaactcctccaatgtatgt 874



to top

>gb|AF454959.1| Brassica oleracea senescence-associated cysteine protease (CP4) mRNA,
            complete cds
          Length = 1253

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                          
Query: 356  tctcgccccacgagttcttgatgatccagtatggcttctccttgaa 401
            |||| |||||||||||||| || |||||||| ||||||||||||||
Sbjct: 1019 tctctccccacgagttcttaataatccagtaaggcttctccttgaa 974



to top

>gb|U68221.1|BNU68221 Brassica napus cysteine protease (LSC790) mRNA, partial cds
          Length = 255

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 356 tctcgccccacgagttcttgatgatccagtatggcttctccttgaa 401
           |||| |||||||||||||| || |||||||| ||||||||||||||
Sbjct: 187 tctctccccacgagttcttaataatccagtaaggcttctccttgaa 142



to top

>dbj|AB038598.1| Vigna mungo mRNA for cysteine protease, complete cds
          Length = 1424

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                        
Query: 322  ctgcagatcttgtagtaccccttgtccntccagttctcgccccacgagttcttgatgatc 381
            ||||||||||||||||| || || ||   |||| |||| |||||||| ||||| ||||||
Sbjct: 1034 ctgcagatcttgtagtatccattctctccccagctctccccccacgaattcttaatgatc 975

                             
Query: 382  cagtatggcttctcctt 398
            ||||| ||||| |||||
Sbjct: 974  cagtaaggcttttcctt 958



to top

>gb|AY662991.1| Petunia x hybrida cysteine proteinase (CP5) mRNA, partial cds
          Length = 643

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 355 ttctcgccccacgagttcttgatgatccagtatggcttctc 395
           ||||| ||||| ||||||||||||||||||||||| |||||
Sbjct: 473 ttctctccccatgagttcttgatgatccagtatggtttctc 433



to top

>emb|X03971.1|CPCPROR Carica papaya mRNA 3'region for cysteine proteinase (pLBPc13)
          Length = 444

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 319 cccctgcagatcttgtagtaccccttgtccntccagttctcgccccacgagttcttgatg 378
           ||||||||||||||||| || || || ||   |||||| || ||||| || ||||| |||
Sbjct: 224 cccctgcagatcttgtaatatccgttctctccccagttttctccccatgaattctttatg 165

                               
Query: 379 atccagtatggcttctcctt 398
           | ||||||||||||||||||
Sbjct: 164 acccagtatggcttctcctt 145



to top

>gb|AY110841.1| Zea mays CL908_1 mRNA sequence
          Length = 916

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 355 ttctcgccccacgagttcttgatgatccagtat 387
           |||||||||||||||||||||| ||||||||||
Sbjct: 625 ttctcgccccacgagttcttgacgatccagtat 593



to top

>dbj|AP006110.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT39G11, TM0195b,
             complete sequence
          Length = 52245

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                      
Query: 464   tgccgcagatgtatgggcatgacactcctccgatgtatgtc 504
             ||||||| |||||||||||||| ||||| ||||||||||||
Sbjct: 26086 tgccgcaaatgtatgggcatgaaactccaccgatgtatgtc 26126



 Score = 44.1 bits (22), Expect = 0.44
 Identities = 63/77 (81%)
 Strand = Plus / Plus

                                                                         
Query: 322   ctgcagatcttgtagtaccccttgtccntccagttctcgccccacgagttcttgatgatc 381
             |||||||||||||| || || || ||   |||| |||| ||||| || ||||| ||||||
Sbjct: 25944 ctgcagatcttgtaatatccattctctccccaggtctccccccatgaattctttatgatc 26003

                              
Query: 382   cagtatggcttctcctt 398
             ||||| ||||| |||||
Sbjct: 26004 cagtaaggcttttcctt 26020



to top

>gb|M95060.1|MZEORFA Zea mays putative thiol protease homolog mRNA, partial cds
          Length = 171

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 355 ttctcgccccacgagttcttgatgatccagtat 387
           |||||||||||||||||||||| ||||||||||
Sbjct: 100 ttctcgccccacgagttcttgacgatccagtat 68



to top

>emb|AJ844006.1| Plantago major partial mRNA for cysteine protease 2 (cpr2 gene)
          Length = 967

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                       
Query: 445 acaccgtggtcaaggtgcctgccgcagatgtatgggcatgacactcctccgatgtatgtc 504
           ||||||||||||||   | | ||||| |||||||||||||| |||||||| |||||||||
Sbjct: 550 acaccgtggtcaagagacttcccgcaaatgtatgggcatgaaactcctccaatgtatgtc 491



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                       
Query: 319 cccctgcagatcttgtagtaccccttgtccntccagttctcgccccacgagttcttgatg 378
           |||||||||||||||||||| ||  | ||   |||| |||| ||||| || ||||| |||
Sbjct: 673 cccctgcagatcttgtagtagccgctctctccccagctctctccccatgaattctttatg 614

                         
Query: 379 atccagtatggctt 392
           ||||||||||||||
Sbjct: 613 atccagtatggctt 600



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                    
Query: 351      ccagttctcgccccacgagttcttgatgatccagta 386
                ||||||||  ||||||||||||||||||||||||||
Sbjct: 22050545 ccagttcttcccccacgagttcttgatgatccagta 22050580



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                           
Query: 361      ccccacgagttcttgatgatccagtat 387
                ||||| |||||||||||||||||||||
Sbjct: 22144425 ccccaagagttcttgatgatccagtat 22144451



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 359      cgccccacgagttcttgatgatccagta 386
                ||||||||||||||||||  ||||||||
Sbjct: 22188632 cgccccacgagttcttgactatccagta 22188605



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 360      gccccacgagttcttgatgatccagtat 387
                ||||||||||||||| | ||||||||||
Sbjct: 22136828 gccccacgagttcttaacgatccagtat 22136855



to top

>dbj|AP005396.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0635G10
          Length = 146728

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                 
Query: 351   ccagttctcgccccacgagttcttgatgatccagta 386
             ||||||||  ||||||||||||||||||||||||||
Sbjct: 92609 ccagttcttcccccacgagttcttgatgatccagta 92644



to top

>dbj|AK108733.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-150-D05, full
           insert sequence
          Length = 904

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 351 ccagttctcgccccacgagttcttgatgatccagta 386
           ||||||||  ||||||||||||||||||||||||||
Sbjct: 612 ccagttcttcccccacgagttcttgatgatccagta 577



to top

>gb|L38514.1|TRBRANGB Trypanosoma rangeli (clone 3) rangelipain gene, 3' end of cds and
           5' end of cds
          Length = 1898

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                       
Query: 359 cgccccacgagttcttgatgatccagta 386
           ||||||||||||||||||||||||||||
Sbjct: 139 cgccccacgagttcttgatgatccagta 112



to top

>gb|L38513.1|TRBRANGA Trypanosoma rangeli (clone 2) rangelipain gene, 3' end of cds and
           5' end of cds
          Length = 1905

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                       
Query: 359 cgccccacgagttcttgatgatccagta 386
           ||||||||||||||||||||||||||||
Sbjct: 139 cgccccacgagttcttgatgatccagta 112



to top

>gb|L38512.1|TRBRANG Trypanosoma rangeli (clone 1) rangelipain gene, 3' end of cds and
           5' end of cds
          Length = 1902

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                       
Query: 359 cgccccacgagttcttgatgatccagta 386
           ||||||||||||||||||||||||||||
Sbjct: 139 cgccccacgagttcttgatgatccagta 112



to top

>gb|AY662989.1| Petunia x hybrida cysteine proteinase (CP3) mRNA, partial cds
          Length = 1041

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 68/82 (82%)
 Strand = Plus / Minus

                                                                       
Query: 319 cccctgcagatcttgtagtaccccttgtccntccagttctcgccccacgagttcttgatg 378
           ||||||||||||||||| || || |  ||   |||| |||| ||||| || |||||||||
Sbjct: 703 cccctgcagatcttgtaatatccttgctctccccagctctctccccaagaattcttgatg 644

                                 
Query: 379 atccagtatggcttctccttga 400
           |||||||| ||||| |||||||
Sbjct: 643 atccagtaaggcttttccttga 622



to top

>emb|Z32795.1|GMCYSEND G.max (Fiskeby V) mRNA for cysteine endopeptidase
          Length = 1441

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 355  ttctcgccccacgagttcttgatgatccagtatgg 389
            ||||| |||||||| ||||||||||||||||||||
Sbjct: 1064 ttctccccccacgaattcttgatgatccagtatgg 1030



to top

>ref|XM_312033.2| Anopheles gambiae str. PEST ENSANGP00000022503
           (ENSANGG00000016224), partial mRNA
          Length = 880

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 360 gccccacgagttcttgatgatccagta 386
           |||||||||||||||||||||||||||
Sbjct: 732 gccccacgagttcttgatgatccagta 706



to top

>ref|XM_312034.2| Anopheles gambiae str. PEST ENSANGP00000018713 (ENSANGG00000016224),
            partial mRNA
          Length = 1636

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                       
Query: 360  gccccacgagttcttgatgatccagta 386
            |||||||||||||||||||||||||||
Sbjct: 1488 gccccacgagttcttgatgatccagta 1462



to top

>gb|AF167986.1|AF167986 Glycine max putative cysteine proteinase GmPM33 (GmPM33) mRNA,
           complete cds
          Length = 1407

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 355 ttctcgccccacgagttcttgatgatccagtatgg 389
           ||||| |||||||| ||||||||||||||||||||
Sbjct: 999 ttctccccccacgaattcttgatgatccagtatgg 965



to top

>ref|NM_117715.2| Arabidopsis thaliana cysteine-type endopeptidase/ cysteine-type
            peptidase AT4G16190 mRNA, complete cds
          Length = 1395

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 361  ccccacgagttcttgatgatccagtatggcttctcctt 398
            ||||||||||||||||| ||||| || |||||||||||
Sbjct: 1055 ccccacgagttcttgataatccaataaggcttctcctt 1018



to top

>ref|NM_187324.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1415

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 361  ccccacgagttcttgatgatccagta 386
            ||||||||||||||||||||||||||
Sbjct: 1044 ccccacgagttcttgatgatccagta 1019



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 276  ggagaccatggagtcgacgccgca 299
            ||||||||||| ||||||||||||
Sbjct: 1120 ggagaccatggtgtcgacgccgca 1097



to top

>ref|XM_476390.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1059

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 361 ccccacgagttcttgatgatccagta 386
           ||||||||||||||||||||||||||
Sbjct: 953 ccccacgagttcttgatgatccagta 928



to top

>gb|BT018299.1| Zea mays clone EL01T0206B09.c mRNA sequence
          Length = 1209

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 361 ccccacgagttcttgatgatccagta 386
           ||||||||||||||||||||||||||
Sbjct: 890 ccccacgagttcttgatgatccagta 865



to top

>gb|AC145324.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0026D03 map near S2137, complete sequence
          Length = 115141

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                           
Query: 357   ctcgccccacgagttcttgatgatccagta 386
             |||||||||||||||||||| |||||||||
Sbjct: 34065 ctcgccccacgagttcttgacgatccagta 34036



to top

>gb|BT000733.1| Arabidopsis thaliana clone RAFL08-11-G18 (R11350) putative cysteine
            proteinase (At4g16190) mRNA, complete cds
          Length = 1398

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 361  ccccacgagttcttgatgatccagtatggcttctcctt 398
            ||||||||||||||||| ||||| || |||||||||||
Sbjct: 1047 ccccacgagttcttgataatccaataaggcttctcctt 1010



to top

>emb|Z97340.2|ATFCA5 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 5
          Length = 209164

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                    
Query: 361    ccccacgagttcttgatgatccagtatggcttctcctt 398
              ||||||||||||||||| ||||| || |||||||||||
Sbjct: 139423 ccccacgagttcttgataatccaataaggcttctcctt 139386



to top

>emb|Z13964.1|NTCYP8 N.tabacum mRNA for pre-pro-cysteine proteinase
          Length = 1330

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 351  ccagttctcgccccacgagttcttgatgatccagtatggcttctccttga 400
            ||||||||| ||||| || ||||||||||||||||| | ||| |||||||
Sbjct: 1014 ccagttctctccccatgaattcttgatgatccagtaagccttttccttga 965



to top

>emb|Z13959.1|NTCYP7 N.tabacum mRNA for pre-pro-cysteine proteinase
          Length = 1304

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 351 ccagttctcgccccacgagttcttgatgatccagtatggcttctccttga 400
           ||||||||| ||||| || ||||||||||||||||| | ||| |||||||
Sbjct: 993 ccagttctctccccatgaattcttgatgatccagtaagccttttccttga 944



to top

>emb|X80876.1|OSCYSPRO O.sativa mRNA for cysteine protease
          Length = 1440

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                          
Query: 357  ctcgccccacgagttcttgatgatccagta 386
            |||||||||||||||||||| |||||||||
Sbjct: 1077 ctcgccccacgagttcttgacgatccagta 1048



to top

>emb|AL161543.2|ATCHRIV43 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 43
          Length = 198226

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                    
Query: 361    ccccacgagttcttgatgatccagtatggcttctcctt 398
              ||||||||||||||||| ||||| || |||||||||||
Sbjct: 108413 ccccacgagttcttgataatccaataaggcttctcctt 108376



to top

>gb|AY136316.1| Arabidopsis thaliana cysteine proteinase (At4g16190) mRNA, complete
            cds
          Length = 1389

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 361  ccccacgagttcttgatgatccagtatggcttctcctt 398
            ||||||||||||||||| ||||| || |||||||||||
Sbjct: 1054 ccccacgagttcttgataatccaataaggcttctcctt 1017



to top

>gb|AY129473.1| Arabidopsis thaliana AT4g16190/dl4135w mRNA, complete cds
          Length = 1122

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 361  ccccacgagttcttgatgatccagtatggcttctcctt 398
            ||||||||||||||||| ||||| || |||||||||||
Sbjct: 1010 ccccacgagttcttgataatccaataaggcttctcctt 973



to top

>gb|DQ084023.1| Nicotiana benthamiana cysteine proteinase glycinain type mRNA,
            partial cds
          Length = 1086

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 351  ccagttctcgccccacgagttcttgatgatccagtatggcttctccttga 400
            ||||||||| ||||| || ||||||||||||||||| | ||| |||||||
Sbjct: 1013 ccagttctctccccaagaattcttgatgatccagtaagccttttccttga 964



to top

>gb|AY039556.1| Arabidopsis thaliana AT4g16190/dl4135w mRNA, complete cds
          Length = 1291

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 361  ccccacgagttcttgatgatccagtatggcttctcctt 398
            ||||||||||||||||| ||||| || |||||||||||
Sbjct: 1054 ccccacgagttcttgataatccaataaggcttctcctt 1017



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                             
Query: 357     ctcgccccacgagttcttgatgatccagta 386
               |||||||||||||||||||| |||||||||
Sbjct: 8298335 ctcgccccacgagttcttgacgatccagta 8298364



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                          
Query: 361      ccccacgagttcttgatgatccagta 386
                ||||||||||||||||||||||||||
Sbjct: 17444052 ccccacgagttcttgatgatccagta 17444027



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                        
Query: 361    ccccacgagttcttgatgatccagta 386
              ||||||||||||||||||||||||||
Sbjct: 464235 ccccacgagttcttgatgatccagta 464210



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 276      ggagaccatggagtcgacgccgca 299
                ||||||||||| ||||||||||||
Sbjct: 17444128 ggagaccatggtgtcgacgccgca 17444105



to top

>emb|BX828277.1|CNS0A2YD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH70ZD04 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1323

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 361  ccccacgagttcttgatgatccagtatggcttctcctt 398
            ||||||||||||||||| ||||| || |||||||||||
Sbjct: 1028 ccccacgagttcttgataatccaataaggcttctcctt 991



to top

>emb|BX827724.1|CNS0A2XO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH14ZG05 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1287

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 361  ccccacgagttcttgatgatccagtatggcttctcctt 398
            ||||||||||||||||| ||||| || |||||||||||
Sbjct: 1038 ccccacgagttcttgataatccaataaggcttctcctt 1001



to top

>dbj|AP004299.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0434A03
          Length = 146505

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                        
Query: 361    ccccacgagttcttgatgatccagta 386
              ||||||||||||||||||||||||||
Sbjct: 112276 ccccacgagttcttgatgatccagta 112251



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 276    ggagaccatggagtcgacgccgca 299
              ||||||||||| ||||||||||||
Sbjct: 112352 ggagaccatggtgtcgacgccgca 112329



to top

>dbj|AP004342.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0585H11
          Length = 149371

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 361   ccccacgagttcttgatgatccagta 386
             ||||||||||||||||||||||||||
Sbjct: 66399 ccccacgagttcttgatgatccagta 66374



to top

>dbj|AK071495.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023099K03, full
            insert sequence
          Length = 1511

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                          
Query: 357  ctcgccccacgagttcttgatgatccagta 386
            |||||||||||||||||||| |||||||||
Sbjct: 1083 ctcgccccacgagttcttgacgatccagta 1054



to top

>dbj|AK063422.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-115-C06, full
            insert sequence
          Length = 1415

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 361  ccccacgagttcttgatgatccagta 386
            ||||||||||||||||||||||||||
Sbjct: 1044 ccccacgagttcttgatgatccagta 1019



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 276  ggagaccatggagtcgacgccgca 299
            ||||||||||| ||||||||||||
Sbjct: 1120 ggagaccatggtgtcgacgccgca 1097



to top

>dbj|AP003759.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1567_G09
          Length = 121388

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 361   ccccacgagttcttgatgatccagta 386
             ||||||||||||||||||||||||||
Sbjct: 18147 ccccacgagttcttgatgatccagta 18122



to top

>dbj|AB090880.1| Aster tripolium mRNA for thiol protease, complete cds
          Length = 910

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 361 ccccacgagttcttgatgatccagtatggcttctcctt 398
           ||||| |||||||| |||||||| ||||||||||||||
Sbjct: 601 ccccatgagttctttatgatccaatatggcttctcctt 564



to top

>dbj|AB004648.1| Oryza sativa (japonica cultivar-group) RepA gene for cysteine
            endopeptidase, complete cds
          Length = 3836

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                          
Query: 357  ctcgccccacgagttcttgatgatccagta 386
            |||||||||||||||||||| |||||||||
Sbjct: 2599 ctcgccccacgagttcttgacgatccagta 2570



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                             
Query: 357     ctcgccccacgagttcttgatgatccagta 386
               |||||||||||||||||||| |||||||||
Sbjct: 8369098 ctcgccccacgagttcttgacgatccagta 8369127



to top

>gb|AY919606.1| Theileria orientalis cysteine protease 3 gene, complete cds
          Length = 1431

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                 
Query: 351  ccagttctcgccccacgagttcttgatgatccagtat 387
            ||||||||| ||||| ||||||||||||| |||||||
Sbjct: 1251 ccagttctcaccccaagagttcttgatgacccagtat 1215



to top

>gb|AY919605.1| Theileria orientalis cysteine protease 1 gene, complete cds
          Length = 1431

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                 
Query: 351  ccagttctcgccccacgagttcttgatgatccagtat 387
            ||||||||| ||||| ||||||||||||| |||||||
Sbjct: 1251 ccagttctctccccatgagttcttgatgacccagtat 1215



to top

>gb|AY912450.1| Theileria orientalis tocp1 variant tocp5 gene, partial cds
          Length = 1428

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                 
Query: 351  ccagttctcgccccacgagttcttgatgatccagtat 387
            ||||||||| ||||| ||||||||||||| |||||||
Sbjct: 1251 ccagttctcaccccaagagttcttgatgacccagtat 1215



to top

>gb|AY912448.1| Theileria orientalis tocp1 variant tocp3 mRNA, complete cds
          Length = 1559

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                 
Query: 351  ccagttctcgccccacgagttcttgatgatccagtat 387
            ||||||||| ||||| ||||||||||||| |||||||
Sbjct: 1318 ccagttctcaccccaagagttcttgatgacccagtat 1282



to top

>gb|BT014429.1| Lycopersicon esculentum clone 133747F, mRNA sequence
          Length = 1246

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                     
Query: 355  ttctcgccccacgagttcttgatgatccagtatggcttctc 395
            ||||| ||||| |||||||||||||||||||| || |||||
Sbjct: 1026 ttctctccccatgagttcttgatgatccagtacggtttctc 986



to top

>emb|Z99955.1|PVZ99955 Phaseolus vulgaris Moldavian encoding cysteine proteinase precursor
            (clone cp4)
          Length = 1286

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 361  ccccacgagttcttgatgatccagtatgg 389
            |||||||| ||||||||||||||||||||
Sbjct: 1019 ccccacgaattcttgatgatccagtatgg 991



to top

>dbj|AB159780.1| Theileria orientalis ToCP 1 mRNA for cysteine protease 1, complete
            cds
          Length = 1547

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                 
Query: 351  ccagttctcgccccacgagttcttgatgatccagtat 387
            ||||||||| ||||| ||||||||||||| |||||||
Sbjct: 1309 ccagttctctccccatgagttcttgatgacccagtat 1273



to top

>gb|AY850168.1| Cloning vector pQ-CPB recombinant cysteine protease mRNA, partial
           cds
          Length = 1005

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 351 ccagttctcgccccacgagttcttgatgatccagta 386
           ||||||||| ||||||||||||||||| | ||||||
Sbjct: 918 ccagttctcaccccacgagttcttgatcacccagta 883



to top

>ref|XM_813485.1| Trypanosoma cruzi strain CL Brener cysteine peptidase
           (Tc00.1047053507603.260) partial mRNA
          Length = 1404

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 363 ccacgagttcttgatgatccagta 386
           ||||||||||||||||||||||||
Sbjct: 918 ccacgagttcttgatgatccagta 895



to top

>ref|XM_813486.1| Trypanosoma cruzi strain CL Brener cruzipain precursor
           (Tc00.1047053507603.270) partial mRNA
          Length = 1404

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 363 ccacgagttcttgatgatccagta 386
           ||||||||||||||||||||||||
Sbjct: 918 ccacgagttcttgatgatccagta 895



to top

>ref|XM_800858.1| Trypanosoma cruzi strain CL Brener cysteine peptidase
           (Tc00.1047053507537.20) partial mRNA
          Length = 1281

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 363 ccacgagttcttgatgatccagta 386
           ||||||||||||||||||||||||
Sbjct: 918 ccacgagttcttgatgatccagta 895



to top

>ref|XM_815081.1| Trypanosoma cruzi strain CL Brener cysteine peptidase
           (Tc00.1047053509429.320) partial mRNA
          Length = 1404

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 363 ccacgagttcttgatgatccagta 386
           ||||||||||||||||||||||||
Sbjct: 918 ccacgagttcttgatgatccagta 895



to top

>ref|XM_799143.1| Trypanosoma cruzi strain CL Brener cruzipain precursor
           (Tc00.1047053507297.10) partial mRNA
          Length = 745

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 363 ccacgagttcttgatgatccagta 386
           ||||||||||||||||||||||||
Sbjct: 469 ccacgagttcttgatgatccagta 446



to top

>emb|Z97022.1|HVZ97022 Hordeum vulgare gene encoding cysteine proteinase
          Length = 5593

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 359  cgccccacgagttcttgatgatccagta 386
            |||||||||||||||| |||||||||||
Sbjct: 4814 cgccccacgagttcttcatgatccagta 4787



to top

>emb|AJ512653.1|LGU512653 Leishmania guyanensis partial cpb gene for cysteine proteinase b
          Length = 522

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 351 ccagttctcgccccacgagttcttgatgatccagta 386
           ||||||||| ||||||||||||||||| | ||||||
Sbjct: 516 ccagttctcaccccacgagttcttgatcagccagta 481



to top

>gb|AF314929.1|AF314929 Trypanosoma cruzi strain Y cruzipain gene, complete cds
          Length = 1404

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 363 ccacgagttcttgatgatccagta 386
           ||||||||||||||||||||||||
Sbjct: 918 ccacgagttcttgatgatccagta 895



to top

>gb|AY112673.1| Trypanosoma cruzi repeated HaeIII genomic fragment IGRE F510
          Length = 600

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 363 ccacgagttcttgatgatccagta 386
           ||||||||||||||||||||||||
Sbjct: 342 ccacgagttcttgatgatccagta 319



to top

>gb|AF265226.1|AF265226 Trypanosoma cruzi strain TUL cruzipain gene, complete cds
          Length = 1404

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 363 ccacgagttcttgatgatccagta 386
           ||||||||||||||||||||||||
Sbjct: 918 ccacgagttcttgatgatccagta 895



to top

>gb|U32430.1|TAU32430 Triticum aestivum thiol protease mRNA, complete cds
          Length = 1353

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 355  ttctcgccccacgagttcttgatgatccagta 386
            |||||||||||||||||||||  |||||||||
Sbjct: 1046 ttctcgccccacgagttcttggcgatccagta 1015



to top

>gb|M90067.1|TRBCYSPRNS Trypanosoma cruzi cysteine proteinase gene, partial cds
          Length = 2401

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 363  ccacgagttcttgatgatccagta 386
            ||||||||||||||||||||||||
Sbjct: 1799 ccacgagttcttgatgatccagta 1776



to top

>gb|AF004594.1|AF004594 Trypanosoma cruzi cysteine protease (cp) gene, complete cds
          Length = 1677

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 363 ccacgagttcttgatgatccagta 386
           ||||||||||||||||||||||||
Sbjct: 969 ccacgagttcttgatgatccagta 946



to top

>emb|X54414.1|TCCRUZIP T. cruzi mRNA for cysteine proteinase (cruzipain)
          Length = 767

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 363 ccacgagttcttgatgatccagta 386
           ||||||||||||||||||||||||
Sbjct: 36  ccacgagttcttgatgatccagta 13



to top

>gb|M69121.1|TRBTUL2TAN Trypanosoma cruzi tandem cysteine proteinase genes, C-terminal and
           N-terminal cds
          Length = 1845

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 363 ccacgagttcttgatgatccagta 386
           ||||||||||||||||||||||||
Sbjct: 264 ccacgagttcttgatgatccagta 241



to top

>gb|M84342.1|TRBCYSPROA Trypanosoma cruzi cruzain protein gene, complete cds
          Length = 1845

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 363 ccacgagttcttgatgatccagta 386
           ||||||||||||||||||||||||
Sbjct: 918 ccacgagttcttgatgatccagta 895



to top

>gb|M27305.1|TRBCYPAA Trypanosoma cruzi cysteine protease gene, partial cds
          Length = 495

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 363 ccacgagttcttgatgatccagta 386
           ||||||||||||||||||||||||
Sbjct: 495 ccacgagttcttgatgatccagta 472



to top

>ref|NM_127715.2| Arabidopsis thaliana cysteine-type endopeptidase/ cysteine-type
            peptidase AT2G21430 mRNA, complete cds
          Length = 1177

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 361  ccccacgagttcttgatgatcca 383
            |||||||||||||||||||||||
Sbjct: 1004 ccccacgagttcttgatgatcca 982



to top

>ref|XM_463580.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1116

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 360 gccccacgagttcttgatgatccagta 386
           ||||||||||||||||| |||||||||
Sbjct: 960 gccccacgagttcttgacgatccagta 934



to top

>gb|BT014316.1| Lycopersicon esculentum clone 133569F, mRNA sequence
          Length = 1354

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 361  ccccacgagttcttgatgatccagtatggct 391
            |||||||||||||| |||||||| |||||||
Sbjct: 1071 ccccacgagttctttatgatccaatatggct 1041



to top

>ref|XM_797951.1| Trypanosoma cruzi strain CL Brener cysteine peptidase
           (Tc00.1047053509401.30) partial mRNA
          Length = 1404

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 363 ccacgagttcttgatgatccagt 385
           |||||||||||||||||||||||
Sbjct: 918 ccacgagttcttgatgatccagt 896



to top

>ref|XM_800491.1| Trypanosoma cruzi strain CL Brener cysteine peptidase
           (Tc00.1047053508595.50) partial mRNA
          Length = 548

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 363 ccacgagttcttgatgatccagt 385
           |||||||||||||||||||||||
Sbjct: 62  ccacgagttcttgatgatccagt 40



to top

>emb|X74359.1|ATTHIPRO A.thaliana mRNA for putative thiol protease
          Length = 1060

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 361 ccccacgagttcttgatgatcca 383
           |||||||||||||||||||||||
Sbjct: 842 ccccacgagttcttgatgatcca 820



to top

>dbj|AP003380.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0497A05
          Length = 130919

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 360   gccccacgagttcttgatgatccagta 386
             ||||||||||||||||| |||||||||
Sbjct: 50139 gccccacgagttcttgacgatccagta 50113



to top

>gb|AC006841.7| Arabidopsis thaliana chromosome 2 clone F3K23 map mi148, complete
             sequence
          Length = 125045

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 361   ccccacgagttcttgatgatcca 383
             |||||||||||||||||||||||
Sbjct: 69103 ccccacgagttcttgatgatcca 69125



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                           
Query: 360      gccccacgagttcttgatgatccagta 386
                ||||||||||||||||| |||||||||
Sbjct: 39495697 gccccacgagttcttgacgatccagta 39495671



to top

>gb|AY089044.1| Arabidopsis thaliana clone 21453 mRNA, complete sequence
          Length = 1159

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 361  ccccacgagttcttgatgatcca 383
            |||||||||||||||||||||||
Sbjct: 1005 ccccacgagttcttgatgatcca 983



to top

>dbj|AP006531.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1417F08
          Length = 155536

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 360   gccccacgagttcttgatgatccagta 386
             ||||||||||||||||| |||||||||
Sbjct: 70711 gccccacgagttcttgacgatccagta 70685



to top

>dbj|AP006170.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OSJNBa0042B15
          Length = 157981

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 361   ccccacgagttcttgatgatccagtat 387
             ||||| |||||||||||||||||||||
Sbjct: 65918 ccccaagagttcttgatgatccagtat 65944



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 359    cgccccacgagttcttgatgatccagta 386
              ||||||||||||||||||  ||||||||
Sbjct: 110125 cgccccacgagttcttgactatccagta 110098



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 360   gccccacgagttcttgatgatccagtat 387
             ||||||||||||||| | ||||||||||
Sbjct: 58321 gccccacgagttcttaacgatccagtat 58348



to top

>dbj|AK175856.1| Arabidopsis thaliana mRNA for putative cysteine proteinase, complete
            cds, clone: RAFL22-47-O11
          Length = 1220

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 361  ccccacgagttcttgatgatcca 383
            |||||||||||||||||||||||
Sbjct: 1024 ccccacgagttcttgatgatcca 1002



to top

>gb|AF099203.1|AF099203 Oryza sativa cysteine endopeptidase precursor (EP3A) gene, complete
            cds
          Length = 2588

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 360  gccccacgagttcttgatgatccagta 386
            ||||||||||||||||| |||||||||
Sbjct: 1924 gccccacgagttcttgacgatccagta 1898



to top

>gb|AY109437.1| Zea mays CL903_-1 mRNA sequence
          Length = 1664

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 360  gccccacgagttcttgatgatccagta 386
            ||||||||||||||||| |||||||||
Sbjct: 1051 gccccacgagttcttgacgatccagta 1025



to top

>gb|AF006198.1|AF006198 Giardia muris cysteine protease (GMCP1) mRNA, complete cds
          Length = 906

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 360 gccccacgagttcttgatgatccagta 386
           ||||||||||||| |||||||||||||
Sbjct: 810 gccccacgagttcctgatgatccagta 784



to top

>gb|AC172870.1| Brassica rapa subsp. pekinensis clone KBrH004A06, complete sequence
          Length = 145603

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 361   ccccacgagttcttgatgatcca 383
             |||||||||||||||||||||||
Sbjct: 79667 ccccacgagttcttgatgatcca 79689



to top

>dbj|D76415.1| Rice seedling mRNA for cysteine proteinase, complete cds
          Length = 1429

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 360 gccccacgagttcttgatgatccagta 386
           ||||||||||||||||| |||||||||
Sbjct: 970 gccccacgagttcttgacgatccagta 944



to top

>dbj|AB004819.1| Oryza sativa Rep1 gene for cysteine endopeptidase, complete cds
          Length = 2544

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 360  gccccacgagttcttgatgatccagta 386
            ||||||||||||||||| |||||||||
Sbjct: 1886 gccccacgagttcttgacgatccagta 1860



to top

>gb|AY728269.1| Paragonimus westermani westerpain-1 gene, complete cds
          Length = 2097

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 369  gttcttgatgatccagtatggc 390
            ||||||||||||||||||||||
Sbjct: 1676 gttcttgatgatccagtatggc 1655



to top

>ref|XM_467463.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1101

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 351 ccagttctcgccccacgagttcttgatgat 380
           |||||||| ||||||||||||||| |||||
Sbjct: 987 ccagttcttgccccacgagttcttcatgat 958



to top

>gb|AC106834.9| Mus musculus chromosome 19, clone RP24-132H7, complete sequence
          Length = 177277

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 211   gatcagatcagaacagatcaga 232
             ||||||||||||||||||||||
Sbjct: 89644 gatcagatcagaacagatcaga 89623



to top

>gb|AC103947.20| Mus musculus chromosome 19, clone RP23-261A21, complete sequence
          Length = 245390

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 211  gatcagatcagaacagatcaga 232
            ||||||||||||||||||||||
Sbjct: 2117 gatcagatcagaacagatcaga 2096



to top

>emb|Z30338.1|VSCYSPROT V.sativa mRNA for cysteine proteinase
          Length = 1371

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 63/77 (81%)
 Strand = Plus / Minus

                                                                        
Query: 322  ctgcagatcttgtagtaccccttgtccntccagttctcgccccacgagttcttgatgatc 381
            |||||||||||||| || ||||  ||   ||| ||||  ||||| |||||||| ||||||
Sbjct: 1064 ctgcagatcttgtaatatccctgctctccccaattctgcccccaagagttcttaatgatc 1005

                             
Query: 382  cagtatggcttctcctt 398
            ||||| ||||| |||||
Sbjct: 1004 cagtaaggcttttcctt 988



to top

>emb|X54358.1|PSCC15A P.sativum mRNA of cDNA clone 15a
          Length = 1453

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 63/77 (81%)
 Strand = Plus / Minus

                                                                        
Query: 322  ctgcagatcttgtagtaccccttgtccntccagttctcgccccacgagttcttgatgatc 381
            |||||||||||||| || ||||  ||   ||| ||||  ||||| |||||||| ||||||
Sbjct: 1066 ctgcagatcttgtaatatccctgctctccccaattctgcccccaggagttcttaatgatc 1007

                             
Query: 382  cagtatggcttctcctt 398
            ||||| ||||| |||||
Sbjct: 1006 cagtaaggcttttcctt 990



to top

>emb|AJ242994.1|NTA242994 Nicotiana tabacum mRNA for putative preprocysteine proteinase
          Length = 1431

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                              
Query: 351  ccagttctcgccccacgagttcttgatgatccagtatggcttctccttga 400
            |||||| || ||||| || ||||||||||||||||| | ||| |||||||
Sbjct: 1067 ccagttttctccccaagaattcttgatgatccagtaagccttttccttga 1018



to top

>gb|AC148242.14| Medicago truncatula clone mth2-18f6, complete sequence
          Length = 125077

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 63/77 (81%)
 Strand = Plus / Plus

                                                                         
Query: 322   ctgcagatcttgtagtaccccttgtccntccagttctcgccccacgagttcttgatgatc 381
             ||||| ||||||||||| || || ||   |||| |||| ||||||||||| || | ||||
Sbjct: 81680 ctgcaaatcttgtagtatccgttctctccccaggtctcaccccacgagtttttaacgatc 81739

                              
Query: 382   cagtatggcttctcctt 398
             || || |||||||||||
Sbjct: 81740 caatacggcttctcctt 81756



to top

>ref|NM_137062.2| Drosophila melanogaster CG6347-RA (CG6347), mRNA
          Length = 1311

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 365  acgagttcttgatgatccagta 386
            ||||||||||||||||||||||
Sbjct: 1067 acgagttcttgatgatccagta 1046



to top

>gb|AC099008.1| Drosophila melanogaster, chromosome 2R, region 50B-50C, BAC clone
              BACR16G12, complete sequence
          Length = 154681

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 365    acgagttcttgatgatccagta 386
              ||||||||||||||||||||||
Sbjct: 108467 acgagttcttgatgatccagta 108488



to top

>gb|AY069609.1| Drosophila melanogaster LD36817 full insert cDNA
          Length = 1318

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 365  acgagttcttgatgatccagta 386
            ||||||||||||||||||||||
Sbjct: 1056 acgagttcttgatgatccagta 1035



to top

>gb|AY017414.1| Nicotiana tabacum CPR2-like cysteine proteinase gene, complete cds
          Length = 2107

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                              
Query: 351  ccagttctcgccccacgagttcttgatgatccagtatggcttctccttga 400
            |||||| || ||||| || ||||||||||||||||| | ||| |||||||
Sbjct: 1989 ccagttttctccccaagaattcttgatgatccagtaagccttttccttga 1940



to top

>gb|AY144442.1| Sorghum bicolor BAC 95A23/98N8.1 Rph region, partial sequence
          Length = 268433

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 361    ccccacgagttcttgatgatccagta 386
              |||||||||||||||| |||||||||
Sbjct: 152882 ccccacgagttcttgacgatccagta 152857



to top

>gb|AY161277.1| Vicia faba pre-pro cysteine proteinase gene, complete cds
          Length = 3822

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 63/77 (81%)
 Strand = Plus / Minus

                                                                        
Query: 322  ctgcagatcttgtagtaccccttgtccntccagttctcgccccacgagttcttgatgatc 381
            ||||||||||||||||| ||||  ||   ||| ||||  ||||| |||||||| | ||||
Sbjct: 3423 ctgcagatcttgtagtatccctgctctccccaattctgcccccaagagttcttaacgatc 3364

                             
Query: 382  cagtatggcttctcctt 398
            ||||| ||||| |||||
Sbjct: 3363 cagtaaggcttttcctt 3347



to top

>dbj|AP004047.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1191_G08
          Length = 172832

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 351   ccagttctcgccccacgagttcttgatgat 380
             |||||||| ||||||||||||||| |||||
Sbjct: 56780 ccagttcttgccccacgagttcttcatgat 56751



to top

>dbj|AB091669.1| Pandalus borealis PbCys mRNA for crustapain, complete cds
          Length = 1242

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 361 ccccacgagttcttgatgatccagta 386
           |||||||||||||||| |||||||||
Sbjct: 890 ccccacgagttcttgacgatccagta 865



to top

>gb|AF217446.1|AF217446 Babesia equi cysteine protease Cys2 mRNA, partial cds
          Length = 657

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 361 ccccacgagttcttgatgatccagta 386
           ||||| ||||||||||||||||||||
Sbjct: 467 ccccaagagttcttgatgatccagta 442



to top

>dbj|AK104296.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-008-H03, full
           insert sequence
          Length = 1251

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 351 ccagttctcgccccacgagttcttgatgat 380
           |||||||| ||||||||||||||| |||||
Sbjct: 987 ccagttcttgccccacgagttcttcatgat 958



to top

>gb|AF139913.1|AF139913 Trypanosoma congolense cysteine protease gene, partial cds
          Length = 1321

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 360 gccccacgagttcttgatgatccagtatgg 389
           |||||| ||||||||||| |||||||||||
Sbjct: 930 gccccatgagttcttgataatccagtatgg 901



to top

>dbj|AK060534.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-021-A12, full
           insert sequence
          Length = 1251

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 351 ccagttctcgccccacgagttcttgatgat 380
           |||||||| ||||||||||||||| |||||
Sbjct: 987 ccagttcttgccccacgagttcttcatgat 958



to top

>gb|AC005977.3|AC005977 Drosophila melanogaster, chromosome 2R, region 50C6-50C8, P1 clone
             DS04160, complete sequence
          Length = 69330

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 365   acgagttcttgatgatccagta 386
             ||||||||||||||||||||||
Sbjct: 67688 acgagttcttgatgatccagta 67709



to top

>gb|AE003817.3| Drosophila melanogaster chromosome 2R, section 33 of 73 of the complete
              sequence
          Length = 265472

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 365    acgagttcttgatgatccagta 386
              ||||||||||||||||||||||
Sbjct: 245754 acgagttcttgatgatccagta 245733



to top

>gb|U59465.1|VFU59465 Vicia faba pre-pro-cysteine proteinase (VFCYSPRO) mRNA, complete cds
          Length = 1439

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 63/77 (81%)
 Strand = Plus / Minus

                                                                        
Query: 322  ctgcagatcttgtagtaccccttgtccntccagttctcgccccacgagttcttgatgatc 381
            ||||||||||||||||| ||||  ||   ||| ||||  ||||| |||||||| | ||||
Sbjct: 1040 ctgcagatcttgtagtatccctgctctccccaattctgcccccaagagttcttaacgatc 981

                             
Query: 382  cagtatggcttctcctt 398
            ||||| ||||| |||||
Sbjct: 980  cagtaaggcttttcctt 964



to top

>gb|AY728270.1| Paragonimus westermani westerpain-10 gene, complete cds
          Length = 2456

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 370  ttcttgatgatccagtatggc 390
            |||||||||||||||||||||
Sbjct: 2031 ttcttgatgatccagtatggc 2011



to top

>gb|DQ079995.1| Drosophila simulans male accessory gland protein (CG4847) mRNA,
           partial cds
          Length = 1086

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 362 cccacgagttcttgatgatccagta 386
           ||||||||||||||| |||||||||
Sbjct: 997 cccacgagttcttgacgatccagta 973



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 210     cgatcagatcagaacagatcagaca 234
               ||||||||||||| |||||||||||
Sbjct: 9225773 cgatcagatcagaccagatcagaca 9225797



to top

>emb|Z97023.1|HVZ97023 Hordeum vulgare mRNA encoding cysteine endopeptidase EP-A
          Length = 1299

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 351 ccagttctcgccccacgagttcttgatgatccagtat 387
           ||||| ||| |||||||||||||| | ||||||||||
Sbjct: 996 ccagtcctctccccacgagttcttcacgatccagtat 960



to top

>emb|Z97021.1|HVZ97021 Hordeum vulgare gene encoding cysteine endopeptidase EP-A
          Length = 2752

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 351  ccagttctcgccccacgagttcttgatgatccagtat 387
            ||||| ||| |||||||||||||| | ||||||||||
Sbjct: 2373 ccagtcctctccccacgagttcttcacgatccagtat 2337



to top

>emb|X05167.1|HVLEU Barley gene for thiol protease aleurain
          Length = 5372

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 359  cgccccacgagttcttgatga 379
            |||||||||||||||||||||
Sbjct: 4845 cgccccacgagttcttgatga 4825



to top

>gb|AC099770.11| Mus musculus Strain C57BL6/J chromosome 5 BAC, RP23-349C19, Complete
             Sequence, complete sequence
          Length = 191223

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   gatcagatcagaacagatcag 231
             |||||||||||||||||||||
Sbjct: 46972 gatcagatcagaacagatcag 46992



to top

>gb|AC107315.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0032O19, from chromosome 3, complete sequence
          Length = 142248

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 210   cgatcagatcagaacagatcagaca 234
             ||||||||||||| |||||||||||
Sbjct: 60618 cgatcagatcagaccagatcagaca 60594



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 210     cgatcagatcagaacagatcagaca 234
               ||||||||||||| |||||||||||
Sbjct: 9223606 cgatcagatcagaccagatcagaca 9223630



to top

>gb|AF314930.1|AF314930 Trypanosoma cruzi strain Ynull cruzipain gene, complete cds
          Length = 1404

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 366 cgagttcttgatgatccagta 386
           |||||||||||||||||||||
Sbjct: 915 cgagttcttgatgatccagta 895



to top

>gb|AC137698.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBb0014A21, from chromosome 3, complete sequence
          Length = 134014

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 210    cgatcagatcagaacagatcagaca 234
              ||||||||||||| |||||||||||
Sbjct: 130480 cgatcagatcagaccagatcagaca 130456



to top

>gb|AY099317.1| Trypanosoma cruzi clone CL Brener cysteine proteinase precursor,
           gene, complete cds
          Length = 1404

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 363 ccacgagttcttgatgatcca 383
           |||||||||||||||||||||
Sbjct: 918 ccacgagttcttgatgatcca 898



to top

>gb|U94591.1|HVU94591 Hordeum vulgare cysteine proteinase precursor, mRNA, complete cds
          Length = 1328

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 351  ccagttctcgccccacgagttcttgatgatccagtat 387
            ||||| ||| |||||||||||||| | ||||||||||
Sbjct: 1004 ccagtcctctccccacgagttcttcacgatccagtat 968



to top

>dbj|D21124.1|PWSNTP Paragonimus westermani mRNA for neutral thiol protease, complete
           cds
          Length = 803

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 370 ttcttgatgatccagtatggc 390
           |||||||||||||||||||||
Sbjct: 633 ttcttgatgatccagtatggc 613



to top

>ref|XM_507329.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1150_A11.17 mRNA
          Length = 1437

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 359  cgccccacgagttcttgatgatccagta 386
            |||||||||||||| ||| |||||||||
Sbjct: 1042 cgccccacgagttcctgacgatccagta 1015



to top

>ref|XM_483741.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1437

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 359  cgccccacgagttcttgatgatccagta 386
            |||||||||||||| ||| |||||||||
Sbjct: 1042 cgccccacgagttcctgacgatccagta 1015



to top

>gb|CP000069.1| Trypanosoma brucei chromosome 6, complete sequence
          Length = 1618915

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 363    ccacgagttcttgatgatccagta 386
              ||||||||| ||||||||||||||
Sbjct: 422852 ccacgagtttttgatgatccagta 422875



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 363    ccacgagttcttgatgatccagta 386
              ||||||||| ||||||||||||||
Sbjct: 421091 ccacgagtttttgatgatccagta 421114



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 363    ccacgagttcttgatgatccagta 386
              ||||||||| ||||||||||||||
Sbjct: 419330 ccacgagtttttgatgatccagta 419353



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 363    ccacgagttcttgatgatccagta 386
              ||||||||| ||||||||||||||
Sbjct: 417569 ccacgagtttttgatgatccagta 417592



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 363    ccacgagttcttgatgatccagta 386
              ||||||||| ||||||||||||||
Sbjct: 415808 ccacgagtttttgatgatccagta 415831



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 363    ccacgagttcttgatgatccagta 386
              ||||||||| ||||||||||||||
Sbjct: 414044 ccacgagtttttgatgatccagta 414067



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 363    ccacgagttcttgatgatccagta 386
              ||||||||| ||||||||||||||
Sbjct: 412280 ccacgagtttttgatgatccagta 412303



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 363    ccacgagttcttgatgatccagta 386
              ||||||||| ||||||||||||||
Sbjct: 410519 ccacgagtttttgatgatccagta 410542



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 363    ccacgagttcttgatgatccagta 386
              ||||||||| ||||||||||||||
Sbjct: 408758 ccacgagtttttgatgatccagta 408781



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 363    ccacgagttcttgatgatccagta 386
              ||||||||| ||||||||||||||
Sbjct: 406994 ccacgagtttttgatgatccagta 407017



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 363    ccacgagttcttgatgatccagta 386
              ||||||||| ||||||||||||||
Sbjct: 405230 ccacgagtttttgatgatccagta 405253



to top

>gb|AC073906.6| Trypanosoma brucei chromosome 6 clone RPCI93-3A7, complete sequence
          Length = 175357

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 363   ccacgagttcttgatgatccagta 386
             ||||||||| ||||||||||||||
Sbjct: 74668 ccacgagtttttgatgatccagta 74691



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 363   ccacgagttcttgatgatccagta 386
             ||||||||| ||||||||||||||
Sbjct: 72907 ccacgagtttttgatgatccagta 72930



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 363   ccacgagttcttgatgatccagta 386
             ||||||||| ||||||||||||||
Sbjct: 71146 ccacgagtttttgatgatccagta 71169



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 363   ccacgagttcttgatgatccagta 386
             ||||||||| ||||||||||||||
Sbjct: 69385 ccacgagtttttgatgatccagta 69408



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 363   ccacgagttcttgatgatccagta 386
             ||||||||| ||||||||||||||
Sbjct: 67624 ccacgagtttttgatgatccagta 67647



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 363   ccacgagttcttgatgatccagta 386
             ||||||||| ||||||||||||||
Sbjct: 65860 ccacgagtttttgatgatccagta 65883



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 363   ccacgagttcttgatgatccagta 386
             ||||||||| ||||||||||||||
Sbjct: 64096 ccacgagtttttgatgatccagta 64119



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 363   ccacgagttcttgatgatccagta 386
             ||||||||| ||||||||||||||
Sbjct: 62335 ccacgagtttttgatgatccagta 62358



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 363   ccacgagttcttgatgatccagta 386
             ||||||||| ||||||||||||||
Sbjct: 60574 ccacgagtttttgatgatccagta 60597



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 363   ccacgagttcttgatgatccagta 386
             ||||||||| ||||||||||||||
Sbjct: 58810 ccacgagtttttgatgatccagta 58833



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 363   ccacgagttcttgatgatccagta 386
             ||||||||| ||||||||||||||
Sbjct: 57046 ccacgagtttttgatgatccagta 57069



to top

>gb|AY253445.1| Triticum aestivum P9346A1-2-5-1 putative thiol protease mRNA,
           partial cds
          Length = 560

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 355 ttctcgccccacgagttcttgatgatccagta 386
           |||||||||||||||||| ||  |||||||||
Sbjct: 423 ttctcgccccacgagttcctggcgatccagta 392



to top

>ref|XM_540519.2| PREDICTED: Canis familiaris similar to tumor protein p53 inducible
            protein 5 (LOC483400), mRNA
          Length = 2205

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 374  tgatgatccagtatggcttc 393
            ||||||||||||||||||||
Sbjct: 1589 tgatgatccagtatggcttc 1608



to top

>ref|XM_821191.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cysteine peptidase
           precursor (Tb927.6.1060) partial mRNA
          Length = 1350

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 363 ccacgagttcttgatgatccagta 386
           ||||||||| ||||||||||||||
Sbjct: 927 ccacgagtttttgatgatccagta 904



to top

>ref|XM_821190.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cysteine peptidase
           precursor (Tb927.6.1050) partial mRNA
          Length = 1350

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 363 ccacgagttcttgatgatccagta 386
           ||||||||| ||||||||||||||
Sbjct: 927 ccacgagtttttgatgatccagta 904



to top

>ref|XM_821189.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cysteine peptidase
           precursor (Tb927.6.1040) partial mRNA
          Length = 1350

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 363 ccacgagttcttgatgatccagta 386
           ||||||||| ||||||||||||||
Sbjct: 927 ccacgagtttttgatgatccagta 904



to top

>ref|XM_821188.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cysteine peptidase
           precursor (Tb927.6.1030) partial mRNA
          Length = 1350

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 363 ccacgagttcttgatgatccagta 386
           ||||||||| ||||||||||||||
Sbjct: 927 ccacgagtttttgatgatccagta 904



to top

>ref|XM_821187.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cysteine peptidase
           precursor (Tb927.6.1020) partial mRNA
          Length = 1353

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 363 ccacgagttcttgatgatccagta 386
           ||||||||| ||||||||||||||
Sbjct: 927 ccacgagtttttgatgatccagta 904



to top

>ref|XM_821186.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cysteine peptidase
           precursor (Tb927.6.1010) partial mRNA
          Length = 1353

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 363 ccacgagttcttgatgatccagta 386
           ||||||||| ||||||||||||||
Sbjct: 927 ccacgagtttttgatgatccagta 904



to top

>ref|XM_821185.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cysteine peptidase
           precursor (Tb927.6.1000) partial mRNA
          Length = 1350

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 363 ccacgagttcttgatgatccagta 386
           ||||||||| ||||||||||||||
Sbjct: 927 ccacgagtttttgatgatccagta 904



to top

>ref|XM_821184.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cysteine peptidase
           precursor (Tb927.6.990) partial mRNA
          Length = 1350

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 363 ccacgagttcttgatgatccagta 386
           ||||||||| ||||||||||||||
Sbjct: 927 ccacgagtttttgatgatccagta 904



to top

>ref|XM_821183.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cysteine peptidase
           precursor (Tb927.6.980) partial mRNA
          Length = 1353

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 363 ccacgagttcttgatgatccagta 386
           ||||||||| ||||||||||||||
Sbjct: 927 ccacgagtttttgatgatccagta 904



to top

>ref|XM_821182.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cysteine peptidase
           precursor (Tb927.6.970) partial mRNA
          Length = 1353

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 363 ccacgagttcttgatgatccagta 386
           ||||||||| ||||||||||||||
Sbjct: 927 ccacgagtttttgatgatccagta 904



to top

>ref|XM_821181.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 cysteine peptidase
           precursor (Tb927.6.960) partial mRNA
          Length = 1353

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 363 ccacgagttcttgatgatccagta 386
           ||||||||| ||||||||||||||
Sbjct: 927 ccacgagtttttgatgatccagta 904



to top

>emb|AJ879460.1| Leishmania donovani infantum partial cpbE gene for Cysteine
           proteinase type B, strain MHOM/FR/1996/LEM3249
          Length = 192

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 351 ccagttctcgccccacgagttcttgatgatccagta 386
           ||||| ||| ||||||||||||||||| | ||||||
Sbjct: 46  ccagtcctcaccccacgagttcttgatcacccagta 11



to top

>emb|AJ879459.1| Leishmania donovani donovani partial cpbF gene for Cysteine
           proteinase type B, strain MHOM/IN/1996/THAK35(LEM3178)
          Length = 192

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 351 ccagttctcgccccacgagttcttgatgatccagta 386
           ||||| ||| ||||||||||||||||| | ||||||
Sbjct: 46  ccagtcctcaccccacgagttcttgatcacccagta 11



to top

>emb|AJ879458.1| Leishmania donovani infantum partial cpbE gene for cysteine
           proteinase type B, strain MHOM/FR/1978/LEM75
          Length = 192

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 351 ccagttctcgccccacgagttcttgatgatccagta 386
           ||||| ||| ||||||||||||||||| | ||||||
Sbjct: 46  ccagtcctcaccccacgagttcttgatcacccagta 11



to top

>emb|AJ879457.1| Leishmania donovani archibaldi partial cpbA gene for cysteine
           proteinase type B, strain MHOM/ET/1972/GEBRE 1
          Length = 354

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 351 ccagttctcgccccacgagttcttgatgatccagta 386
           ||||| ||| ||||||||||||||||| | ||||||
Sbjct: 46  ccagtcctcaccccacgagttcttgatcacccagta 11



to top

>emb|AJ879456.1| Leishmania donovani infantum partial cpbA gene for cysteine
           proteinase type B, strain MHOM/IN/1996/THAK35(LEM3178)
          Length = 354

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 351 ccagttctcgccccacgagttcttgatgatccagta 386
           ||||| ||| ||||||||||||||||| | ||||||
Sbjct: 46  ccagtcctcaccccacgagttcttgatcacccagta 11



to top

>emb|AJ879455.1| Leishmania donovani infantum partial cpbA gene for cysteine
           proteinase type B, strain MHOM/FR/1978/LEM75
          Length = 354

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 351 ccagttctcgccccacgagttcttgatgatccagta 386
           ||||| ||| ||||||||||||||||| | ||||||
Sbjct: 46  ccagtcctcaccccacgagttcttgatcacccagta 11



to top

>emb|AL356858.19| Human DNA sequence from clone RP11-357K9 on chromosome Xp11.4-21.2
             Contains the PRRG1 gene for proline-rich Gla
             (G-carboxyglutamic acid) polypetide 1, a ferritin heavy
             polypeptide-like 17 (FTHL17) pseudogene and a CpG island,
             complete sequence
          Length = 128968

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 16    ataaaatagcgtgtggcaaa 35
             ||||||||||||||||||||
Sbjct: 66647 ataaaatagcgtgtggcaaa 66666



to top

>emb|Z14028.1|LECYSPRO L.esculentum mRNA encoding pre-pro-cysteine proteinase
          Length = 1295

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 361 ccccacgagttcttgatgatccagtatggctt 392
           ||||| || ||||||||||||||||| |||||
Sbjct: 971 ccccaagaattcttgatgatccagtaaggctt 940



to top

>emb|X99936.1|ZMSEE1 Z.mays mRNA for cysteine proteinase, See1
          Length = 1412

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 359  cgccccacgagttcttgatgatccagta 386
            ||||||| ||||||||||||| ||||||
Sbjct: 1053 cgccccatgagttcttgatgagccagta 1026



to top

>emb|X16465.1|TBCYSPRO Trypanosoma brucei mRNA for cysteine proteinase
          Length = 1621

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 363 ccacgagttcttgatgatccagta 386
           ||||||||| ||||||||||||||
Sbjct: 958 ccacgagtttttgatgatccagta 935



to top

>emb|X54353.1|TBCSTPRO Trypanosome mRNA for a cysteine protease
          Length = 1636

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 363 ccacgagttcttgatgatccagta 386
           ||||||||| ||||||||||||||
Sbjct: 962 ccacgagtttttgatgatccagta 939



to top

>emb|AJ628943.1| Leishmania infantum cpb gene for cathepsin L-like cysteine
           proteinase and partial ORF
          Length = 6462

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 351 ccagttctcgccccacgagttcttgatgatccagta 386
           ||||| ||| ||||||||||||||||| | ||||||
Sbjct: 903 ccagtcctcaccccacgagttcttgatcacccagta 868



to top

>emb|AJ628942.1| Leishmania infantum hd gene for histone deacetylase and cpb1 gene for
             cysteine proteinase
          Length = 12482

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                 
Query: 351   ccagttctcgccccacgagttcttgatgatccagta 386
             ||||| ||| ||||||||||||||||| | ||||||
Sbjct: 12092 ccagtcctcaccccacgagttcttgatcacccagta 12057



to top

>emb|AJ512654.1|LMA512654 Leishmania major partial cpb gene for cysteine proteinase b
          Length = 522

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 351 ccagttctcgccccacgagttcttgatgatccagta 386
           ||||| ||| ||||||||||||||||| | ||||||
Sbjct: 516 ccagtcctcaccccacgagttcttgatcacccagta 481



to top

>emb|AJ420286.1|LIN420286 Leishmania infantum cpb gene for cysteine proteinase
          Length = 2767

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 351  ccagttctcgccccacgagttcttgatgatccagta 386
            ||||| ||| ||||||||||||||||| | ||||||
Sbjct: 1298 ccagtcctcaccccacgagttcttgatcacccagta 1263



to top

>emb|AJ297265.1|TBR297265 Trypanosoma brucei rhodesiense partial mRNA for cysteine protease
           (rhodesain gene)
          Length = 1350

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 363 ccacgagttcttgatgatccagta 386
           ||||||||| ||||||||||||||
Sbjct: 927 ccacgagtttttgatgatccagta 904



to top

>emb|AJ245868.1|MSA245868 Medicago sativa mRNA for cysteine protease, partial (cyp15a gene)
          Length = 890

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 355 ttctcgccccacgagttcttgatgatccagtatggcttctcctt 398
           |||| |||||| || ||||| ||||||||||| ||||| |||||
Sbjct: 536 ttctggccccatgaattctttatgatccagtaaggcttttcctt 493



to top

>emb|CR860490.1| Pongo pygmaeus mRNA; cDNA DKFZp469F0716 (from clone DKFZp469F0716)
          Length = 3762

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 196  tccaggagggccgccgatca 215
            ||||||||||||||||||||
Sbjct: 1426 tccaggagggccgccgatca 1407



to top

>gb|AC023728.5| Drosophila melanogaster X BAC RP98-6J12 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 175674

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      aagttctttagcccataaaa 21
              ||||||||||||||||||||
Sbjct: 160703 aagttctttagcccataaaa 160684



to top

>dbj|AB226127.1| Aspergillus oryzae cDNA, contig sequence: AoEST2984
          Length = 929

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 435 gacgagaaggacaccgtggtcaaggtgc 462
           |||||| |||||||| ||||||||||||
Sbjct: 312 gacgaggaggacaccctggtcaaggtgc 285



to top

>dbj|AP007169.1| Aspergillus oryzae RIB40 genomic DNA, SC038
          Length = 1725576

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 435    gacgagaaggacaccgtggtcaaggtgc 462
              |||||| |||||||| ||||||||||||
Sbjct: 770095 gacgaggaggacaccctggtcaaggtgc 770122



to top

>gb|AC087182.12| Oryza sativa chromosome 10 BAC OSJNBa0029C15 genomic sequence, complete
             sequence
          Length = 148816

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 35    acatcacatgcatgggcgta 54
             ||||||||||||||||||||
Sbjct: 65430 acatcacatgcatgggcgta 65449



to top

>gb|AF309626.1|AF309626 Leishmania donovani clone Ld-A cysteine protease gene, complete cds
          Length = 1332

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 351 ccagttctcgccccacgagttcttgatgatccagta 386
           ||||| ||| ||||||||||||||||| | ||||||
Sbjct: 942 ccagtcctcaccccacgagttcttgatcacccagta 907



to top

>gb|AC155939.6| Mus musculus 10 BAC RP24-418P10 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 158211

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 243    ctcctccttcgaggagtgtg 262
              ||||||||||||||||||||
Sbjct: 124106 ctcctccttcgaggagtgtg 124125



to top

>gb|AF004592.2|AF004592 Leishmania donovani chagasi amastigote-specific cysteine protease
            (ldccys1) mRNA, complete cds
          Length = 2498

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 351  ccagttctcgccccacgagttcttgatgatccagta 386
            ||||| ||| ||||||||||||||||| | ||||||
Sbjct: 1290 ccagtcctcaccccacgagttcttgatcacccagta 1255



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 35       acatcacatgcatgggcgta 54
                ||||||||||||||||||||
Sbjct: 17866611 acatcacatgcatgggcgta 17866592



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 359      cgccccacgagttcttgatgatccagta 386
                |||||||||||||| ||| |||||||||
Sbjct: 27868940 cgccccacgagttcctgacgatccagta 27868913



to top

>gb|AF217087.1|AF217087 Leishmania chagasi cathepsin L-like cysteine protease gene,
           complete cds
          Length = 1146

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 351 ccagttctcgccccacgagttcttgatgatccagta 386
           ||||| ||| ||||||||||||||||| | ||||||
Sbjct: 903 ccagtcctcaccccacgagttcttgatcacccagta 868



to top

>ref|XM_574585.1| PREDICTED: Rattus norvegicus similar to transmembrane protein 16D
           (LOC499286), mRNA
          Length = 1223

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 374 tgatgatccagtatggcttc 393
           ||||||||||||||||||||
Sbjct: 503 tgatgatccagtatggcttc 522



to top

>dbj|AP006171.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
            clone:OSJNBa0070E11
          Length = 142855

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 359  cgccccacgagttcttgatgatccagta 386
            ||||||||||||||||||  ||||||||
Sbjct: 8530 cgccccacgagttcttgactatccagta 8503



to top

>gb|AF265227.1|AF265227 Trypanosoma cruzi strain TCC cruzipain gene, complete cds
          Length = 1404

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 363 ccacgagttcttgatgatccagta 386
           ||||||||||||||||| ||||||
Sbjct: 918 ccacgagttcttgatgacccagta 895



to top

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 239     cctactcctccttcgaggag 258
               ||||||||||||||||||||
Sbjct: 4554388 cctactcctccttcgaggag 4554369



to top

>dbj|AP003928.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1150_A11
          Length = 142010

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 359   cgccccacgagttcttgatgatccagta 386
             |||||||||||||| ||| |||||||||
Sbjct: 77018 cgccccacgagttcctgacgatccagta 76991



to top

>dbj|AK105612.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-200-B06, full
           insert sequence
          Length = 1351

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 359 cgccccacgagttcttgatgatccagta 386
           |||||||||||||| ||| |||||||||
Sbjct: 956 cgccccacgagttcctgacgatccagta 929



to top

>dbj|AK099308.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023144C09, full
            insert sequence
          Length = 1437

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 359  cgccccacgagttcttgatgatccagta 386
            |||||||||||||| ||| |||||||||
Sbjct: 1042 cgccccacgagttcctgacgatccagta 1015



to top

>dbj|AK072235.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023001J24, full
            insert sequence
          Length = 1437

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 359  cgccccacgagttcttgatgatccagta 386
            |||||||||||||| ||| |||||||||
Sbjct: 1042 cgccccacgagttcctgacgatccagta 1015



to top

>gb|AY111351.1| Zea mays CL1876_2 mRNA sequence
          Length = 532

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 359 cgccccacgagttcttgatgatccagta 386
           ||||||| ||||||||||||| ||||||
Sbjct: 154 cgccccatgagttcttgatgagccagta 127



to top

>gb|AY106223.1| Zea mays PCO114759 mRNA sequence
          Length = 1532

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 359  cgccccacgagttcttgatgatccagta 386
            ||||||| ||||||||||||| ||||||
Sbjct: 1075 cgccccatgagttcttgatgagccagta 1048



to top

>gb|AE003440.3| Drosophila melanogaster chromosome X, section 24 of 74 of the complete
             sequence
          Length = 342195

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     aagttctttagcccataaaa 21
             ||||||||||||||||||||
Sbjct: 26071 aagttctttagcccataaaa 26052



to top

>gb|AY896791.1| Leishmania infantum strain MHOM/PA/78/WR285 cathepsin L-like
           cysteine protease (cpbE) gene, partial cds
          Length = 607

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 351 ccagttctcgccccacgagttcttgatgatccagta 386
           ||||| ||| ||||||||||||||||| | ||||||
Sbjct: 480 ccagtcctcaccccacgagttcttgatcacccagta 445



to top

>gb|AY896788.1| Leishmania donovani strain IMAR/KE/62/LRC-L57 cathepsin L-like
           cysteine protease (cpbF) gene, partial cds
          Length = 639

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 351 ccagttctcgccccacgagttcttgatgatccagta 386
           ||||| ||| ||||||||||||||||| | ||||||
Sbjct: 532 ccagtcctcaccccacgagttcttgatcacccagta 497



to top

>gb|AY896787.1| Leishmania donovani strain MHOM/CN/00/WangJie1 cathepsin L-like
           cysteine protease (cpbF) gene, partial cds
          Length = 676

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 351 ccagttctcgccccacgagttcttgatgatccagta 386
           ||||| ||| ||||||||||||||||| | ||||||
Sbjct: 467 ccagtcctcaccccacgagttcttgatcacccagta 432



to top

>gb|AY896786.1| Leishmania donovani strain MHOM/KE/67/MRC(L)3 cathepsin L-like
           cysteine protease (cpbF) gene, partial cds
          Length = 741

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 351 ccagttctcgccccacgagttcttgatgatccagta 386
           ||||| ||| ||||||||||||||||| | ||||||
Sbjct: 532 ccagtcctcaccccacgagttcttgatcacccagta 497



to top

>gb|AY896785.1| Leishmania donovani strain MHOM/ET/00/HUSSEN cathepsin L-like
           cysteine protease (cpbF) gene, partial cds
          Length = 741

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 351 ccagttctcgccccacgagttcttgatgatccagta 386
           ||||| ||| ||||||||||||||||| | ||||||
Sbjct: 532 ccagtcctcaccccacgagttcttgatcacccagta 497



to top

>gb|AY896784.1| Leishmania donovani strain MHOM/SD/82/GILANI cathepsin L-like
           cysteine protease (cpbF) gene, partial cds
          Length = 741

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 351 ccagttctcgccccacgagttcttgatgatccagta 386
           ||||| ||| ||||||||||||||||| | ||||||
Sbjct: 532 ccagtcctcaccccacgagttcttgatcacccagta 497



to top

>gb|AY896783.1| Leishmania donovani strain MHOM/ET/67/HU3 cathepsin L-like cysteine
           protease (cpbF) gene, partial cds
          Length = 741

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 351 ccagttctcgccccacgagttcttgatgatccagta 386
           ||||| ||| ||||||||||||||||| | ||||||
Sbjct: 532 ccagtcctcaccccacgagttcttgatcacccagta 497



to top

>gb|AY896782.1| Leishmania infantum strain MHOM/MA/67/ITMAP263 cathepsin L-like
           cysteine protease (cpbE) gene, partial cds
          Length = 702

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 351 ccagttctcgccccacgagttcttgatgatccagta 386
           ||||| ||| ||||||||||||||||| | ||||||
Sbjct: 493 ccagtcctcaccccacgagttcttgatcacccagta 458



to top

>gb|AY896781.1| Leishmania infantum strain MHOM/FR/78/LEM75 cathepsin L-like
           cysteine protease (cpbE) gene, partial cds
          Length = 702

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 351 ccagttctcgccccacgagttcttgatgatccagta 386
           ||||| ||| ||||||||||||||||| | ||||||
Sbjct: 493 ccagtcctcaccccacgagttcttgatcacccagta 458



to top

>gb|AY896780.1| Leishmania infantum strain MHOM/FR/85/LEM663 cathepsin L-like
           cysteine protease (cpbE) gene, partial cds
          Length = 702

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 351 ccagttctcgccccacgagttcttgatgatccagta 386
           ||||| ||| ||||||||||||||||| | ||||||
Sbjct: 493 ccagtcctcaccccacgagttcttgatcacccagta 458



to top

>gb|AY896779.1| Leishmania infantum strain MHOM/FR/82/LEM356 cathepsin L-like
           cysteine protease (cpbE) gene, partial cds
          Length = 702

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 351 ccagttctcgccccacgagttcttgatgatccagta 386
           ||||| ||| ||||||||||||||||| | ||||||
Sbjct: 493 ccagtcctcaccccacgagttcttgatcacccagta 458



to top

>gb|AY896778.1| Leishmania infantum strain MHOM/ES/81/BCN1 cathepsin L-like
           cysteine protease (cpbE) gene, partial cds
          Length = 702

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 351 ccagttctcgccccacgagttcttgatgatccagta 386
           ||||| ||| ||||||||||||||||| | ||||||
Sbjct: 493 ccagtcctcaccccacgagttcttgatcacccagta 458



to top

>gb|AY896777.1| Leishmania infantum strain MHOM/FR/85/LEM716 cathepsin L-like
           cysteine protease (cpbE) gene, partial cds
          Length = 702

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 351 ccagttctcgccccacgagttcttgatgatccagta 386
           ||||| ||| ||||||||||||||||| | ||||||
Sbjct: 493 ccagtcctcaccccacgagttcttgatcacccagta 458



to top

>gb|AY896776.1| Leishmania infantum strain MHOM/FR/87/LEM1098 cathepsin L-like
           cysteine protease (cpbE) gene, partial cds
          Length = 702

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 351 ccagttctcgccccacgagttcttgatgatccagta 386
           ||||| ||| ||||||||||||||||| | ||||||
Sbjct: 493 ccagtcctcaccccacgagttcttgatcacccagta 458


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,995,652
Number of Sequences: 3902068
Number of extensions: 2995652
Number of successful extensions: 52522
Number of sequences better than 10.0: 258
Number of HSP's better than 10.0 without gapping: 258
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 51872
Number of HSP's gapped (non-prelim): 611
length of query: 504
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 482
effective length of database: 17,147,199,772
effective search space: 8264950290104
effective search space used: 8264950290104
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top