Clone Name	rbaal36b20
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	dbj|D38088.1|WHTPH2AB Triticum aestivum mRNA for protein H2A, co...	392	e-106
2	dbj|D38090.1|WHTPH2AD Triticum aestivum mRNA for protein H2A, co...	387	e-104
3	emb|X94973.1|TAH2A274 T.aestivum histone H2A gene (clone TH274)	339	5e-90
4	gb|L75802.1|WHTHIH2A Triticum aestivum histone H2A gene, complet...	339	5e-90
5	dbj|D38087.1|WHTPH2AA Triticum aestivum mRNA for protein H2A, co...	319	4e-84
6	gb|AF493985.1| Triticum aestivum H2A-1 gene, partial sequence	208	1e-50
7	gb|BT016569.1| Zea mays clone Contig402 mRNA sequence	196	4e-47
8	gb|AY103710.1| Zea mays PCO123562 mRNA sequence	196	4e-47
9	ref|XM_475374.1| Oryza sativa (japonica cultivar-group), predic...	155	1e-34
10	dbj|AK099763.1| Oryza sativa (japonica cultivar-group) cDNA clon...	155	1e-34
11	dbj|AK067406.1| Oryza sativa (japonica cultivar-group) cDNA clon...	155	1e-34
12	gb|BT019008.1| Zea mays clone Contig499.F mRNA sequence	145	1e-31
13	gb|AC108876.2| Oryza sativa (japonica cultivar-group) chromosome...	145	1e-31
14	gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome...	145	1e-31
15	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	145	1e-31
16	gb|AY103585.1| Zea mays PCO123564 mRNA sequence	143	5e-31
17	gb|BT017719.1| Zea mays clone EL01N0447A04.c mRNA sequence	141	2e-30
18	dbj|AK074018.1| Oryza sativa (japonica cultivar-group) cDNA clon...	141	2e-30
19	ref|NM_193707.1| Oryza sativa (japonica cultivar-group), predic...	139	9e-30
20	gb|AC093921.2| Oryza sativa (japonica cultivar-group) chromosome...	139	9e-30
21	ref|XM_475081.1| Oryza sativa (japonica cultivar-group), predic...	137	3e-29
22	dbj|AK121750.1| Oryza sativa (japonica cultivar-group) cDNA clon...	137	3e-29
23	gb|BT019315.1| Zea mays clone Contig989.F mRNA sequence	135	1e-28
24	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	129	8e-27
25	gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare str...	129	8e-27
26	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	129	8e-27
27	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	129	8e-27
28	dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic D...	129	8e-27
29	gb|BT016301.1| Zea mays clone Contig134 mRNA sequence	127	3e-26
30	gb|AY104486.1| Zea mays PCO109435 mRNA sequence	111	2e-21
31	dbj|AK071511.1| Oryza sativa (japonica cultivar-group) cDNA clon...	107	3e-20
32	dbj|AK058913.1| Oryza sativa (japonica cultivar-group) cDNA clon...	107	3e-20
33	gb|BC068823.1| Xenopus laevis cDNA clone IMAGE:6635737, partial cds	105	1e-19
34	gb|BC010336.1| Mus musculus H2A histone family, member X, mRNA (...	103	5e-19
35	gb|AC122428.4| Mus musculus BAC clone RP24-175C20 from chromosom...	103	5e-19
36	ref|NM_010436.2| Mus musculus H2A histone family, member X (H2af...	103	5e-19
37	emb|Z35401.1|MMHISTH2A M.musculus C3H gene for histone H2A.X	103	5e-19
38	gb|BC005468.1| Mus musculus H2A histone family, member X, mRNA (...	103	5e-19
39	dbj|AK088040.1| Mus musculus 2 days neonate thymus thymic cells ...	103	5e-19
40	gb|AF255739.1|AF255739 Bufo bufo gagarizans replication-dependen...	103	5e-19
41	dbj|AK008124.1| Mus musculus adult male small intestine cDNA, RI...	103	5e-19
42	ref|XM_478632.1| Oryza sativa (japonica cultivar-group), mRNA	100	7e-18
43	dbj|AK099888.1| Oryza sativa (japonica cultivar-group) cDNA clon...	100	7e-18
44	dbj|AK058540.1| Oryza sativa (japonica cultivar-group) cDNA clon...	100	7e-18
45	gb|BC106331.1| Xenopus laevis cDNA clone MGC:130860 IMAGE:720558...	98	3e-17
46	emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A...	98	3e-17
47	dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D...	98	3e-17
48	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	98	3e-17
49	dbj|AP003838.3| Oryza sativa (japonica cultivar-group) genomic D...	98	3e-17
50	gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome...	98	3e-17
51	emb|AL731753.2|CNS08C82 Oryza sativa chromosome 12, . BAC OJ1112...	98	3e-17
52	gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 gene...	98	3e-17
53	ref|XM_865148.1| PREDICTED: Bos taurus similar to Histone H2A.1 ...	96	1e-16
54	ref|NM_178185.1| Mus musculus histone 1, H2ao (Hist1h2ao), mRNA	96	1e-16
55	gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, co...	96	1e-16
56	ref|NG_002734.1| Mus musculus histone 1, H2aj (Hist1h2aj) pseudo...	96	1e-16
57	ref|XM_545430.1| PREDICTED: Canis familiaris similar to Histone ...	96	1e-16
58	ref|XM_849168.1| PREDICTED: Canis familiaris similar to Histone ...	96	1e-16
59	ref|XM_545413.1| PREDICTED: Canis familiaris similar to Histone ...	96	1e-16
60	ref|XM_545411.1| PREDICTED: Canis familiaris similar to Histone ...	96	1e-16
61	ref|XM_545400.2| PREDICTED: Canis familiaris similar to Histone ...	96	1e-16
62	ref|XM_545394.2| PREDICTED: Canis familiaris similar to Histone ...	96	1e-16
63	ref|XM_848774.1| PREDICTED: Canis familiaris similar to Histone ...	96	1e-16
64	ref|XM_848759.1| PREDICTED: Canis familiaris similar to Histone ...	96	1e-16
65	ref|XM_545384.2| PREDICTED: Canis familiaris similar to Histone ...	96	1e-16
66	ref|XM_848716.1| PREDICTED: Canis familiaris similar to Histone ...	96	1e-16
67	ref|XM_545376.2| PREDICTED: Canis familiaris similar to Histone ...	96	1e-16
68	ref|XM_545373.1| PREDICTED: Canis familiaris similar to histone ...	96	1e-16
69	ref|XM_854341.1| PREDICTED: Canis familiaris similar to Histone ...	96	1e-16
70	ref|XM_545390.1| PREDICTED: Canis familiaris similar to Histone ...	96	1e-16
71	ref|XM_978341.1| PREDICTED: Mus musculus similar to histone 2a, ...	96	1e-16
72	ref|XM_978296.1| PREDICTED: Mus musculus similar to histone 2a, ...	96	1e-16
73	ref|XM_539322.1| PREDICTED: Canis familiaris similar to Histone ...	96	1e-16
74	gb|BC058544.1| Mus musculus cDNA clone IMAGE:5711765, with appar...	96	1e-16
75	emb|BX063165.1|CNS09KWH Single read from an extremity of a full-...	96	1e-16
76	emb|BX063164.1|CNS09KWG Single read from an extremity of a full-...	96	1e-16
77	emb|BX040864.1|CNS093P0 Single read from an extremity of a full-...	96	1e-16
78	emb|BX019683.1|CNS08NCN Single read from an extremity of a full-...	96	1e-16
79	emb|BX016451.1|CNS08KUV Single read from an extremity of a full-...	96	1e-16
80	emb|BX009846.1|CNS08FRE Single read from an extremity of a full-...	96	1e-16
81	emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143	96	1e-16
82	emb|X58069.1|MMH2AX Mouse mRNA for Histone H2A.X	96	1e-16
83	emb|X05863.1|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B)	96	1e-16
84	emb|X05862.1|MMHIS2BA Mouse H2B and H2A histone genes (291A)	96	1e-16
85	gb|BC099406.1| Mus musculus histone 1, H2ac, mRNA (cDNA clone MG...	96	1e-16
86	emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chr...	96	1e-16
87	ref|NM_178189.2| Mus musculus histone 1, H2ac (Hist1h2ac), mRNA	96	1e-16
88	emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chr...	96	1e-16
89	emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chrom...	96	1e-16
90	emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chr...	96	1e-16
91	emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chr...	96	1e-16
92	gb|BC065803.1| Mus musculus histone 1, H2ag, mRNA (cDNA clone MG...	96	1e-16
93	gb|BC076498.1| Mus musculus histone 1, H2ae, mRNA (cDNA clone MG...	96	1e-16
94	dbj|AK145443.1| Mus musculus 5 days embryo whole body cDNA, RIKE...	96	1e-16
95	dbj|AK146117.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length...	96	1e-16
96	dbj|AK146846.1| Mus musculus 17 days embryo heart cDNA, RIKEN fu...	96	1e-16
97	ref|NM_175660.2| Mus musculus histone 1, H2ab (Hist1h2ab), mRNA	96	1e-16
98	gb|BC090402.1| Mus musculus cDNA clone MGC:103288 IMAGE:5150365,...	96	1e-16
99	gb|BC062251.1| Mus musculus cDNA clone MGC:73635 IMAGE:1224905, ...	96	1e-16
100	gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016	96	1e-16
101	gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108	96	1e-16
102	ref|NM_178186.2| Mus musculus histone 1, H2ag (Hist1h2ag), mRNA	96	1e-16
103	ref|NM_178187.2| Mus musculus histone 1, H2ae (Hist1h2ae), mRNA	96	1e-16
104	ref|NM_178188.3| Mus musculus histone 1, H2ad (Hist1h2ad), mRNA	96	1e-16
105	gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone...	96	1e-16
106	dbj|AK028026.1| Mus musculus 18-day embryo whole body cDNA, RIKE...	96	1e-16
107	dbj|AK033518.1| Mus musculus adult male colon cDNA, RIKEN full-l...	96	1e-16
108	ref|NM_178182.1| Mus musculus histone 1, H2ai (Hist1h2ai), mRNA	96	1e-16
109	gb|AY158920.1| Mus musculus histone protein Hist1h2ab gene, comp...	96	1e-16
110	gb|AY158919.1| Mus musculus histone protein Hist1h2ac gene, comp...	96	1e-16
111	gb|AY158918.1| Mus musculus histone protein Hist1h2ad gene, comp...	96	1e-16
112	gb|AY158917.1| Mus musculus histone protein Hist1h2ae gene, comp...	96	1e-16
113	gb|AY158915.1| Mus musculus histone protein Hist1h2ag gene, comp...	96	1e-16
114	gb|AY158914.1| Mus musculus histone protein Hist1h2ah gene, comp...	96	1e-16
115	gb|AY158913.1| Mus musculus histone protein Hist1h2ao gene, comp...	96	1e-16
116	gb|AY158910.1| Mus musculus histone protein Hist1h2aj pseudogene...	96	1e-16
117	gb|AY158909.1| Mus musculus histone protein Hist1h2ai gene, comp...	96	1e-16
118	ref|NM_175659.1| Mus musculus histone 1, H2ah (Hist1h2ah), mRNA	96	1e-16
119	gb|M37736.1|MUSHIS2AR Mouse replication-dependent histone H2A.1 ...	96	1e-16
120	gb|U95109.1|MSU95109 Mus spicilegus histone H2a pseudogene, comp...	94	5e-16
121	ref|XM_482492.1| Oryza sativa (japonica cultivar-group), mRNA	92	2e-15
122	ref|XM_868899.1| PREDICTED: Bos taurus similar to Histone H2A.1 ...	92	2e-15
123	ref|XM_545421.1| PREDICTED: Canis familiaris similar to Histone ...	88	3e-14
124	ref|XM_545419.2| PREDICTED: Canis familiaris similar to Histone ...	88	3e-14
125	ref|XM_543796.2| PREDICTED: Canis familiaris similar to H2A hist...	88	3e-14
126	emb|CR700361.2|CNS0G3CL Tetraodon nigroviridis full-length cDNA	88	3e-14
127	emb|BX016452.1|CNS08KUW Single read from an extremity of a full-...	88	3e-14
128	gb|AF255740.1|AF255740 Bufo bufo gagarizans histone H1 (H1) and ...	88	3e-14
129	ref|NM_178183.1| Mus musculus histone 1, H2ak (Hist1h2ak), mRNA	88	3e-14
130	ref|XM_225386.2| PREDICTED: Rattus norvegicus histone 1, H2an (p...	88	3e-14
131	gb|AY158916.1| Mus musculus histone protein Hist1h2af gene, comp...	88	3e-14
132	gb|AY158911.1| Mus musculus histone protein Hist1h2ak gene, comp...	88	3e-14
133	ref|XM_314447.2| Anopheles gambiae str. PEST ENSANGP00000016040 ...	88	3e-14
134	ref|XM_306256.1| Anopheles gambiae str. PEST ENSANGP00000000004 ...	88	3e-14
135	ref|NM_175661.1| Mus musculus histone 1, H2af (Hist1h2af), mRNA	88	3e-14
136	gb|AY109370.1| Zea mays CL2029_4 mRNA sequence	88	3e-14
137	gb|U95111.1|MSU95111 Mus spretus histone H2a pseudogene, complet...	88	3e-14
138	gb|U08225.1|ZMU08225 Zea mays W-22 histone H2A mRNA, complete cds	88	3e-14
139	gb|M33988.1|MUSH2AX1 Mouse histone H2A.1 gene, complete cds	88	3e-14
140	ref|XM_607721.2| PREDICTED: Bos taurus similar to Histone H2A.1 ...	84	4e-13
141	dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D...	84	4e-13
142	ref|XM_225372.2| PREDICTED: Rattus norvegicus similar to Histone...	84	4e-13
143	dbj|AP005734.4| Oryza sativa (japonica cultivar-group) genomic D...	84	4e-13
144	dbj|AP003898.3| Oryza sativa (japonica cultivar-group) genomic D...	84	4e-13
145	dbj|AK121752.1| Oryza sativa (japonica cultivar-group) cDNA clon...	84	4e-13
146	gb|AY108339.1| Zea mays PCO070432 mRNA sequence	84	4e-13
147	gb|BC077427.1| Xenopus laevis MGC82198 protein, mRNA (cDNA clone...	82	2e-12
148	emb|BX008487.1|CNS08EPN Single read from an extremity of a full-...	82	2e-12
149	gb|DQ214188.1| Taeniopygia guttata clone 0058P0024E05 histone 1 ...	80	7e-12
150	gb|DQ214187.1| Taeniopygia guttata clone 0058P0044E04 histone 1 ...	80	7e-12
151	ref|XM_525084.1| PREDICTED: Pan troglodytes similar to Histone H...	80	7e-12
152	gb|BC001193.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC...	80	7e-12
153	gb|BC082269.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC...	80	7e-12
154	ref|XM_868674.1| PREDICTED: Bos taurus similar to Histone H2A.1 ...	80	7e-12
155	ref|NM_177688.2| Mus musculus H2A histone family, member J (H2af...	80	7e-12
156	ref|NM_033445.2| Homo sapiens histone 3, H2a (HIST3H2A), mRNA	80	7e-12
157	ref|XM_906486.2| PREDICTED: Mus musculus similar to H2A histone ...	80	7e-12
158	gb|AC122804.4| Mus musculus BAC clone RP23-296J10 from 6, comple...	80	7e-12
159	ref|XM_848163.1| PREDICTED: Canis familiaris similar to Histone ...	80	7e-12
160	emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chr...	80	7e-12
161	emb|BX007458.1|CNS08DX2 Single read from an extremity of a full-...	80	7e-12
162	dbj|AK053755.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f...	80	7e-12
163	ref|NM_178184.1| Mus musculus histone 1, H2an (Hist1h2an), mRNA	80	7e-12
164	ref|XM_577577.1| PREDICTED: Rattus norvegicus similar to Histone...	80	7e-12
165	ref|XM_576399.1| PREDICTED: Rattus norvegicus similar to Histone...	80	7e-12
166	gb|AY158912.1| Mus musculus histone protein Hist1h2an gene, comp...	80	7e-12
167	dbj|D38091.1|WHTPH2AE Triticum aestivum mRNA for protein H2A, co...	80	7e-12
168	dbj|D38089.1|WHTPH2AC Triticum aestivum mRNA for protein H2A, co...	80	7e-12
169	gb|BC099606.1| Mus musculus H2A histone family, member J, mRNA (...	80	7e-12
170	gb|BC024397.1| Mus musculus H2A histone family, member J, mRNA (...	80	7e-12
171	gb|AY131974.1| Homo sapiens histone H2A (HIST3H2A) gene, complet...	80	7e-12
172	ref|XM_478633.1| Oryza sativa (japonica cultivar-group), mRNA	78	3e-11
173	ref|XM_870470.1| PREDICTED: Bos taurus similar to Histone H2A.1 ...	78	3e-11
174	ref|XM_545426.2| PREDICTED: Canis familiaris similar to Histone ...	78	3e-11
175	emb|X14730.1|CMHIST2A Duck H2A histone gene	78	3e-11
176	dbj|AK059228.1| Oryza sativa (japonica cultivar-group) cDNA clon...	78	3e-11
177	gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, c...	78	3e-11
178	ref|NM_175662.1| Mus musculus histone 2, H2ac (Hist2h2ac), mRNA	76	1e-10
179	ref|NM_013549.1| Mus musculus histone 2, H2aa1 (Hist2h2aa1), mRNA	76	1e-10
180	gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339	76	1e-10
181	ref|XM_603142.2| PREDICTED: Bos taurus similar to histone 1, H2a...	76	1e-10
182	ref|XM_602496.2| PREDICTED: Bos taurus similar to Histone H2A.1 ...	76	1e-10
183	ref|XM_871147.1| PREDICTED: Bos taurus similar to Histone H2A.1 ...	76	1e-10
184	gb|BC010564.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone I...	76	1e-10
185	ref|XM_869001.1| PREDICTED: Bos taurus similar to Histone H2A.1 ...	76	1e-10
186	ref|XM_865976.1| PREDICTED: Bos taurus similar to Histone H2A.g ...	76	1e-10
187	ref|NM_178213.2| Mus musculus histone 2, H2ab (Hist2h2ab), mRNA	76	1e-10
188	ref|XM_981616.1| PREDICTED: Mus musculus similar to H2A histone ...	76	1e-10
189	ref|XM_992084.1| PREDICTED: Mus musculus similar to H2A histone ...	76	1e-10
190	ref|XM_994730.1| PREDICTED: Mus musculus similar to H2A histone ...	76	1e-10
191	ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h...	76	1e-10
192	gb|BC064002.1| Mus musculus cDNA clone IMAGE:6823756, partial cds	76	1e-10
193	gb|AY158922.2| Mus musculus histone protein Hist2h2ab gene, comp...	76	1e-10
194	emb|Z30940.1|MDH2AHIST M.domesticus (CD-1) mRNA for histone H2A ...	76	1e-10
195	emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23	76	1e-10
196	emb|X16148.1|MMHIS2A3 Mouse H2a and H3 histone genes	76	1e-10
197	dbj|AK158457.1| Mus musculus adult inner ear cDNA, RIKEN full-le...	76	1e-10
198	dbj|AK006728.1| Mus musculus adult male testis cDNA, RIKEN full-...	76	1e-10
199	dbj|AK077055.1| Mus musculus adult male testis cDNA, RIKEN full-...	76	1e-10
200	dbj|AK002725.1| Mus musculus adult male kidney cDNA, RIKEN full-...	76	1e-10
201	dbj|AK016171.1| Mus musculus adult male testis cDNA, RIKEN full-...	76	1e-10
202	gb|U62674.1|MMU62674 Mus musculus histone H2a.2-615 (H2a-615), ...	76	1e-10
203	gb|U62673.1|MMU62673 Mus musculus histone H2a(A)-613, histone H2...	76	1e-10
204	dbj|AK028129.1| Mus musculus adult male stomach cDNA, RIKEN full...	76	1e-10
205	ref|NM_178212.1| Mus musculus histone 2, H2aa2 (Hist2h2aa2), mRNA	76	1e-10
206	ref|XM_344599.2| PREDICTED: Rattus norvegicus histone 1, H2ao (p...	76	1e-10
207	gb|AY158953.1| Mus musculus histone protein Hist2h3c2 gene, comp...	76	1e-10
208	gb|AY158925.1| Mus musculus histone protein Hist2h2aa1 gene, com...	76	1e-10
209	gb|AY158924.1| Mus musculus histone protein Hist2h2aa2 gene, com...	76	1e-10
210	gb|AY158923.1| Mus musculus histone protein Hist2h2ac gene, comp...	76	1e-10
211	gb|BC062255.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone M...	76	1e-10
212	gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, comp...	76	1e-10
213	gb|AC157656.3| Mus musculus BAC clone RP23-406A5 from chromosome...	76	1e-10
214	gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, comple...	76	1e-10
215	gb|BC053966.1| Mus musculus histone 2, H2aa2, mRNA (cDNA clone I...	76	1e-10
216	ref|XM_667061.1| Plasmodium berghei strain ANKA histone h2a (PB3...	76	1e-10
217	gb|BC089519.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone M...	76	1e-10
218	gb|U70133.1|BBU70133 Bufo bufo gagarizans replication-dependent ...	76	1e-10
219	gb|AC160122.2| Mus musculus BAC clone RP23-390G1 from chromosome...	76	1e-10
220	ref|XM_527272.1| PREDICTED: Pan troglodytes similar to Histone H...	74	4e-10
221	ref|XM_518300.1| PREDICTED: Pan troglodytes similar to Histone H...	74	4e-10
222	ref|XM_527262.1| PREDICTED: Pan troglodytes similar to histone p...	74	4e-10
223	ref|XM_518289.1| PREDICTED: Pan troglodytes similar to Histone H...	74	4e-10
224	gb|BC104198.1| Homo sapiens histone 1, H2ak, mRNA (cDNA clone MG...	74	4e-10
225	gb|BC104199.1| Homo sapiens histone 1, H2ak, mRNA (cDNA clone MG...	74	4e-10
226	gb|BC016677.1| Homo sapiens histone 1, H2ag, mRNA (cDNA clone MG...	74	4e-10
227	gb|BC067782.1| Homo sapiens histone 1, H2ag, mRNA (cDNA clone IM...	74	4e-10
228	gb|BC034487.2| Homo sapiens histone 1, H2ak, mRNA (cDNA clone IM...	74	4e-10
229	ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@...	74	4e-10
230	ref|NM_021064.3| Homo sapiens histone 1, H2ag (HIST1H2AG), mRNA	74	4e-10
231	ref|NM_003510.2| Homo sapiens histone 1, H2ak (HIST1H2AK), mRNA	74	4e-10
232	emb|Z98744.2|HS193B12 Human DNA sequence from clone RP1-193B12 o...	74	4e-10
233	emb|AL021807.2|HS86C11 Human DNA sequence from clone RP1-86C11 o...	74	4e-10
234	emb|Z83739.1|HSZ83739 H.sapiens hH2A/d gene	74	4e-10
235	emb|X80330.1|CLH2A232 C.longicaudatus genes for histones H2a.2 a...	74	4e-10
236	ref|XM_577573.1| PREDICTED: Rattus norvegicus similar to Histone...	74	4e-10
237	ref|XM_345255.2| PREDICTED: Rattus norvegicus histone 2, H2aa (p...	74	4e-10
238	ref|XM_574998.1| PREDICTED: Rattus norvegicus similar to Hist2h2...	74	4e-10
239	ref|XM_574997.1| PREDICTED: Rattus norvegicus similar to histone...	74	4e-10
240	gb|AY131991.1| Homo sapiens histone H2A (HIST1H2AK) gene, comple...	74	4e-10
241	gb|AY131987.1| Homo sapiens histone H2A (HIST1H2AG) gene, comple...	74	4e-10
242	dbj|AK130106.1| Homo sapiens cDNA FLJ26596 fis, clone LNF08501	74	4e-10
243	gb|AY893520.1| Synthetic construct Homo sapiens clone FLH130895....	74	4e-10
244	gb|L19778.1|HUMH2A1B Homo sapiens histone H2A.1b mRNA, complete cds	74	4e-10
245	emb|AL713943.3|CNS07YPC Oryza sativa chromosome 12, . BAC OSJNBa...	74	4e-10
246	emb|AL731880.3|CNS08C8J Oryza sativa chromosome 12, . BAC OSJNBa...	74	4e-10
247	ref|NG_000827.2| Homo sapiens genomic histone family microcluste...	74	4e-10
248	ref|XM_522264.1| PREDICTED: Pan troglodytes similar to Histone H...	72	2e-09
249	ref|XM_425469.1| PREDICTED: Gallus gallus similar to histone 2, ...	72	2e-09
250	ref|XM_425465.1| PREDICTED: Gallus gallus similar to histone 2, ...	72	2e-09
251	ref|XM_425459.1| PREDICTED: Gallus gallus similar to histone 2, ...	72	2e-09
252	ref|XM_425455.1| PREDICTED: Gallus gallus similar to histone 2, ...	72	2e-09
253	ref|XM_416195.1| PREDICTED: Gallus gallus similar to histone 2, ...	72	2e-09
254	ref|XM_416192.1| PREDICTED: Gallus gallus similar to germinal hi...	72	2e-09
255	gb|BC004915.2| Homo sapiens H2A histone family, member X, mRNA (...	72	2e-09
256	emb|CR673199.2|CNS0FIET Tetraodon nigroviridis full-length cDNA	72	2e-09
257	ref|NM_002105.2| Homo sapiens H2A histone family, member X (H2AF...	72	2e-09
258	emb|AL512384.9| Human DNA sequence from clone RP11-317E16 on chr...	72	2e-09
259	emb|X94693.1|TAH2A254 T.aestivum histone H2A gene	72	2e-09
260	emb|X59962.1|RNTH2AB R.norvegicus genes for TH2A and TH2B histones	72	2e-09
261	emb|X14850.1|HSH2AX Human H2A.X mRNA encoding histone H2A.X	72	2e-09
262	emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4...	72	2e-09
263	emb|V00413.1|GGH2AX Chicken gene for histone H2A with flanking r...	72	2e-09
264	gb|BC013416.2| Homo sapiens H2A histone family, member X, mRNA (...	72	2e-09
265	emb|CR605072.1| full-length cDNA clone CS0DD007YB20 of Neuroblas...	72	2e-09
266	gb|L75824.1|WHTHIH2AA Triticum aestivum histone H2A gene, comple...	72	2e-09
267	gb|DQ015918.1| Homo sapiens H2A histone family, member X (H2AFX)...	72	2e-09
268	ref|NM_021839.1| Rattus norvegicus testis-specific histone 2a (H...	72	2e-09
269	emb|BX933556.1| Gallus gallus finished cDNA, clone ChEST42h4	72	2e-09
270	gb|BC011694.2| Homo sapiens H2A histone family, member X, mRNA (...	72	2e-09
271	dbj|AP003391.1| Homo sapiens genomic DNA, chromosome 11q clone:C...	72	2e-09
272	dbj|D11055.1|CHKH2A4H Gallus gallus gene for H2A histone, comple...	72	2e-09
273	gb|U38933.1|GGU38933 Gallus gallus histone H2A (H2A-VIII) gene, ...	72	2e-09
274	gb|U38931.1|GGU38931 Gallus gallus histone H2A (H2A-VI) gene, co...	72	2e-09
275	gb|U95110.1|MMU95110 Mus macedonicus histone H2a pseudogene, com...	72	2e-09
276	gb|J00864.1|CHKH2A2B Chicken histone H2A/H2B gene pair and flanks	72	2e-09
277	ref|XM_527281.1| PREDICTED: Pan troglodytes similar to H2A histo...	68	3e-08
278	ref|XM_527273.1| PREDICTED: Pan troglodytes similar to Histone H...	68	3e-08
279	ref|XM_518299.1| PREDICTED: Pan troglodytes similar to Histone H...	68	3e-08
280	ref|XM_518286.1| PREDICTED: Pan troglodytes similar to Histone H...	68	3e-08
281	gb|BC062305.1| Homo sapiens cDNA clone IMAGE:3162462	68	3e-08
282	gb|BC017379.1| Homo sapiens histone 1, H2ac, mRNA (cDNA clone MG...	68	3e-08
283	ref|XM_425467.1| PREDICTED: Gallus gallus similar to histone 2, ...	68	3e-08
284	ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone pro...	68	3e-08
285	ref|NG_001335.1| Homo sapiens genomic large histone family clust...	68	3e-08
286	ref|NM_021066.2| Homo sapiens histone 1, H2aj (HIST1H2AJ), mRNA	68	3e-08
287	ref|NM_080596.1| Homo sapiens histone 1, H2ah (HIST1H2AH), mRNA	68	3e-08
288	ref|NM_003512.3| Homo sapiens histone 1, H2ac (HIST1H2AC), mRNA	68	3e-08
289	ref|NM_003509.2| Homo sapiens histone 1, H2ai (HIST1H2AI), mRNA	68	3e-08
290	gb|BC066234.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM...	68	3e-08
291	gb|BC066232.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM...	68	3e-08
292	gb|BC066233.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM...	68	3e-08
293	gb|BC066237.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM...	68	3e-08
294	gb|BC066236.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM...	68	3e-08
295	gb|BC066235.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM...	68	3e-08
296	ref|XM_789760.1| PREDICTED: Strongylocentrotus purpuratus simila...	68	3e-08
297	emb|AL353759.8| Human DNA sequence from clone RP1-221C16 on chro...	68	3e-08
298	emb|AL049822.30|HSJ160A22 Human DNA sequence from clone RP1-160A...	68	3e-08
299	gb|AY270707.1| Homo sapiens clone SKA08-D09 putative promoter se...	68	3e-08
300	emb|AL009179.1|HS97D16 Human DNA sequence from clone RP1-97D16 o...	68	3e-08
301	emb|Z83742.1|HSZ83742 H.sapiens hH2A/c gene	68	3e-08
302	emb|Z83736.1|HSZ83736 H.sapiens hH2A/e gene	68	3e-08
303	emb|Z80778.1|HSH2AL H.sapiens H2A/l gene	68	3e-08
304	ref|XM_781115.1| PREDICTED: Strongylocentrotus purpuratus simila...	68	3e-08
305	ref|NM_001030753.1| Gallus gallus histone H2A (H2A-IX), mRNA	68	3e-08
306	emb|X07763.1|GGH2AB8 Chicken DNA for pCH3.5E histone H2A/H2B seq...	68	3e-08
307	gb|AY849373.1| Emiliania huxleyi histone H2A.X mRNA, complete cds	68	3e-08
308	emb|CR624886.1| full-length cDNA clone CS0DK009YH13 of HeLa cell...	68	3e-08
309	emb|CR621753.1| full-length cDNA clone CS0DI059YA15 of Placenta ...	68	3e-08
310	emb|CR608156.1| full-length cDNA clone CS0DI013YB19 of Placenta ...	68	3e-08
311	ref|NM_001024282.1| Rattus norvegicus Histone H2a (predicted) (R...	68	3e-08
312	gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, h...	68	3e-08
313	gb|U90551.1|HSU90551 Human histone 2A-like protein (H2A/l) mRNA,...	68	3e-08
314	gb|BC093851.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG...	68	3e-08
315	gb|BC093849.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG...	68	3e-08
316	gb|AY131990.1| Homo sapiens histone H2A (HIST1H2AJ) gene, comple...	68	3e-08
317	gb|AY131989.1| Homo sapiens histone H2A (HIST1H2AI) gene, comple...	68	3e-08
318	gb|AY131988.1| Homo sapiens histone H2A (HIST1H2AH) gene, comple...	68	3e-08
319	gb|BC085010.1| Homo sapiens histone 1, H2ac, mRNA (cDNA clone MG...	68	3e-08
320	gb|AY894000.1| Synthetic construct Homo sapiens clone FLH130938....	68	3e-08
321	gb|AY893556.1| Synthetic construct Homo sapiens clone FLH130901....	68	3e-08
322	gb|AY893555.1| Synthetic construct Homo sapiens clone FLH130900....	68	3e-08
323	gb|BC112256.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG...	68	3e-08
324	gb|BC112254.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG...	68	3e-08
325	gb|BC050602.1| Homo sapiens histone 1, H2ac, mRNA (cDNA clone MG...	68	3e-08
326	dbj|AK064299.1| Oryza sativa (japonica cultivar-group) cDNA clon...	68	3e-08
327	gb|U38934.1|GGU38934 Gallus gallus histone H2A (H2A-IX) gene, co...	68	3e-08
328	gb|U38932.1|GGU38932 Gallus gallus histone H2A (H2A-VII) gene, c...	68	3e-08
329	gb|U95113.1|RNU95113 Rattus norvegicus histone H2a gene, complet...	68	3e-08
330	gb|AY131984.1| Homo sapiens histone H2A (HIST1H2AC) gene, comple...	68	3e-08
331	ref|NM_003530.3| Homo sapiens histone 1, H3d (HIST1H3D), mRNA	66	1e-07
332	ref|NM_021065.2| Homo sapiens histone 1, H2ad (HIST1H2AD), mRNA	66	1e-07
333	ref|NM_021052.2| Homo sapiens histone 1, H2ae (HIST1H2AE), mRNA	66	1e-07
334	emb|AL031777.5|HS34B20 Human DNA sequence from clone RP1-34B20 o...	66	1e-07
335	emb|Z80776.1|HSH2AG H.sapiens H2A/g gene	66	1e-07
336	emb|X16495.1|MMHIST2A Murine H2A gene for histone H2A	66	1e-07
337	emb|X59961.1|RNH2AB R.norvegicus genes for H2A and H2B histones	66	1e-07
338	gb|BC093807.1| Homo sapiens histone 1, H2ad, mRNA (cDNA clone MG...	66	1e-07
339	emb|CR541999.1| Homo sapiens full open reading frame cDNA clone ...	66	1e-07
340	emb|CR541970.1| Homo sapiens full open reading frame cDNA clone ...	66	1e-07
341	gb|BC092032.1| Xenopus laevis hypothetical protein MGC83508, mRN...	66	1e-07
342	gb|BC093862.1| Homo sapiens histone 1, H2ae, mRNA (cDNA clone MG...	66	1e-07
343	gb|BC093809.1| Homo sapiens histone 1, H2ad, mRNA (cDNA clone MG...	66	1e-07
344	gb|BC093836.1| Homo sapiens histone 1, H2ae, mRNA (cDNA clone MG...	66	1e-07
345	ref|XM_551996.1| Anopheles gambiae str. PEST ENSANGP00000029020 ...	66	1e-07
346	gb|M60752.1|HUMHISAG Human histone H2A.1 (H2A) gene, complete cds	66	1e-07
347	gb|AY131986.1| Homo sapiens histone H2A (HIST1H2AE) gene, comple...	66	1e-07
348	gb|AY131985.1| Homo sapiens histone H2A (HIST1H2AD) gene, comple...	66	1e-07
349	ref|XM_540292.2| PREDICTED: Canis familiaris similar to histone ...	64	4e-07
350	ref|XM_845715.1| PREDICTED: Canis familiaris similar to Histone ...	64	4e-07
351	ref|XM_540286.2| PREDICTED: Canis familiaris similar to Histone ...	64	4e-07
352	emb|X07766.1|GGH2AB11 Chicken DNA for CH1-10 histone H2A/H2B seq...	64	4e-07
353	gb|AY849374.1| Emiliania huxleyi histone H2A mRNA, complete cds	64	4e-07
354	emb|CR457079.1| Homo sapiens full open reading frame cDNA clone ...	64	4e-07
355	dbj|AB168678.1| Macaca fascicularis testis cDNA clone: QtsA-1409...	64	4e-07
356	gb|AY104637.1| Zea mays PCO070433 mRNA sequence	64	4e-07
357	ref|XM_527254.1| PREDICTED: Pan troglodytes similar to HIST2H3C ...	62	2e-06
358	ref|XM_870473.1| PREDICTED: Bos taurus similar to Histone H2A.1 ...	62	2e-06
359	ref|NM_003513.2| Homo sapiens histone 1, H2ab (HIST1H2AB), mRNA	62	2e-06
360	emb|X00089.1|HSHISH2A Human histone H2a gene	62	2e-06
361	emb|Z83741.1|HSZ83741 H.sapiens hH2A/m gene	62	2e-06
362	gb|AY131983.1| Homo sapiens histone H2A (HIST1H2AB) gene, comple...	62	2e-06
363	gb|AY158938.1| Mus musculus histone protein Hist1h2bb gene, comp...	62	2e-06
364	gb|AY158937.1| Mus musculus histone protein Hist1h2bc gene, comp...	62	2e-06
365	dbj|AK214754.1| Mus musculus cDNA, clone:Y2G0132O07, strand:minu...	62	2e-06
366	gb|BC060324.1| Homo sapiens histone 2, H2ac, mRNA (cDNA clone MG...	60	6e-06
367	ref|XM_527287.1| PREDICTED: Pan troglodytes similar to Histone H...	60	6e-06
368	ref|XM_527283.1| PREDICTED: Pan troglodytes similar to Hist2h2aa...	60	6e-06
369	ref|XM_513764.1| PREDICTED: Pan troglodytes LOC457261 (LOC457261...	60	6e-06
370	ref|NM_003517.2| Homo sapiens histone 2, H2ac (HIST2H2AC), mRNA	60	6e-06
371	gb|AY648852.1| Homo sapiens histone H2A/r gene, complete cds	60	6e-06
372	gb|BC019308.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG...	60	6e-06
373	gb|BC001629.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG...	60	6e-06
374	ref|XM_583411.2| PREDICTED: Bos taurus similar to Histone H2A.l ...	60	6e-06
375	ref|XM_869647.1| PREDICTED: Bos taurus similar to Histone H2A.l ...	60	6e-06
376	gb|BC069306.1| Homo sapiens histone 1, H2al, mRNA (cDNA clone MG...	60	6e-06
377	ref|XM_602557.2| PREDICTED: Bos taurus similar to Histone H2A.1 ...	60	6e-06
378	ref|NM_003516.2| Homo sapiens histone 2, H2aa (HIST2H2AA), mRNA	60	6e-06
379	ref|NM_003514.2| Homo sapiens histone 1, H2am (HIST1H2AM), mRNA	60	6e-06
380	ref|NM_003511.2| Homo sapiens histone 1, H2al (HIST1H2AL), mRNA	60	6e-06
381	gb|BC098891.1| Danio rerio zgc:114037, mRNA (cDNA clone MGC:1140...	60	6e-06
382	ref|NM_001031826.1| Danio rerio zgc:114037 (zgc:114037), mRNA	60	6e-06
383	emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on ch...	60	6e-06
384	ref|XM_785689.1| PREDICTED: Strongylocentrotus purpuratus simila...	60	6e-06
385	gb|AF517874.1| Griffithsia japonica isolate Gj10 histone protein...	60	6e-06
386	emb|X83549.1|HSHISTN2A H.sapiens gene for histone H2A	60	6e-06
387	emb|X57138.1|HSH2B2H2 Human H2B.2 and H2A.1 genes for Histone H2...	60	6e-06
388	gb|BC032686.1| Homo sapiens, clone IMAGE:5581652, mRNA	60	6e-06
389	ref|XM_683419.1| PREDICTED: Danio rerio similar to replication-d...	60	6e-06
390	ref|XM_928387.1| PREDICTED: Homo sapiens similar to Histone H2A....	60	6e-06
391	emb|CR541872.1| Homo sapiens full open reading frame cDNA clone ...	60	6e-06
392	emb|CR536525.1| Homo sapiens full open reading frame cDNA clone ...	60	6e-06
393	dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D...	60	6e-06
394	gb|AY131993.1| Homo sapiens histone H2A (HIST1H2AM) gene, comple...	60	6e-06
395	gb|AY131992.1| Homo sapiens histone H2A (HIST1H2AL) gene, comple...	60	6e-06
396	gb|AY894055.1| Synthetic construct Homo sapiens clone FLH131281....	60	6e-06
397	gb|AY894054.1| Synthetic construct Homo sapiens clone FLH130836....	60	6e-06
398	gb|BC112072.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG...	60	6e-06
399	gb|BC098171.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG...	60	6e-06
400	gb|BC096705.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG...	60	6e-06
401	gb|BC096739.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG...	60	6e-06
402	gb|BC071668.1| Homo sapiens histone 1, H2am, mRNA (cDNA clone MG...	60	6e-06
403	gb|BC105129.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG...	60	6e-06
404	gb|BC032756.1| Homo sapiens histone 1, H2am, mRNA (cDNA clone MG...	60	6e-06
405	dbj|D11054.1|CHKH2A3H Gallus gallus gene for H2A histone, comple...	60	6e-06
406	emb|AL662960.3|OSJN00162 Oryza sativa genomic DNA, chromosome 4,...	60	6e-06
407	gb|L19779.1|HUMH2A2A Homo sapiens histone H2A.2 mRNA, complete cds	60	6e-06
408	emb|CR354435.20| Zebrafish DNA sequence from clone CH211-113A14 ...	60	6e-06
409	gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-I...	60	6e-06
410	gb|AY131973.1| Homo sapiens histone H2A (HIST2H2AC) gene, comple...	60	6e-06
411	gb|AY131971.1| Homo sapiens histone H2A (HIST2H2AA) gene, comple...	60	6e-06
412	gb|AF377946.3| Oryza sativa (japonica cultivar-group) chromosome...	58	3e-05
413	gb|AC146936.4| Oryza sativa (japonica cultivar-group) chromosome...	58	3e-05
414	ref|XM_871500.1| PREDICTED: Bos taurus similar to Histone H2A.o ...	58	3e-05
415	ref|XM_614586.2| PREDICTED: Bos taurus similar to Histone H2A.o ...	58	3e-05
416	gb|AC147426.2| Oryza sativa chromosome 3 B1377B10 genomic seque...	58	3e-05
417	gb|BC031333.1| Homo sapiens histone 1, H3d, mRNA (cDNA clone MGC...	58	3e-05
418	ref|XM_866756.1| PREDICTED: Bos taurus similar to H3 histone, fa...	58	3e-05
419	ref|XM_591391.2| PREDICTED: Bos taurus similar to Histone H2A.o ...	58	3e-05
420	ref|XM_906200.1| PREDICTED: Mus musculus similar to histone H2A ...	58	3e-05
421	ref|XM_886305.1| PREDICTED: Mus musculus similar to histone H2A ...	58	3e-05
422	gb|AY131972.1| Homo sapiens histone H2A (HIST2H2AB) gene, comple...	58	3e-05
423	ref|NM_178218.2| Mus musculus histone 3, H2a (Hist3h2a), mRNA	56	1e-04
424	ref|XM_610233.2| PREDICTED: Bos taurus similar to Histone H2AFX ...	56	1e-04
425	gb|BC063781.1| Mus musculus histone 3, H2a, mRNA (cDNA clone MGC...	56	1e-04
426	gb|BC058119.1| Mus musculus histone 3, H2a, mRNA (cDNA clone IMA...	56	1e-04
427	emb|CR709561.2|CNS0GAG5 Tetraodon nigroviridis full-length cDNA	56	1e-04
428	ref|XM_683706.1| PREDICTED: Danio rerio similar to histone H2A (...	56	1e-04
429	ref|XM_694138.1| PREDICTED: Danio rerio similar to histone H2A (...	56	1e-04
430	ref|XM_688696.1| PREDICTED: Danio rerio similar to histone H2A (...	56	1e-04
431	dbj|AK077568.1| Mus musculus 8 days embryo whole body cDNA, RIKE...	56	1e-04
432	dbj|AK051448.1| Mus musculus 12 days embryo spinal ganglion cDNA...	56	1e-04
433	dbj|AK087537.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f...	56	1e-04
434	dbj|AK015962.1| Mus musculus adult male testis cDNA, RIKEN full-...	56	1e-04
435	dbj|AK083155.1| Mus musculus adult male hippocampus cDNA, RIKEN ...	56	1e-04
436	gb|AY760064.1| Muntiacus muntjak vaginalis H2A histone family me...	56	1e-04
437	dbj|AK082083.1| Mus musculus 0 day neonate cerebellum cDNA, RIKE...	56	1e-04
438	gb|AY158926.1| Mus musculus histone protein Hist3h2a gene, compl...	56	1e-04
439	dbj|AK207984.1| Mus musculus cDNA, clone:Y2G0109L23, strand:minu...	56	1e-04
440	ref|XM_318363.2| Anopheles gambiae str. PEST ENSANGP00000015971 ...	56	1e-04
441	gb|AY110108.1| Zea mays CL14299_1 mRNA sequence	56	1e-04
442	emb|AL662809.14| Mouse DNA sequence from clone RP23-441I8 on chr...	56	1e-04
443	gb|J00950.1|NVIHIS2A Newt histone H2a gene, partial	56	1e-04
444	gb|BC072354.1| Xenopus laevis hypothetical protein MGC83508, mRN...	54	4e-04
445	gb|BC083299.1| Danio rerio zgc:101846, mRNA (cDNA clone MGC:1018...	54	4e-04
446	gb|BC054677.1| Danio rerio cDNA clone IMAGE:5600370, partial cds	54	4e-04
447	emb|BX019514.1|CNS08N7Y Single read from an extremity of a full-...	54	4e-04
448	emb|AJ494852.1|ODI494852 Oikopleura dioica partial H2A.4 gene fo...	54	4e-04
449	ref|NM_001005967.1| Danio rerio zgc:101846 (zgc:101846), mRNA	54	4e-04
450	dbj|AK216150.1| Mus musculus cDNA, clone:Y2G0137G02, strand:minu...	54	4e-04
451	ref|XM_318365.1| Anopheles gambiae str. PEST ENSANGP00000015967 ...	54	4e-04
452	ref|XM_307083.1| Anopheles gambiae str. PEST ENSANGP00000012043 ...	54	4e-04
453	emb|Z65161.1|HS21G2F H.sapiens CpG island DNA genomic Mse1 fragm...	54	4e-04
454	emb|BX120005.6| Zebrafish DNA sequence from clone RP71-56I13 in ...	54	4e-04
455	gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histo...	54	4e-04
456	ref|NM_175065.2| Homo sapiens histone 2, H2ab (HIST2H2AB), mRNA	52	0.002
457	ref|XM_683282.1| PREDICTED: Danio rerio similar to histone H2A (...	52	0.002
458	ref|XM_683060.1| PREDICTED: Danio rerio similar to replication-d...	52	0.002
459	ref|XM_687955.1| PREDICTED: Danio rerio similar to histone H2A (...	52	0.002
460	ref|XM_682538.1| PREDICTED: Danio rerio similar to replication-d...	52	0.002
461	gb|AY104826.1| Zea mays PCO099353 mRNA sequence	52	0.002
462	gb|U16726.1|CRU16726 Chlamydomonas reinhardtii histone H1 (ch1),...	52	0.002
463	gb|M11084.1|SUPHIS2A1 Sea urchin (P.miliaris) late histone H2A-1...	52	0.002
464	gb|M14141.1|SUPH2A2 P.miliaris histone H2A-2.2 gene, complete cds	52	0.002
465	ref|NM_001030332.2| Xenopus tropicalis hypothetical protein LOC5...	50	0.006
466	ref|NM_001030325.2| Xenopus tropicalis hypothetical protein LOC5...	50	0.006
467	gb|BC074601.1| Xenopus tropicalis MGC69325 protein, mRNA (cDNA c...	50	0.006
468	ref|XM_866523.1| PREDICTED: Bos taurus similar to Histone H2A.1 ...	50	0.006
469	emb|CT025304.2| Xenopus tropicalis finished cDNA, clone TNeu074k04	50	0.006
470	emb|X61748.1|SMTBPB S.mytilis telomere-binding protein gene (bet...	50	0.006
471	gb|U63576.1|SMU63576 Stylonychia mytilus SM7 micronuclear telome...	50	0.006
472	gb|BC093343.1| Danio rerio MID1 interacting protein 1, mRNA (cDN...	50	0.006
473	ref|NM_001004821.1| Xenopus tropicalis MGC69325 protein (MGC6932...	50	0.006
474	emb|CR762147.2| Xenopus tropicalis finished cDNA, clone TGas072e19	50	0.006
475	emb|CR761789.2| Xenopus tropicalis finished cDNA, clone TGas125k04	50	0.006
476	gb|U95112.1|MCU95112 Mus caroli histone H2a pseudogene, complete...	50	0.006
477	gb|J00980.1|XELHIS2AL xenopus laevis h2a histone gene & flanks	50	0.006
478	gb|BC107354.1| Mus musculus histone 1, H2aa, mRNA (cDNA clone MG...	48	0.024
479	gb|BC107355.1| Mus musculus histone 1, H2aa, mRNA (cDNA clone MG...	48	0.024
480	ref|NM_175658.1| Mus musculus histone 1, H2aa (Hist1h2aa), mRNA	48	0.024
481	emb|X01064.1|SGHIS2A3 Rainbow trout histone H2A and H3 genes	48	0.024
482	emb|BX088700.1|CNS09S4S DNA centromeric region sequence from BAC...	48	0.024
483	emb|AL606464.11| Mouse DNA sequence from clone RP23-462P2 on chr...	48	0.024
484	ref|XM_687127.1| PREDICTED: Danio rerio similar to replication-d...	48	0.024
485	ref|XM_684224.1| PREDICTED: Danio rerio similar to replication-d...	48	0.024
486	ref|XM_683938.1| PREDICTED: Danio rerio similar to histone H2A (...	48	0.024
487	ref|XM_686987.1| PREDICTED: Danio rerio similar to replication-d...	48	0.024
488	gb|AY158921.1| Mus musculus histone protein Hist1h2aa gene, comp...	48	0.024
489	gb|M11085.1|SUPHIS2A2 Sea urchin (P.miliaris) late histone H2A-2...	48	0.024
490	emb|AL590462.1|CNS07EGJ DNA centromeric region sequence BAC 34F0...	48	0.024
491	ref|NM_006632.1| Homo sapiens solute carrier family 17 (sodium p...	46	0.095
492	ref|XM_866661.1| PREDICTED: Bos taurus similar to Histone H2A.o ...	46	0.095
493	ref|XR_003029.1| PREDICTED: Mus musculus similar to H2A histone ...	46	0.095
494	ref|XR_001920.1| PREDICTED: Mus musculus similar to H2A histone ...	46	0.095
495	ref|XM_390996.1| Gibberella zeae PH-1 chromosome 3 hypothetical ...	46	0.095
496	gb|AC123686.11| Mus musculus chromosome 5, clone RP23-301L9, com...	46	0.095
497	emb|CR722682.2|CNS0GKKG Tetraodon nigroviridis full-length cDNA	46	0.095
498	emb|CR705936.2|CNS0G7NG Tetraodon nigroviridis full-length cDNA	46	0.095
499	emb|CR681249.2|CNS0FOLP Tetraodon nigroviridis full-length cDNA	46	0.095
500	emb|CR673736.2|CNS0FITQ Tetraodon nigroviridis full-length cDNA	46	0.095

---

>dbj|D38088.1|WHTPH2AB Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-3
          Length = 1153

 Score =  392 bits (198), Expect = e-106
 Identities = 245/261 (93%)
 Strand = Plus / Minus

                                                                       
Query: 177 gcggccttcttcttgggcgacttggtggcggccttcttcttgggcgacttggtggcctcc 236
           |||| |||||||||||| ||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 514 gcggtcttcttcttgggggacttggtggcggccttcttcttgggcgacttggtggactcc 455

                                                                       
Query: 237 ttctcggcggcggcggcggacttcttggggagcagcacggagttgatgttggggatcacg 296
           |||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |||
Sbjct: 454 ttctcggcggcgccggcggccttcttggggagcagcacggagttgatgttggggatgacg 395

                                                                       
Query: 297 ccgccgtgggcgatggtgacgcccgcgagcagcctgccgagctcctggtcgttgcggacg 356
           ||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 394 ccgccgtgggcgatggtgacgccggcgagcagcctgcccagctcctggtcgttgcggacg 335

                                                                       
Query: 357 gcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtccttggccgcgttgccg 416
           || || || ||||| |||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 334 gccagcagcaggtggcgcgggatgatgcgcgtcttcttgttgtccttggccgcgttgccg 275

                                
Query: 417 gcgagctcaancacctcggcg 437
           |||||||| |  |||||||||
Sbjct: 274 gcgagctccaggacctcggcg 254



 Score =  111 bits (56), Expect = 2e-21
 Identities = 59/60 (98%)
 Strand = Plus / Minus

                                                                       
Query: 145 tggcggcggtcttcttcttgggggacttggtggcggccttcttcttgggcgacttggtgg 204
           |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 519 tggctgcggtcttcttcttgggggacttggtggcggccttcttcttgggcgacttggtgg 460



 Score = 46.1 bits (23), Expect = 0.095
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 143 cttggcggcggtcttcttcttgggggacttggtgg 177
           ||||| ||||| |||||||||||| ||||||||||
Sbjct: 494 cttggtggcggccttcttcttgggcgacttggtgg 460

---

>dbj|D38090.1|WHTPH2AD Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-9
          Length = 704

 Score =  387 bits (195), Expect = e-104
 Identities = 250/268 (93%), Gaps = 3/268 (1%)
 Strand = Plus / Minus

                                                                       
Query: 170 cttggtggcggccttcttcttgggcgacttggtggcggccttcttcttgggcgacttggt 229
           ||||| |||| ||||||||||||| |||||||||| || |||||||||||||||||||| 
Sbjct: 497 cttggcggcgaccttcttcttgggggacttggtggaggtcttcttcttgggcgacttgg- 439

                                                                       
Query: 230 ggcctccttctcggcggcggcggcggacttcttggggagcagcacggagttgatgttggg 289
             ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 438 --cctccttctcggcggcggcgggggacttcttggggagcagcacggagttgatgttggg 381

                                                                       
Query: 290 gatcacgccgccgtgggcgatggtgacgcccgcgagcagcctgccgagctcctggtcgtt 349
           ||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 380 gatcacgccaccgtgggcgatggtgacgccagcgagcagcctgccgagctcctggtcgtt 321

                                                                       
Query: 350 gcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtccttggccgc 409
           |||||| ||||| || ||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 320 gcggacagcgagcagcaggtggcgcgggatgatgcgggtcttcttgttgtccttggccgc 261

                                       
Query: 410 gttgccggcgagctcaancacctcggcg 437
           ||||||||| ||||| | ||||||||||
Sbjct: 260 gttgccggcaagctccagcacctcggcg 233



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 61/65 (93%)
 Strand = Plus / Minus

                                                                       
Query: 137 ctactccttggcggcggtcttcttcttgggggacttggtggcggccttcttcttgggcga 196
           ||||||||||||||||  ||||||||||||||||||||||| || |||||||||||||||
Sbjct: 503 ctactccttggcggcgaccttcttcttgggggacttggtggaggtcttcttcttgggcga 444

                
Query: 197 cttgg 201
           |||||
Sbjct: 443 cttgg 439

---

>emb|X94973.1|TAH2A274 T.aestivum histone H2A gene (clone TH274)
          Length = 2546

 Score =  339 bits (171), Expect = 5e-90
 Identities = 232/252 (92%), Gaps = 3/252 (1%)
 Strand = Plus / Minus

                                                                        
Query: 181  ccttcttcttgggcgacttggtggcggccttcttcttgggcgacttggtggcctccttct 240
            ||||||||||||| |||||||||| || ||||||||||||||||||||   |||||||||
Sbjct: 2308 ccttcttcttgggggacttggtggaggtcttcttcttgggcgacttgg---cctccttct 2252

                                                                        
Query: 241  cggcggcggcggcggacttcttggggagcagcacggagttgatgttggggatcacgccgc 300
            |||||||||||| |||||||||||| |||||||||||||||||  ||||||| |||||||
Sbjct: 2251 cggcggcggcgggggacttcttgggcagcagcacggagttgattgtggggatgacgccgc 2192

                                                                        
Query: 301  cgtgggcgatggtgacgcccgcgagcagcctgccgagctcctggtcgttgcggacggcga 360
            ||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||
Sbjct: 2191 cgtgggcgatggtgacgccggcaagcagcctgccgagctcctggtcgttgcggacggcga 2132

                                                                        
Query: 361  gaagtaggtgccgcgggatgatgcgggtcttcttgttgtccttggccgcgttgccggcga 420
            | || ||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |
Sbjct: 2131 gcagcaggtggcgcgggatgatgcgggtcttcttgttgtccttggctgcgttgccggcaa 2072

                        
Query: 421  gctcaancacct 432
            |||| | |||||
Sbjct: 2071 gctccagcacct 2060



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 61/66 (92%)
 Strand = Plus / Minus

                                                                        
Query: 136  tctactccttggcggcggtcttcttcttgggggacttggtggcggccttcttcttgggcg 195
            ||||||||||||||||   ||||||||||||||||||||||| || ||||||||||||||
Sbjct: 2326 tctactccttggcggcaaccttcttcttgggggacttggtggaggtcttcttcttgggcg 2267

                  
Query: 196  acttgg 201
            ||||||
Sbjct: 2266 acttgg 2261

---

>gb|L75802.1|WHTHIH2A Triticum aestivum histone H2A gene, complete cds
          Length = 2546

 Score =  339 bits (171), Expect = 5e-90
 Identities = 232/252 (92%), Gaps = 3/252 (1%)
 Strand = Plus / Minus

                                                                        
Query: 181  ccttcttcttgggcgacttggtggcggccttcttcttgggcgacttggtggcctccttct 240
            ||||||||||||| |||||||||| || ||||||||||||||||||||   |||||||||
Sbjct: 2308 ccttcttcttgggggacttggtggaggtcttcttcttgggcgacttgg---cctccttct 2252

                                                                        
Query: 241  cggcggcggcggcggacttcttggggagcagcacggagttgatgttggggatcacgccgc 300
            |||||||||||| |||||||||||| |||||||||||||||||  ||||||| |||||||
Sbjct: 2251 cggcggcggcgggggacttcttgggcagcagcacggagttgattgtggggatgacgccgc 2192

                                                                        
Query: 301  cgtgggcgatggtgacgcccgcgagcagcctgccgagctcctggtcgttgcggacggcga 360
            ||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||
Sbjct: 2191 cgtgggcgatggtgacgccggcaagcagcctgccgagctcctggtcgttgcggacggcga 2132

                                                                        
Query: 361  gaagtaggtgccgcgggatgatgcgggtcttcttgttgtccttggccgcgttgccggcga 420
            | || ||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |
Sbjct: 2131 gcagcaggtggcgcgggatgatgcgggtcttcttgttgtccttggctgcgttgccggcaa 2072

                        
Query: 421  gctcaancacct 432
            |||| | |||||
Sbjct: 2071 gctccagcacct 2060



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 61/66 (92%)
 Strand = Plus / Minus

                                                                        
Query: 136  tctactccttggcggcggtcttcttcttgggggacttggtggcggccttcttcttgggcg 195
            ||||||||||||||||   ||||||||||||||||||||||| || ||||||||||||||
Sbjct: 2326 tctactccttggcggcaaccttcttcttgggggacttggtggaggtcttcttcttgggcg 2267

                  
Query: 196  acttgg 201
            ||||||
Sbjct: 2266 acttgg 2261

---

>dbj|D38087.1|WHTPH2AA Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-2
          Length = 717

 Score =  319 bits (161), Expect = 4e-84
 Identities = 236/261 (90%), Gaps = 9/261 (3%)
 Strand = Plus / Minus

                                                                       
Query: 177 gcggccttcttcttgggcgacttggtggcggccttcttcttgggcgacttggtggcctcc 236
           |||| |||||||||||| ||||||| |||||||||||      |||||||||   |||||
Sbjct: 507 gcggtcttcttcttgggggacttggcggcggccttct------gcgacttgg---cctcc 457

                                                                       
Query: 237 ttctcggcggcggcggcggacttcttggggagcagcacggagttgatgttggggatcacg 296
           ||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 456 ttctcggcggctgcgggggacttcttggggagcagcacggagttgatgttggggatgacg 397

                                                                       
Query: 297 ccgccgtgggcgatggtgacgcccgcgagcagcctgccgagctcctggtcgttgcggacg 356
           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 396 ccgccgtgggcgatggtgacgccggcgagcagcctgccgagctcctggtcgttgcggacg 337

                                                                       
Query: 357 gcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtccttggccgcgttgccg 416
           || || || ||||| |||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 336 gccagcagcaggtggcgcgggatgatgcgcgtcttcttgttgtccttggccgcgttgccg 277

                                
Query: 417 gcgagctcaancacctcggcg 437
           || ||||| |  |||||||||
Sbjct: 276 gcaagctccaggacctcggcg 256



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 145 tggcggcggtcttcttcttgggggacttggtggcggccttct 186
           |||| ||||||||||||||||||||||||| |||||||||||
Sbjct: 512 tggctgcggtcttcttcttgggggacttggcggcggccttct 471

---

>gb|AF493985.1| Triticum aestivum H2A-1 gene, partial sequence
          Length = 538

 Score =  208 bits (105), Expect = 1e-50
 Identities = 143/155 (92%), Gaps = 3/155 (1%)
 Strand = Plus / Plus

                                                                       
Query: 182 cttcttcttgggcgacttggtggcggccttcttcttgggcgacttggtggcctccttctc 241
           |||||||||||| ||||||| ||| | ||||||||||||||||||||   ||||||||||
Sbjct: 192 cttcttcttgggggacttggcggccgtcttcttcttgggcgacttgg---cctccttctc 248

                                                                       
Query: 242 ggcggcggcggcggacttcttggggagcagcacggagttgatgttggggatcacgccgcc 301
           ||||||||| | |||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 249 ggcggcggcaggggacttcttggggagcagcacggagttgatgttggggatcacaccgcc 308

                                              
Query: 302 gtgggcgatggtgacgcccgcgagcagcctgccga 336
           |||||||||||||||||| ||||||||| ||||||
Sbjct: 309 gtgggcgatggtgacgccggcgagcagcttgccga 343



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Plus

                                                                    
Query: 145 tggcggcggtcttcttcttgggggacttggtggcggccttcttcttgggcgacttgg 201
           ||||||| |||||||||||||||||||||| ||| | ||||||||||||||||||||
Sbjct: 182 tggcggccgtcttcttcttgggggacttggcggccgtcttcttcttgggcgacttgg 238



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 143 cttggcggcggtcttcttcttgggggacttgg 174
           ||||||||| |||||||||||||| |||||||
Sbjct: 207 cttggcggccgtcttcttcttgggcgacttgg 238

---

>gb|BT016569.1| Zea mays clone Contig402 mRNA sequence
          Length = 719

 Score =  196 bits (99), Expect = 4e-47
 Identities = 164/186 (88%)
 Strand = Plus / Minus

                                                                       
Query: 252 gcggacttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatg 311
           |||| ||||||||| || ||||| | ||||||||||||||  ||||||||||||||||||
Sbjct: 497 gcggtcttcttgggcaggagcaccgggttgatgttggggaggacgccgccgtgggcgatg 438

                                                                       
Query: 312 gtgacgcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgc 371
           |||||||| |  |||||| |||||||||||| ||||||||||| ||| || || | ||| 
Sbjct: 437 gtgacgccggacagcagcttgccgagctcctcgtcgttgcggatggcaaggagcacgtgg 378

                                                                       
Query: 372 cgcgggatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctcaancacc 431
           ||||||||||||||||||||||||||||||||||| ||||||||||| ||||| | ||||
Sbjct: 377 cgcgggatgatgcgggtcttcttgttgtccttggcagcgttgccggccagctccagcacc 318

                 
Query: 432 tcggcg 437
           ||||||
Sbjct: 317 tcggcg 312

---

>gb|AY103710.1| Zea mays PCO123562 mRNA sequence
          Length = 770

 Score =  196 bits (99), Expect = 4e-47
 Identities = 164/186 (88%)
 Strand = Plus / Minus

                                                                       
Query: 252 gcggacttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatg 311
           |||| ||||||||| || ||||| | ||||||||||||||  ||||||||||||||||||
Sbjct: 497 gcggtcttcttgggcaggagcaccgggttgatgttggggaggacgccgccgtgggcgatg 438

                                                                       
Query: 312 gtgacgcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgc 371
           |||||||| |  |||||| |||||||||||| ||||||||||| ||| || || | ||| 
Sbjct: 437 gtgacgccggacagcagcttgccgagctcctcgtcgttgcggatggcaaggagcacgtgg 378

                                                                       
Query: 372 cgcgggatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctcaancacc 431
           ||||||||||||||||||||||||||||||||||| ||||||||||| ||||| | ||||
Sbjct: 377 cgcgggatgatgcgggtcttcttgttgtccttggcagcgttgccggccagctccagcacc 318

                 
Query: 432 tcggcg 437
           ||||||
Sbjct: 317 tcggcg 312

---

>ref|XM_475374.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 492

 Score =  155 bits (78), Expect = 1e-34
 Identities = 176/209 (84%)
 Strand = Plus / Minus

                                                                       
Query: 229 tggcctccttctcggcggcggcggcggacttcttggggagcagcacggagttgatgttgg 288
           ||||||||||  | ||||||| | ||| |||||||||||||||||| | |||||||||||
Sbjct: 421 tggcctccttggccgcggcggagccggtcttcttggggagcagcaccgggttgatgttgg 362

                                                                       
Query: 289 ggatcacgccgccgtgggcgatggtgacgcccgcgagcagcctgccgagctcctggtcgt 348
           | | ||| |||||||| |||||||||||||| || |||||| | |||||||||| |||||
Sbjct: 361 gcagcaccccgccgtgcgcgatggtgacgccggccagcagcttcccgagctcctcgtcgt 302

                                                                       
Query: 349 tgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtccttggccg 408
           ||||||  || || || | ||||||||||||||| ||| ||||||||||||||   ||||
Sbjct: 301 tgcggatcgccagcagcacgtgccgcgggatgatccggttcttcttgttgtcccgcgccg 242

                                        
Query: 409 cgttgccggcgagctcaancacctcggcg 437
           |||| || || ||||| | ||||||||||
Sbjct: 241 cgttccccgcaagctcgagcacctcggcg 213



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 39/44 (88%), Gaps = 3/44 (6%)
 Strand = Plus / Minus

                                                       
Query: 185 cttcttgggcgacttggtggcggccttcttcttgggcgacttgg 228
           |||||| ||||||||||||| |||||||||   |||||||||||
Sbjct: 477 cttctttggcgacttggtggtggccttctt---gggcgacttgg 437

---

>dbj|AK099763.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013094K03, full
           insert sequence
          Length = 912

 Score =  155 bits (78), Expect = 1e-34
 Identities = 176/209 (84%)
 Strand = Plus / Minus

                                                                       
Query: 229 tggcctccttctcggcggcggcggcggacttcttggggagcagcacggagttgatgttgg 288
           ||||||||||  | ||||||| | ||| |||||||||||||||||| | |||||||||||
Sbjct: 491 tggcctccttggccgcggcggagccggtcttcttggggagcagcaccgggttgatgttgg 432

                                                                       
Query: 289 ggatcacgccgccgtgggcgatggtgacgcccgcgagcagcctgccgagctcctggtcgt 348
           | | ||| |||||||| |||||||||||||| || |||||| | |||||||||| |||||
Sbjct: 431 gcagcaccccgccgtgcgcgatggtgacgccggccagcagcttcccgagctcctcgtcgt 372

                                                                       
Query: 349 tgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtccttggccg 408
           ||||||  || || || | ||||||||||||||| ||| ||||||||||||||   ||||
Sbjct: 371 tgcggatcgccagcagcacgtgccgcgggatgatccggttcttcttgttgtcccgcgccg 312

                                        
Query: 409 cgttgccggcgagctcaancacctcggcg 437
           |||| || || ||||| | ||||||||||
Sbjct: 311 cgttccccgcaagctcgagcacctcggcg 283



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 39/44 (88%), Gaps = 3/44 (6%)
 Strand = Plus / Minus

                                                       
Query: 185 cttcttgggcgacttggtggcggccttcttcttgggcgacttgg 228
           |||||| ||||||||||||| |||||||||   |||||||||||
Sbjct: 547 cttctttggcgacttggtggtggccttctt---gggcgacttgg 507

---

>dbj|AK067406.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013099N23, full
           insert sequence
          Length = 1097

 Score =  155 bits (78), Expect = 1e-34
 Identities = 176/209 (84%)
 Strand = Plus / Minus

                                                                       
Query: 229 tggcctccttctcggcggcggcggcggacttcttggggagcagcacggagttgatgttgg 288
           ||||||||||  | ||||||| | ||| |||||||||||||||||| | |||||||||||
Sbjct: 492 tggcctccttggccgcggcggagccggtcttcttggggagcagcaccgggttgatgttgg 433

                                                                       
Query: 289 ggatcacgccgccgtgggcgatggtgacgcccgcgagcagcctgccgagctcctggtcgt 348
           | | ||| |||||||| |||||||||||||| || |||||| | |||||||||| |||||
Sbjct: 432 gcagcaccccgccgtgcgcgatggtgacgccggccagcagcttcccgagctcctcgtcgt 373

                                                                       
Query: 349 tgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtccttggccg 408
           ||||||  || || || | ||||||||||||||| ||| ||||||||||||||   ||||
Sbjct: 372 tgcggatcgccagcagcacgtgccgcgggatgatccggttcttcttgttgtcccgcgccg 313

                                        
Query: 409 cgttgccggcgagctcaancacctcggcg 437
           |||| || || ||||| | ||||||||||
Sbjct: 312 cgttccccgcaagctcgagcacctcggcg 284



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 39/44 (88%), Gaps = 3/44 (6%)
 Strand = Plus / Minus

                                                       
Query: 185 cttcttgggcgacttggtggcggccttcttcttgggcgacttgg 228
           |||||| ||||||||||||| |||||||||   |||||||||||
Sbjct: 548 cttctttggcgacttggtggtggccttctt---gggcgacttgg 508

---

>gb|BT019008.1| Zea mays clone Contig499.F mRNA sequence
          Length = 674

 Score =  145 bits (73), Expect = 1e-31
 Identities = 146/169 (86%), Gaps = 1/169 (0%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||| || | |||||||||||| | ||||||||||||||||||||| ||
Sbjct: 450 cttcttgggcagcaggaccgggttgatgttgggcaacacgccgccgtgggcgatggtcac 391

                                                                       
Query: 317 gcccgcgagcagcctgcc-gagctcctggtcgttgcggacggcgagaagtaggtgccgcg 375
           ||| |  |||||||| || |||||||| |||||||||||  || || || | ||| ||||
Sbjct: 390 gccggtcagcagccttcccgagctcctcgtcgttgcggatcgccagcagcacgtggcgcg 331

                                                            
Query: 376 ggatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||| |||||| |||||||||||||||||||| |||||||||||||||||
Sbjct: 330 ggacgatgcgcgtcttcttgttgtccttggcagcgttgccggcgagctc 282

---

>gb|AC108876.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1525_A02,
            complete sequence
          Length = 93826

 Score =  145 bits (73), Expect = 1e-31
 Identities = 148/173 (85%)
 Strand = Plus / Plus

                                                                        
Query: 229  tggcctccttctcggcggcggcggcggacttcttggggagcagcacggagttgatgttgg 288
            ||||||||||  | ||||||| | ||| |||||||||||||||||| | |||||||||||
Sbjct: 7349 tggcctccttggccgcggcggagccggtcttcttggggagcagcaccgggttgatgttgg 7408

                                                                        
Query: 289  ggatcacgccgccgtgggcgatggtgacgcccgcgagcagcctgccgagctcctggtcgt 348
            | | ||| |||||||| |||||||||||||| || |||||| | |||||||||| |||||
Sbjct: 7409 gcagcaccccgccgtgcgcgatggtgacgccggccagcagcttcccgagctcctcgtcgt 7468

                                                                 
Query: 349  tgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtcc 401
            ||||||  || || || | ||||||||||||||| ||| ||||||||||||||
Sbjct: 7469 tgcggatcgccagcagcacgtgccgcgggatgatccggttcttcttgttgtcc 7521



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 39/44 (88%), Gaps = 3/44 (6%)
 Strand = Plus / Plus

                                                        
Query: 185  cttcttgggcgacttggtggcggccttcttcttgggcgacttgg 228
            |||||| ||||||||||||| |||||||||   |||||||||||
Sbjct: 7293 cttctttggcgacttggtggtggccttctt---gggcgacttgg 7333

---

>gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1281_H05,
              complete sequence
          Length = 163130

 Score =  145 bits (73), Expect = 1e-31
 Identities = 148/173 (85%)
 Strand = Plus / Plus

                                                                          
Query: 229    tggcctccttctcggcggcggcggcggacttcttggggagcagcacggagttgatgttgg 288
              ||||||||||  | ||||||| | ||| |||||||||||||||||| | |||||||||||
Sbjct: 101706 tggcctccttggccgcggcggagccggtcttcttggggagcagcaccgggttgatgttgg 101765

                                                                          
Query: 289    ggatcacgccgccgtgggcgatggtgacgcccgcgagcagcctgccgagctcctggtcgt 348
              | | ||| |||||||| |||||||||||||| || |||||| | |||||||||| |||||
Sbjct: 101766 gcagcaccccgccgtgcgcgatggtgacgccggccagcagcttcccgagctcctcgtcgt 101825

                                                                   
Query: 349    tgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtcc 401
              ||||||  || || || | ||||||||||||||| ||| ||||||||||||||
Sbjct: 101826 tgcggatcgccagcagcacgtgccgcgggatgatccggttcttcttgttgtcc 101878



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 39/44 (88%), Gaps = 3/44 (6%)
 Strand = Plus / Plus

                                                          
Query: 185    cttcttgggcgacttggtggcggccttcttcttgggcgacttgg 228
              |||||| ||||||||||||| |||||||||   |||||||||||
Sbjct: 101650 cttctttggcgacttggtggtggccttctt---gggcgacttgg 101690

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  145 bits (73), Expect = 1e-31
 Identities = 148/173 (85%)
 Strand = Plus / Plus

                                                                            
Query: 229      tggcctccttctcggcggcggcggcggacttcttggggagcagcacggagttgatgttgg 288
                ||||||||||  | ||||||| | ||| |||||||||||||||||| | |||||||||||
Sbjct: 22512299 tggcctccttggccgcggcggagccggtcttcttggggagcagcaccgggttgatgttgg 22512358

                                                                            
Query: 289      ggatcacgccgccgtgggcgatggtgacgcccgcgagcagcctgccgagctcctggtcgt 348
                | | ||| |||||||| |||||||||||||| || |||||| | |||||||||| |||||
Sbjct: 22512359 gcagcaccccgccgtgcgcgatggtgacgccggccagcagcttcccgagctcctcgtcgt 22512418

                                                                     
Query: 349      tgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtcc 401
                ||||||  || || || | ||||||||||||||| ||| ||||||||||||||
Sbjct: 22512419 tgcggatcgccagcagcacgtgccgcgggatgatccggttcttcttgttgtcc 22512471



 Score =  139 bits (70), Expect = 9e-30
 Identities = 153/181 (84%)
 Strand = Plus / Minus

                                                                          
Query: 252    gcggacttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatg 311
              |||| |||||| ||||||||||| | ||||||||| || | |||||||||||| ||||||
Sbjct: 707409 gcggtcttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgtgcgcgatg 707350

                                                                          
Query: 312    gtgacgcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgc 371
              ||||| || ||||||||| | |||||||||| |||||||||||  || || || | ||||
Sbjct: 707349 gtgaccccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgc 707290

                                                                          
Query: 372    cgcgggatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctcaancacc 431
              | ||||||||| ||| ||||||||||||||   |||||||| ||||||||||| | ||||
Sbjct: 707289 ctcgggatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagctccagcacc 707230

               
Query: 432    t 432
              |
Sbjct: 707229 t 707229



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 39/44 (88%), Gaps = 3/44 (6%)
 Strand = Plus / Plus

                                                            
Query: 185      cttcttgggcgacttggtggcggccttcttcttgggcgacttgg 228
                |||||| ||||||||||||| |||||||||   |||||||||||
Sbjct: 22512243 cttctttggcgacttggtggtggccttctt---gggcgacttgg 22512283

---

>gb|AY103585.1| Zea mays PCO123564 mRNA sequence
          Length = 1953

 Score =  143 bits (72), Expect = 5e-31
 Identities = 135/156 (86%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| || |||||||||| |||||||||||  ||||||||||| |||||||||||
Sbjct: 610 cttcttgggcaggagcacggagtggatgttggggaggacgccgccgtgcgcgatggtgac 551

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||| || |||||| | |||||||||| |||||||||||  || || || | ||| |||||
Sbjct: 550 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccaggagcacgtggcgcgg 491

                                               
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgtt 412
           ||||||||| |||||||||||||| || ||||||||
Sbjct: 490 gatgatgcgcgtcttcttgttgtctttcgccgcgtt 455

---

>gb|BT017719.1| Zea mays clone EL01N0447A04.c mRNA sequence
          Length = 772

 Score =  141 bits (71), Expect = 2e-30
 Identities = 131/151 (86%)
 Strand = Plus / Minus

                                                                       
Query: 250 cggcggacttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcga 309
           |||||| |||||||||||| || |||| ||| |||||||| | ||| |||||||| ||||
Sbjct: 456 cggcggccttcttggggaggaggacggggttaatgttgggcagcacaccgccgtgcgcga 397

                                                                       
Query: 310 tggtgacgcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggt 369
           ||||||| ||  | |||||| |||||||||||| ||||||||||| |||||| || ||||
Sbjct: 396 tggtgaccccacccagcagcttgccgagctcctcgtcgttgcggatggcgaggaggaggt 337

                                          
Query: 370 gccgcgggatgatgcgggtcttcttgttgtc 400
           | ||||||||||||||||| |||||||||||
Sbjct: 336 ggcgcgggatgatgcgggttttcttgttgtc 306



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 185 cttcttgggcgacttggtggcggccttctt 214
           |||||| |||||||||| ||||||||||||
Sbjct: 527 cttcttaggcgacttggcggcggccttctt 498

---

>dbj|AK074018.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033075N03, full
           insert sequence
          Length = 797

 Score =  141 bits (71), Expect = 2e-30
 Identities = 154/182 (84%)
 Strand = Plus / Minus

                                                                       
Query: 252 gcggacttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatg 311
           |||| |||||| ||||||||||| | ||||||||| || | |||||||||||| ||||||
Sbjct: 472 gcggtcttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgtgcgcgatg 413

                                                                       
Query: 312 gtgacgcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgc 371
           ||||| || ||||||||| | |||||||||| |||||||||||  || || || | ||||
Sbjct: 412 gtgaccccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgc 353

                                                                       
Query: 372 cgcgggatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctcaancacc 431
           | ||||||||| ||| ||||||||||||||   |||||||| ||||||||||| | ||||
Sbjct: 352 ctcgggatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagctccagcacc 293

             
Query: 432 tc 433
           ||
Sbjct: 292 tc 291

---

>ref|NM_193707.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 480

 Score =  139 bits (70), Expect = 9e-30
 Identities = 153/181 (84%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| |||||||| | |||||||||||| | |||||| ||||| |||||||| ||
Sbjct: 399 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 340

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||| || |||||| |||||||||||| |||||| | ||  || || || | ||| |||||
Sbjct: 339 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 280

                                                                       
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctcaancacctcggc 436
           |||||| | | |||||||||||||| |||||||||| ||||||||||| | |||||||||
Sbjct: 279 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctccagcacctcggc 220

            
Query: 437 g 437
           |
Sbjct: 219 g 219



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 37/42 (88%), Gaps = 3/42 (7%)
 Strand = Plus / Minus

                                                     
Query: 212 cttcttgggcgacttggtggcctccttctcggcggcggcggc 253
           ||||||||||||||   ||||||||||  |||||||||||||
Sbjct: 450 cttcttgggcgact---tggcctccttgccggcggcggcggc 412

---

>gb|AC093921.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBb0041A22, complete sequence
          Length = 117919

 Score =  139 bits (70), Expect = 9e-30
 Identities = 153/181 (84%)
 Strand = Plus / Minus

                                                                         
Query: 252   gcggacttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatg 311
             |||| |||||| ||||||||||| | ||||||||| || | |||||||||||| ||||||
Sbjct: 52608 gcggtcttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgtgcgcgatg 52549

                                                                         
Query: 312   gtgacgcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgc 371
             ||||| || ||||||||| | |||||||||| |||||||||||  || || || | ||||
Sbjct: 52548 gtgaccccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgc 52489

                                                                         
Query: 372   cgcgggatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctcaancacc 431
             | ||||||||| ||| ||||||||||||||   |||||||| ||||||||||| | ||||
Sbjct: 52488 ctcgggatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagctccagcacc 52429

              
Query: 432   t 432
             |
Sbjct: 52428 t 52428

---

>ref|XM_475081.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 522

 Score =  137 bits (69), Expect = 3e-29
 Identities = 147/173 (84%)
 Strand = Plus / Minus

                                                                       
Query: 252 gcggacttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatg 311
           |||| |||||| ||||||||||| | ||||||||| || | |||||||||||| ||||||
Sbjct: 446 gcggtcttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgtgcgcgatg 387

                                                                       
Query: 312 gtgacgcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgc 371
           ||||| || ||||||||| | |||||||||| |||||||||||  || || || | ||||
Sbjct: 386 gtgaccccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgc 327

                                                                
Query: 372 cgcgggatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           | ||||||||| ||| ||||||||||||||   |||||||| |||||||||||
Sbjct: 326 ctcgggatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagctc 274

---

>dbj|AK121750.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033087I02, full
           insert sequence
          Length = 754

 Score =  137 bits (69), Expect = 3e-29
 Identities = 152/180 (84%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| |||||||| | |||||||||||| | |||||| ||||| |||||||| ||
Sbjct: 489 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 430

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||| || |||||| |||||||||||| |||||| | ||  || || || | ||| |||||
Sbjct: 429 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 370

                                                                       
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctcaancacctcggc 436
           |||||| | | |||||||||||||| |||||||||| ||||||||||| | |||||||||
Sbjct: 369 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctccagcacctcggc 310



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 37/42 (88%), Gaps = 3/42 (7%)
 Strand = Plus / Minus

                                                     
Query: 212 cttcttgggcgacttggtggcctccttctcggcggcggcggc 253
           ||||||||||||||   ||||||||||  |||||||||||||
Sbjct: 540 cttcttgggcgact---tggcctccttgccggcggcggcggc 502

---

>gb|BT019315.1| Zea mays clone Contig989.F mRNA sequence
          Length = 699

 Score =  135 bits (68), Expect = 1e-28
 Identities = 134/156 (85%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| || |||||||||| |||||||||||  ||||| ||||| |||||||||||
Sbjct: 461 cttcttgggcaggagcacggagtggatgttggggaggacgccaccgtgcgcgatggtgac 402

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||| || |||||| | |||||||||| |||||||||||  || || || | ||| |||||
Sbjct: 401 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccaggagcacgtggcgcgg 342

                                               
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgtt 412
           ||||||||| |||||||||||||| || ||||||||
Sbjct: 341 gatgatgcgcgtcttcttgttgtctttcgccgcgtt 306

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  129 bits (65), Expect = 8e-27
 Identities = 148/176 (84%)
 Strand = Plus / Plus

                                                                           
Query: 257     cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
               ||||||||| |||||||| | |||||||||||| | |||||| ||||| |||||||| ||
Sbjct: 9471223 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 9471282

                                                                           
Query: 317     gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
               ||| || |||||| |||||||||||| |||||| | ||  || || || | ||| |||||
Sbjct: 9471283 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 9471342

                                                                       
Query: 377     gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctcaancacct 432
               |||||| | | |||||||||||||| |||||||||| ||||||||||| | |||||
Sbjct: 9471343 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctccagcacct 9471398



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 121/152 (79%)
 Strand = Plus / Minus

                                                                            
Query: 281      gatgttggggatcacgccgccgtgggcgatggtgacgcccgcgagcagcctgccgagctc 340
                ||||||||| | ||||||||||  |||||| ||||||    | ||||||||||  |||||
Sbjct: 28998319 gatgttgggcagcacgccgccggcggcgatcgtgacggtgcccagcagcctgctcagctc 28998260

                                                                            
Query: 341      ctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtc 400
                || ||||||||| || || ||  | | ||||||||| | ||| | | |||||||||||||
Sbjct: 28998259 ctcgtcgttgcgcaccgccagctggatgtgccgcggcacgatcctgttcttcttgttgtc 28998200

                                                
Query: 401      cttggccgcgttgccggcgagctcaancacct 432
                | | |||||||| ||||| ||||| | |||||
Sbjct: 28998199 cctcgccgcgttcccggccagctccagcacct 28998168



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 37/42 (88%), Gaps = 3/42 (7%)
 Strand = Plus / Plus

                                                         
Query: 212     cttcttgggcgacttggtggcctccttctcggcggcggcggc 253
               |||||||||||||||||   |||||||  |||||||||||||
Sbjct: 9471172 cttcttgggcgacttgg---cctccttgccggcggcggcggc 9471210



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 226     tggtggcctccttctcggcg 245
               ||||||||||||||||||||
Sbjct: 7530025 tggtggcctccttctcggcg 7530006



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 235     ccttctcggcggcggcggcg 254
               ||||||||||||||||||||
Sbjct: 2941712 ccttctcggcggcggcggcg 2941731

---

>gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0002D01, from chromosome 3, complete sequence
          Length = 187589

 Score =  129 bits (65), Expect = 8e-27
 Identities = 148/176 (84%)
 Strand = Plus / Plus

                                                                          
Query: 257    cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
              ||||||||| |||||||| | |||||||||||| | |||||| ||||| |||||||| ||
Sbjct: 168623 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 168682

                                                                          
Query: 317    gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
              ||| || |||||| |||||||||||| |||||| | ||  || || || | ||| |||||
Sbjct: 168683 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 168742

                                                                      
Query: 377    gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctcaancacct 432
              |||||| | | |||||||||||||| |||||||||| ||||||||||| | |||||
Sbjct: 168743 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctccagcacct 168798



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 37/42 (88%), Gaps = 3/42 (7%)
 Strand = Plus / Plus

                                                        
Query: 212    cttcttgggcgacttggtggcctccttctcggcggcggcggc 253
              |||||||||||||||||   |||||||  |||||||||||||
Sbjct: 168572 cttcttgggcgacttgg---cctccttgccggcggcggcggc 168610

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  129 bits (65), Expect = 8e-27
 Identities = 148/176 (84%)
 Strand = Plus / Plus

                                                                           
Query: 257     cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
               ||||||||| |||||||| | |||||||||||| | |||||| ||||| |||||||| ||
Sbjct: 9469344 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 9469403

                                                                           
Query: 317     gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
               ||| || |||||| |||||||||||| |||||| | ||  || || || | ||| |||||
Sbjct: 9469404 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 9469463

                                                                       
Query: 377     gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctcaancacct 432
               |||||| | | |||||||||||||| |||||||||| ||||||||||| | |||||
Sbjct: 9469464 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctccagcacct 9469519



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 121/152 (79%)
 Strand = Plus / Minus

                                                                            
Query: 281      gatgttggggatcacgccgccgtgggcgatggtgacgcccgcgagcagcctgccgagctc 340
                ||||||||| | ||||||||||  |||||| ||||||    | ||||||||||  |||||
Sbjct: 29089741 gatgttgggcagcacgccgccggcggcgatcgtgacggtgcccagcagcctgctcagctc 29089682

                                                                            
Query: 341      ctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtc 400
                || ||||||||| || || ||  | | ||||||||| | ||| | | |||||||||||||
Sbjct: 29089681 ctcgtcgttgcgcaccgccagctggatgtgccgcggcacgatcctgttcttcttgttgtc 29089622

                                                
Query: 401      cttggccgcgttgccggcgagctcaancacct 432
                | | |||||||| ||||| ||||| | |||||
Sbjct: 29089621 cctcgccgcgttcccggccagctccagcacct 29089590



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 37/42 (88%), Gaps = 3/42 (7%)
 Strand = Plus / Plus

                                                         
Query: 212     cttcttgggcgacttggtggcctccttctcggcggcggcggc 253
               |||||||||||||||||   |||||||  |||||||||||||
Sbjct: 9469293 cttcttgggcgacttgg---cctccttgccggcggcggcggc 9469331



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 226     tggtggcctccttctcggcg 245
               ||||||||||||||||||||
Sbjct: 7527860 tggtggcctccttctcggcg 7527841



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 235     ccttctcggcggcggcggcg 254
               ||||||||||||||||||||
Sbjct: 2941823 ccttctcggcggcggcggcg 2941842

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  129 bits (65), Expect = 8e-27
 Identities = 148/176 (84%)
 Strand = Plus / Minus

                                                                            
Query: 257      cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
                ||||||||| |||||||| | |||||||||||| | |||||| ||||| |||||||| ||
Sbjct: 17417149 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 17417090

                                                                            
Query: 317      gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
                ||| || |||||| |||||||||||| |||||| | ||  || || || | ||| |||||
Sbjct: 17417089 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 17417030

                                                                        
Query: 377      gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctcaancacct 432
                |||||| | | |||||||||||||| |||||||||| ||||||||||| | |||||
Sbjct: 17417029 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctccagcacct 17416974



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 41/47 (87%), Gaps = 3/47 (6%)
 Strand = Plus / Minus

                                                               
Query: 158      cttcttgggggactt---ggtggcggccttcttcttgggcgacttgg 201
                |||||||||||||||   ||||||||  |||||||| ||||||||||
Sbjct: 43063463 cttcttgggggacttggcggtggcggggttcttctttggcgacttgg 43063417



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                             
Query: 227      ggtggcctccttctcggcggcggcggcgg 255
                |||| |||||| |||||||||||||||||
Sbjct: 21105996 ggtgccctcctcctcggcggcggcggcgg 21106024



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 239      ctcggcggcggcggcggacttcttgggg 266
                ||||||||||||| ||| ||||||||||
Sbjct: 43063481 ctcggcggcggcgacggccttcttgggg 43063454



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                    
Query: 278      gttgatgttggggatcacgccgccgtgggcgatggt 313
                |||||||||||| | ||| ||||| |||||||||||
Sbjct: 43063370 gttgatgttgggcagcactccgccatgggcgatggt 43063335



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 241      cggcggcggcggcggacttc 260
                ||||||||||||||||||||
Sbjct: 35067696 cggcggcggcggcggacttc 35067677



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 232      cctccttctcggcggcggcggcgg 255
                |||||| |||||||||||||||||
Sbjct: 29537985 cctcctcctcggcggcggcggcgg 29538008



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 37/42 (88%), Gaps = 3/42 (7%)
 Strand = Plus / Minus

                                                          
Query: 212      cttcttgggcgacttggtggcctccttctcggcggcggcggc 253
                ||||||||||||||   ||||||||||  |||||||||||||
Sbjct: 17417200 cttcttgggcgact---tggcctccttgccggcggcggcggc 17417162

---

>dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0507H06
          Length = 136351

 Score =  129 bits (65), Expect = 8e-27
 Identities = 148/176 (84%)
 Strand = Plus / Minus

                                                                         
Query: 257   cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
             ||||||||| |||||||| | |||||||||||| | |||||| ||||| |||||||| ||
Sbjct: 70541 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 70482

                                                                         
Query: 317   gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
             ||| || |||||| |||||||||||| |||||| | ||  || || || | ||| |||||
Sbjct: 70481 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 70422

                                                                     
Query: 377   gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctcaancacct 432
             |||||| | | |||||||||||||| |||||||||| ||||||||||| | |||||
Sbjct: 70421 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctccagcacct 70366



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 37/42 (88%), Gaps = 3/42 (7%)
 Strand = Plus / Minus

                                                       
Query: 212   cttcttgggcgacttggtggcctccttctcggcggcggcggc 253
             ||||||||||||||   ||||||||||  |||||||||||||
Sbjct: 70592 cttcttgggcgact---tggcctccttgccggcggcggcggc 70554

---

>gb|BT016301.1| Zea mays clone Contig134 mRNA sequence
          Length = 846

 Score =  127 bits (64), Expect = 3e-26
 Identities = 124/144 (86%)
 Strand = Plus / Minus

                                                                       
Query: 258 ttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgacg 317
           ||||||||||||||||| | |||||||||||| |  || |||||||| ||||||||||||
Sbjct: 396 ttcttggggagcagcacagggttgatgttgggcagaaccccgccgtgtgcgatggtgacg 337

                                                                       
Query: 318 cccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcggg 377
           || || || ||| | |||||||||| |||||||||||  || || |||| ||||||||||
Sbjct: 336 ccggccagtagcttcccgagctcctcgtcgttgcggatcgccagcagtacgtgccgcggg 277

                                   
Query: 378 atgatgcgggtcttcttgttgtcc 401
           ||||| ||| ||||||||||||||
Sbjct: 276 atgatccggttcttcttgttgtcc 253

---

>gb|AY104486.1| Zea mays PCO109435 mRNA sequence
          Length = 992

 Score =  111 bits (56), Expect = 2e-21
 Identities = 122/144 (84%)
 Strand = Plus / Minus

                                                                       
Query: 258 ttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgacg 317
           ||||||||||||||||| | |||||||||||| |  || |||||||| ||||||||||||
Sbjct: 467 ttcttggggagcagcacagggttgatgttgggcagaaccccgccgtgtgcgatggtgacg 408

                                                                       
Query: 318 cccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcggg 377
           || || || ||| | ||||||||||  ||||||||||  || || |||| ||| ||||||
Sbjct: 407 ccggccagtagcttcccgagctcctcatcgttgcggatcgccagcagtacgtgtcgcggg 348

                                   
Query: 378 atgatgcgggtcttcttgttgtcc 401
           ||||| ||| ||||||||||||||
Sbjct: 347 atgatccggttcttcttgttgtcc 324

---

>dbj|AK071511.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023096P04, full
           insert sequence
          Length = 824

 Score =  107 bits (54), Expect = 3e-20
 Identities = 131/157 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 gatgttggggatcacgccgccgtgggcgatggtgacgcccgcgagcagcctgccgagctc 340
           ||||||||| || |||||||||  |||||||||| ||||  |||||||| ||  ||||||
Sbjct: 454 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 395

                                                                       
Query: 341 ctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtc 400
           || ||||||||| || |||||  | | ||| ||||| |  ||||||||||||||||||||
Sbjct: 394 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 335

                                                
Query: 401 cttggccgcgttgccggcgagctcaancacctcggcg 437
           | | |||||||| ||||||||||| | ||||||||||
Sbjct: 334 cctcgccgcgttcccggcgagctccagcacctcggcg 298

---

>dbj|AK058913.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-009-A01, full
           insert sequence
          Length = 733

 Score =  107 bits (54), Expect = 3e-20
 Identities = 131/157 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 gatgttggggatcacgccgccgtgggcgatggtgacgcccgcgagcagcctgccgagctc 340
           ||||||||| || |||||||||  |||||||||| ||||  |||||||| ||  ||||||
Sbjct: 453 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 394

                                                                       
Query: 341 ctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtc 400
           || ||||||||| || |||||  | | ||| ||||| |  ||||||||||||||||||||
Sbjct: 393 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 334

                                                
Query: 401 cttggccgcgttgccggcgagctcaancacctcggcg 437
           | | |||||||| ||||||||||| | ||||||||||
Sbjct: 333 cctcgccgcgttcccggcgagctccagcacctcggcg 297

---

>gb|BC068823.1| Xenopus laevis cDNA clone IMAGE:6635737, partial cds
          Length = 763

 Score =  105 bits (53), Expect = 1e-19
 Identities = 134/161 (83%)
 Strand = Plus / Plus

                                                                       
Query: 258 ttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgacg 317
           ||||||||||||||||| || | ||||||||| |  || ||||| |||||||||||||| 
Sbjct: 290 ttcttggggagcagcacagactggatgttgggcagaaccccgccctgggcgatggtgacc 349

                                                                       
Query: 318 cccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcggg 377
           ||  |||||||  ||  |||||||| ||||||||| ||||||||  | |||||||  |||
Sbjct: 350 cctccgagcagtttgttgagctcctcgtcgttgcgcacggcgagctgcaggtgcctgggg 409

                                                    
Query: 378 atgatgcgggtcttcttgttgtccttggccgcgttgccggc 418
           |||||||| ||||||||||| |||  ||| |||||||||||
Sbjct: 410 atgatgcgagtcttcttgttatcccgggcagcgttgccggc 450

---

>gb|BC010336.1| Mus musculus H2A histone family, member X, mRNA (cDNA clone
           MGC:11561 IMAGE:3156946), complete cds
          Length = 1414

 Score =  103 bits (52), Expect = 5e-19
 Identities = 139/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 407 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 348

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           |||  | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 347 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 288

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 287 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 240

---

>gb|AC122428.4| Mus musculus BAC clone RP24-175C20 from chromosome 9, complete sequence
          Length = 185902

 Score =  103 bits (52), Expect = 5e-19
 Identities = 139/168 (82%)
 Strand = Plus / Plus

                                                                          
Query: 257    cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
              ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 149654 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 149713

                                                                          
Query: 317    gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
              |||  | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 149714 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 149773

                                                              
Query: 377    gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
              ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 149774 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 149821

---

>ref|NM_010436.2| Mus musculus H2A histone family, member X (H2afx), mRNA
          Length = 1414

 Score =  103 bits (52), Expect = 5e-19
 Identities = 139/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 407 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 348

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           |||  | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 347 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 288

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 287 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 240

---

>emb|Z35401.1|MMHISTH2A M.musculus C3H gene for histone H2A.X
          Length = 2166

 Score =  103 bits (52), Expect = 5e-19
 Identities = 139/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 986 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 927

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           |||  | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 926 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 867

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 866 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 819

---

>gb|BC005468.1| Mus musculus H2A histone family, member X, mRNA (cDNA clone
           MGC:6616 IMAGE:3490058), complete cds
          Length = 1367

 Score =  103 bits (52), Expect = 5e-19
 Identities = 139/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 401 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 342

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           |||  | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 341 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 282

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 281 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 234

---

>dbj|AK088040.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430002L09
           product:H2A histone family, member X, full insert
           sequence
          Length = 1379

 Score =  103 bits (52), Expect = 5e-19
 Identities = 139/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 430 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 371

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           |||  | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 370 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 311

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 310 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 263

---

>gb|AF255739.1|AF255739 Bufo bufo gagarizans replication-dependent histone H2A gene, complete
            cds
          Length = 2120

 Score =  103 bits (52), Expect = 5e-19
 Identities = 121/144 (84%)
 Strand = Plus / Minus

                                                                        
Query: 257  cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
            ||||||||| ||||||||||  | ||||||||| |  ||||| || ||||||||||||||
Sbjct: 1165 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatggtgac 1106

                                                                        
Query: 317  gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
            |||  | |||||| ||  |||||||| ||||||||| ||||| ||  | ||||| || ||
Sbjct: 1105 gccgcccagcagcttgttgagctcctcgtcgttgcgcacggccagctgcaggtgacgggg 1046

                                    
Query: 377  gatgatgcgggtcttcttgttgtc 400
            ||||||||||||||||||||||||
Sbjct: 1045 gatgatgcgggtcttcttgttgtc 1022

---

>dbj|AK008124.1| Mus musculus adult male small intestine cDNA, RIKEN full-length
           enriched library, clone:2010005I09 product:H2A histone
           family, member X, full insert sequence
          Length = 564

 Score =  103 bits (52), Expect = 5e-19
 Identities = 139/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 427 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 368

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           |||  | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 367 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 308

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 307 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 260

---

>ref|XM_478632.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 823

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 127/153 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 gatgttggggatcacgccgccgtgggcgatggtgacgcccgcgagcagcctgccgagctc 340
           ||||||||| ||||||||||||  |||||||||| ||||  |||||||| ||   | |||
Sbjct: 488 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 429

                                                                       
Query: 341 ctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtc 400
           || ||||||||| || |||||  | | ||| ||||| | |||||||||||||||||||||
Sbjct: 428 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 369

                                            
Query: 401 cttggccgcgttgccggcgagctcaancacctc 433
           | | |||||||| ||||||||||| | ||||||
Sbjct: 368 cctcgccgcgttcccggcgagctcgagcacctc 336

---

>dbj|AK099888.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013112I10, full
           insert sequence
          Length = 823

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 127/153 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 gatgttggggatcacgccgccgtgggcgatggtgacgcccgcgagcagcctgccgagctc 340
           ||||||||| ||||||||||||  |||||||||| ||||  |||||||| ||   | |||
Sbjct: 488 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 429

                                                                       
Query: 341 ctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtc 400
           || ||||||||| || |||||  | | ||| ||||| | |||||||||||||||||||||
Sbjct: 428 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 369

                                            
Query: 401 cttggccgcgttgccggcgagctcaancacctc 433
           | | |||||||| ||||||||||| | ||||||
Sbjct: 368 cctcgccgcgttcccggcgagctcgagcacctc 336

---

>dbj|AK058540.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-017-B06, full
           insert sequence
          Length = 1718

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 127/153 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 gatgttggggatcacgccgccgtgggcgatggtgacgcccgcgagcagcctgccgagctc 340
           ||||||||| ||||||||||||  |||||||||| ||||  |||||||| ||   | |||
Sbjct: 489 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 430

                                                                       
Query: 341 ctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtc 400
           || ||||||||| || |||||  | | ||| ||||| | |||||||||||||||||||||
Sbjct: 429 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 370

                                            
Query: 401 cttggccgcgttgccggcgagctcaancacctc 433
           | | |||||||| ||||||||||| | ||||||
Sbjct: 369 cctcgccgcgttcccggcgagctcgagcacctc 337

---

>gb|BC106331.1| Xenopus laevis cDNA clone MGC:130860 IMAGE:7205580, complete cds
          Length = 799

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 258 ttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgacg 317
           ||||||||||||||||| || | ||||||||| |  || ||||| |||||||||||||| 
Sbjct: 371 ttcttggggagcagcacagactggatgttgggcaggacaccgccctgggcgatggtgacc 312

                                                                       
Query: 318 cccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcggg 377
           ||  |||||||  ||  |||||||| ||||||||| ||||||||  | |||||||  |||
Sbjct: 311 cctccgagcagtttgttgagctcctcgtcgttgcgcacggcgagctgcaggtgcctgggg 252

                                                    
Query: 378 atgatgcgggtcttcttgttgtccttggccgcgttgccggc 418
           ||||| || ||||||||||| |||  ||| |||||||||||
Sbjct: 251 atgatccgagtcttcttgttatcccgggcagcgttgccggc 211

---

>emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A with genes H1A, H2B, H3
            and H4
          Length = 8592

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                        
Query: 258  ttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgacg 317
            ||||||||||||||||| || | ||||||||| |  || ||||| |||||||||||||| 
Sbjct: 4730 ttcttggggagcagcacagactggatgttgggcaggacaccgccctgggcgatggtgacc 4671

                                                                        
Query: 318  cccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcggg 377
            ||  |||||||  ||  |||||||| ||||||||| ||||||||  | |||||||  |||
Sbjct: 4670 cctccgagcagtttgttgagctcctcgtcgttgcgcacggcgagctgcaggtgcctgggg 4611

                                                     
Query: 378  atgatgcgggtcttcttgttgtccttggccgcgttgccggc 418
            ||||| || ||||||||||| |||  ||| |||||||||||
Sbjct: 4610 atgatccgagtcttcttgttatcccgggcagcgttgccggc 4570

---

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 126/152 (82%)
 Strand = Plus / Plus

                                                                            
Query: 281      gatgttggggatcacgccgccgtgggcgatggtgacgcccgcgagcagcctgccgagctc 340
                ||||||||| || |||||||||  |||||||||| ||||  |||||||| ||  ||||||
Sbjct: 14468549 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 14468608

                                                                            
Query: 341      ctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtc 400
                || ||||||||| || |||||  | | ||| ||||| |  ||||||||||||||||||||
Sbjct: 14468609 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 14468668

                                                
Query: 401      cttggccgcgttgccggcgagctcaancacct 432
                | | |||||||| ||||||||||| | |||||
Sbjct: 14468669 cctcgccgcgttcccggcgagctccagcacct 14468700



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 123/152 (80%)
 Strand = Plus / Plus

                                                                            
Query: 281      gatgttggggatcacgccgccgtgggcgatggtgacgcccgcgagcagcctgccgagctc 340
                ||||||||| | ||||||||||  ||||||||||||| |  ||||||||||||  |||||
Sbjct: 20924457 gatgttgggcagcacgccgccggcggcgatggtgacggcgccgagcagcctgctcagctc 20924516

                                                                            
Query: 341      ctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtc 400
                || ||||||||| || || ||  | | ||||| ||| | ||| ||| |||||||||||||
Sbjct: 20924517 ctcgtcgttgcgcaccgccagctggatgtgcctcggcacgatccggttcttcttgttgtc 20924576

                                                
Query: 401      cttggccgcgttgccggcgagctcaancacct 432
                | | |||||||| || || ||||| | |||||
Sbjct: 20924577 cctcgccgcgttccccgccagctccagcacct 20924608



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 232     cctccttctcggcggcggcggcgg 255
               |||||| |||||||||||||||||
Sbjct: 2993839 cctcctcctcggcggcggcggcgg 2993816

---

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 126/152 (82%)
 Strand = Plus / Minus

                                                                            
Query: 281      gatgttggggatcacgccgccgtgggcgatggtgacgcccgcgagcagcctgccgagctc 340
                ||||||||| ||||||||||||  |||||||||| ||||  |||||||| ||   | |||
Sbjct: 21537003 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 21536944

                                                                            
Query: 341      ctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtc 400
                || ||||||||| || |||||  | | ||| ||||| | |||||||||||||||||||||
Sbjct: 21536943 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 21536884

                                                
Query: 401      cttggccgcgttgccggcgagctcaancacct 432
                | | |||||||| ||||||||||| | |||||
Sbjct: 21536883 cctcgccgcgttcccggcgagctcgagcacct 21536852



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 78/91 (85%)
 Strand = Plus / Minus

                                                                            
Query: 336      agctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttg 395
                ||||||| ||||||||||||||||||  | | ||| || || |  |||||||||||||||
Sbjct: 21539587 agctcctcgtcgttgcggacggcgagctggatgtggcggggcactatgcgggtcttcttg 21539528

                                               
Query: 396      ttgtccttggccgcgttgccggcgagctcaa 426
                |||||| | |||||||| |||||||||||||
Sbjct: 21539527 ttgtccctcgccgcgttcccggcgagctcaa 21539497



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 228     gtggcctccttctcggcggcggcggcgg 255
               ||||||||||  ||||||||||||||||
Sbjct: 4013808 gtggcctcctcgtcggcggcggcggcgg 4013835



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 237     ttctcggcggcggcggcgga 256
               ||||||||||||||||||||
Sbjct: 3854952 ttctcggcggcggcggcgga 3854933

---

>dbj|AP003838.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1582_D10
          Length = 103475

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 126/152 (82%)
 Strand = Plus / Minus

                                                                         
Query: 281   gatgttggggatcacgccgccgtgggcgatggtgacgcccgcgagcagcctgccgagctc 340
             ||||||||| ||||||||||||  |||||||||| ||||  |||||||| ||   | |||
Sbjct: 74787 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 74728

                                                                         
Query: 341   ctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtc 400
             || ||||||||| || |||||  | | ||| ||||| | |||||||||||||||||||||
Sbjct: 74727 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 74668

                                             
Query: 401   cttggccgcgttgccggcgagctcaancacct 432
             | | |||||||| ||||||||||| | |||||
Sbjct: 74667 cctcgccgcgttcccggcgagctcgagcacct 74636



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 78/91 (85%)
 Strand = Plus / Minus

                                                                         
Query: 336   agctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttg 395
             ||||||| ||||||||||||||||||  | | ||| || || |  |||||||||||||||
Sbjct: 77371 agctcctcgtcgttgcggacggcgagctggatgtggcggggcactatgcgggtcttcttg 77312

                                            
Query: 396   ttgtccttggccgcgttgccggcgagctcaa 426
             |||||| | |||||||| |||||||||||||
Sbjct: 77311 ttgtccctcgccgcgttcccggcgagctcaa 77281

---

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 126/152 (82%)
 Strand = Plus / Plus

                                                                            
Query: 281      gatgttggggatcacgccgccgtgggcgatggtgacgcccgcgagcagcctgccgagctc 340
                ||||||||| || |||||||||  |||||||||| ||||  |||||||| ||  ||||||
Sbjct: 14422833 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 14422892

                                                                            
Query: 341      ctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtc 400
                || ||||||||| || |||||  | | ||| ||||| |  ||||||||||||||||||||
Sbjct: 14422893 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 14422952

                                                
Query: 401      cttggccgcgttgccggcgagctcaancacct 432
                | | |||||||| ||||||||||| | |||||
Sbjct: 14422953 cctcgccgcgttcccggcgagctccagcacct 14422984



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 123/152 (80%)
 Strand = Plus / Plus

                                                                            
Query: 281      gatgttggggatcacgccgccgtgggcgatggtgacgcccgcgagcagcctgccgagctc 340
                ||||||||| | ||||||||||  ||||||||||||| |  ||||||||||||  |||||
Sbjct: 20850671 gatgttgggcagcacgccgccggcggcgatggtgacggcgccgagcagcctgctcagctc 20850730

                                                                            
Query: 341      ctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtc 400
                || ||||||||| || || ||  | | ||||| ||| | ||| ||| |||||||||||||
Sbjct: 20850731 ctcgtcgttgcgcaccgccagctggatgtgcctcggcacgatccggttcttcttgttgtc 20850790

                                                
Query: 401      cttggccgcgttgccggcgagctcaancacct 432
                | | |||||||| || || ||||| | |||||
Sbjct: 20850791 cctcgccgcgttccccgccagctccagcacct 20850822



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 232     cctccttctcggcggcggcggcgg 255
               |||||| |||||||||||||||||
Sbjct: 2993783 cctcctcctcggcggcggcggcgg 2993760

---

>emb|AL731753.2|CNS08C82 Oryza sativa chromosome 12, . BAC OJ1112_B07 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 118101

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 126/152 (82%)
 Strand = Plus / Minus

                                                                         
Query: 281   gatgttggggatcacgccgccgtgggcgatggtgacgcccgcgagcagcctgccgagctc 340
             ||||||||| || |||||||||  |||||||||| ||||  |||||||| ||  ||||||
Sbjct: 48743 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 48684

                                                                         
Query: 341   ctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtc 400
             || ||||||||| || |||||  | | ||| ||||| |  ||||||||||||||||||||
Sbjct: 48683 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 48624

                                             
Query: 401   cttggccgcgttgccggcgagctcaancacct 432
             | | |||||||| ||||||||||| | |||||
Sbjct: 48623 cctcgccgcgttcccggcgagctccagcacct 48592

---

>gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 genes, complete cds, and
            histone H3 gene, 3' end, gene cluster X1h3
          Length = 8608

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                        
Query: 258  ttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgacg 317
            ||||||||||||||||| || | ||||||||| |  || ||||| |||||||||||||| 
Sbjct: 4747 ttcttggggagcagcacagactggatgttgggcaggacaccgccctgggcgatggtgacc 4688

                                                                        
Query: 318  cccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcggg 377
            ||  |||||||  ||  |||||||| ||||||||| ||||||||  | |||||||  |||
Sbjct: 4687 cctccgagcagtttgttgagctcctcgtcgttgcgcacggcgagctgcaggtgcctgggg 4628

                                                     
Query: 378  atgatgcgggtcttcttgttgtccttggccgcgttgccggc 418
            ||||| || ||||||||||| |||  ||| |||||||||||
Sbjct: 4627 atgatccgagtcttcttgttatcccgggcagcgttgccggc 4587

---

>ref|XM_865148.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC613926), mRNA
          Length = 393

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           |||||| |||||||||||||  | ||||||||| |  |||||||| || |||||||||||
Sbjct: 360 cttcttagggagcagcacggcctggatgttgggcaggacgccgccctgagcgatggtgac 301

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
                | |||||| ||  |||||||| ||||||||||| ||| ||  | | ||| |||||
Sbjct: 300 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaagtgacgcgg 241

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           |||||||||||||||||||||||||  |||||||||||| || |||||
Sbjct: 240 gatgatgcgggtcttcttgttgtcccgggccgcgttgcccgccagctc 193

---

>ref|NM_178185.1| Mus musculus histone 1, H2ao (Hist1h2ao), mRNA
          Length = 393

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193

---

>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence
          Length = 209720

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                         
Query: 257   cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
             ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 64629 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 64570

                                                                         
Query: 317   gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
             ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 64569 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 64510

                                                             
Query: 377   gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
             ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 64509 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 64462



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Plus

                                                                         
Query: 257   cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
             ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 60548 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 60607

                                                                         
Query: 317   gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
             ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 60608 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 60667

                                                             
Query: 377   gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
             ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 60668 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 60715



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 137/168 (81%)
 Strand = Plus / Plus

                                                                          
Query: 257    cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
              ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 101108 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 101167

                                                                          
Query: 317    gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
              ||   | | |||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 101168 gcggcccaacagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 101227

                                                              
Query: 377    gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
              ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 101228 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 101275

---

>ref|NG_002734.1| Mus musculus histone 1, H2aj (Hist1h2aj) pseudogene on chromosome
           13
          Length = 1357

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 842 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 783

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 782 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 723

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 722 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 675

---

>ref|XM_545430.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488308), mRNA
          Length = 456

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 423 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 364

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 363 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 304

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 303 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 256

---

>ref|XM_849168.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC611496), mRNA
          Length = 393

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193

---

>ref|XM_545413.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488291), mRNA
          Length = 387

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193

---

>ref|XM_545411.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488289),
           mRNA
          Length = 393

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193

---

>ref|XM_545400.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488278), mRNA
          Length = 576

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193

---

>ref|XM_545394.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488272), mRNA
          Length = 393

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193

---

>ref|XM_848774.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC611132),
           mRNA
          Length = 393

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193

---

>ref|XM_848759.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488270), mRNA
          Length = 462

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 429 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 370

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 369 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 310

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 309 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 262

---

>ref|XM_545384.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488262), mRNA
          Length = 393

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193

---

>ref|XM_848716.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC611082),
           mRNA
          Length = 393

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193

---

>ref|XM_545376.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488254), mRNA
          Length = 417

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 384 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 325

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 324 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 265

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 264 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 217

---

>ref|XM_545373.1| PREDICTED: Canis familiaris similar to histone H2A (LOC488251),
           mRNA
          Length = 396

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193

---

>ref|XM_854341.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l),
           transcript variant 2 (LOC488268), mRNA
          Length = 402

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193

---

>ref|XM_545390.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l),
           transcript variant 1 (LOC488268), mRNA
          Length = 393

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193

---

>ref|XM_978341.1| PREDICTED: Mus musculus similar to histone 2a, transcript variant 2
           (LOC665433), mRNA
          Length = 465

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 392 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 333

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 332 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 273

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 272 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 225

---

>ref|XM_978296.1| PREDICTED: Mus musculus similar to histone 2a, transcript variant 1
           (LOC665433), mRNA
          Length = 467

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 394 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 335

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 334 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 275

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 274 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 227

---

>ref|XM_539322.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC482203),
           mRNA
          Length = 393

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193

---

>gb|BC058544.1| Mus musculus cDNA clone IMAGE:5711765, with apparent retained
           intron
          Length = 497

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 391 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 332

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 331 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 272

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 271 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 224

---

>emb|BX063165.1|CNS09KWH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 902

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 120/144 (83%)
 Strand = Plus / Plus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| | ||||||||| ||||||||||| ||
Sbjct: 524 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 583

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
            || |  |||||| ||   ||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 584 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 643

                                   
Query: 377 gatgatgcgggtcttcttgttgtc 400
           ||||||||| ||||||||||||||
Sbjct: 644 gatgatgcgcgtcttcttgttgtc 667

---

>emb|BX063164.1|CNS09KWG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 924

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 120/144 (83%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| | ||||||||| ||||||||||| ||
Sbjct: 477 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 418

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
            || |  |||||| ||   ||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 417 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 358

                                   
Query: 377 gatgatgcgggtcttcttgttgtc 400
           ||||||||| ||||||||||||||
Sbjct: 357 gatgatgcgcgtcttcttgttgtc 334

---

>emb|BX040864.1|CNS093P0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC11DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 120/144 (83%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| | ||||||||| ||||||||||| ||
Sbjct: 470 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 411

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
            || |  |||||| ||   ||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 410 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 351

                                   
Query: 377 gatgatgcgggtcttcttgttgtc 400
           ||||||||| ||||||||||||||
Sbjct: 350 gatgatgcgcgtcttcttgttgtc 327

---

>emb|BX019683.1|CNS08NCN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3AB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 651

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 120/144 (83%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| | ||||||||| ||||||||||| ||
Sbjct: 481 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 422

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
            || |  |||||| ||   ||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 421 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 362

                                   
Query: 377 gatgatgcgggtcttcttgttgtc 400
           ||||||||| ||||||||||||||
Sbjct: 361 gatgatgcgcgtcttcttgttgtc 338

---

>emb|BX016451.1|CNS08KUV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24CG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 556

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 120/144 (83%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| | ||||||||| ||||||||||| ||
Sbjct: 404 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 345

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
            || |  |||||| ||   ||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 344 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 285

                                   
Query: 377 gatgatgcgggtcttcttgttgtc 400
           ||||||||| ||||||||||||||
Sbjct: 284 gatgatgcgcgtcttcttgttgtc 261

---

>emb|BX009846.1|CNS08FRE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 357

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 120/144 (83%)
 Strand = Plus / Plus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| | ||||||||| ||||||||||| ||
Sbjct: 117 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 176

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
            || |  |||||| ||   ||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 177 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 236

                                   
Query: 377 gatgatgcgggtcttcttgttgtc 400
           ||||||||| ||||||||||||||
Sbjct: 237 gatgatgcgcgtcttcttgttgtc 260

---

>emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143
          Length = 3210

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                        
Query: 257  cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
            ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 1933 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 1874

                                                                        
Query: 317  gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
            ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 1873 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 1814

                                                            
Query: 377  gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
            ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 1813 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 1766

---

>emb|X58069.1|MMH2AX Mouse mRNA for Histone H2A.X
          Length = 1359

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 411 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 352

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           |||  | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| || ||
Sbjct: 351 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgagg 292

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 291 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 244

---

>emb|X05863.1|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B)
          Length = 1826

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                        
Query: 257  cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
            ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 1308 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 1249

                                                                        
Query: 317  gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
            ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 1248 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 1189

                                                            
Query: 377  gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
            ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 1188 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 1141

---

>emb|X05862.1|MMHIS2BA Mouse H2B and H2A histone genes (291A)
          Length = 1797

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                        
Query: 257  cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
            ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 1309 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 1250

                                                                        
Query: 317  gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
            ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 1249 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 1190

                                                            
Query: 377  gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
            ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 1189 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 1142

---

>gb|BC099406.1| Mus musculus histone 1, H2ac, mRNA (cDNA clone MGC:117571
           IMAGE:30789778), complete cds
          Length = 1075

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 370 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 311

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 310 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 251

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 250 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 203

---

>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a
              novel gene, the genes for three H1, four H2a, five H2b,
              four H3 and four H4 histone family members, the 3' end of a
              variant of the Hfe gene for hemochromatosis protein (Mr2)
              and ten CpG islands, complete sequence
          Length = 184730

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Plus

                                                                          
Query: 257    cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
              ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 163973 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 164032

                                                                          
Query: 317    gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
              ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 164033 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 164092

                                                              
Query: 377    gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
              ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 164093 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 164140



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                         
Query: 257   cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
             ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 55436 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 55377

                                                                         
Query: 317   gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
             ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 55376 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 55317

                                                             
Query: 377   gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
             ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 55316 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 55269



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Plus

                                                                         
Query: 257   cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
             ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 51355 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 51414

                                                                         
Query: 317   gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
             ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 51415 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 51474

                                                             
Query: 377   gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
             ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 51475 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 51522



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 137/168 (81%)
 Strand = Plus / Minus

                                                                         
Query: 257   cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
             ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 14872 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 14813

                                                                         
Query: 317   gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
             ||   | | |||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 14812 gcggcccaacagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 14753

                                                             
Query: 377   gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
             ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 14752 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 14705

---

>ref|NM_178189.2| Mus musculus histone 1, H2ac (Hist1h2ac), mRNA
          Length = 2493

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 404 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 345

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 344 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 285

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 284 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 237

---

>emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chromosome 13 Contains the
             genes for H2b histone family member A, two H2a, two H4 and
             an H2b histone family member, a serine/threonine protein
             kinase pseudogene, a novel pseudogene, a novel gene
             (4930500C15Rik), the gene for a novel KRAB box and C2H2
             Zinc Finger containing protein, a ribosomal protein L21
             (RPL21) pseudogene, a TU mitochondrial translation
             elongation factor (tufa) pseudogene, the 5' end of the
             gene for a novel protein similar to nuclear envelope pore
             membrane protein POM121 and four CpG islands, complete
             sequence
          Length = 182817

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Plus

                                                                         
Query: 257   cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
             ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 33283 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 33342

                                                                         
Query: 317   gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
             ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 33343 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 33402

                                                             
Query: 377   gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
             ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 33403 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 33450



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                         
Query: 257   cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
             ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 10993 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 10934

                                                                         
Query: 317   gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
             ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 10933 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 10874

                                                             
Query: 377   gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
             ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 10873 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 10826

---

>emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chromosome 13 Contains the
             3' end of the gene for a novel protein similar to nuclear
             envelope pore membrane protein POM121, the Prss16 gene for
             thymus serine protease16, three novel genes, the genes for
             two H2a, two H2b and one H4 histone family members, a
             ribosomal protein L37A (Rpl37a) pseudogene, a novel
             pseudogene, three genes for novel vomeronasal 1 receptor H
             (V1rh) family members, the gene for a novel vomeronasal 1
             receptor I (V1ri) family member, six V1ri pseudogenes, a
             V1rh pseudogene and six CpG islands, complete sequence
          Length = 210845

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Plus

                                                                         
Query: 257   cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
             ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 59924 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 59983

                                                                         
Query: 317   gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
             ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 59984 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 60043

                                                             
Query: 377   gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
             ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 60044 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 60091



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Plus

                                                                         
Query: 257   cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
             ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 52549 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 52608

                                                                         
Query: 317   gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
             ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 52609 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 52668

                                                             
Query: 377   gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
             ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 52669 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 52716

---

>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five
              genes for olfactory receptors, a novel gene, the H1f5 gene
              for H1 histone family member 5, three genes and one
              pseudogene for H2a histone family members, four genes for
              H2b, two genes for H4, and two genes for H3 histone family
              members and seven CpG islands, complete sequence
          Length = 222823

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Plus

                                                                          
Query: 257    cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
              ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 142450 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 142509

                                                                          
Query: 317    gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
              ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 142510 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 142569

                                                              
Query: 377    gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
              ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 142570 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 142617



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                          
Query: 257    cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
              ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 137771 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 137712

                                                                          
Query: 317    gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
              ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 137711 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 137652

                                                              
Query: 377    gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
              ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 137651 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 137604



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 137/168 (81%)
 Strand = Plus / Plus

                                                                          
Query: 257    cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
              ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 174458 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 174517

                                                                          
Query: 317    gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
              ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 174518 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 174577

                                                              
Query: 377    gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
              ||| ||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 174578 gataatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 174625



 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 118/144 (81%)
 Strand = Plus / Plus

                                                                          
Query: 281    gatgttggggatcacgccgccgtgggcgatggtgacgcccgcgagcagcctgccgagctc 340
              ||||||||| |  |||||||| || |||||||| ||||   | |||||| ||  ||||||
Sbjct: 207873 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 207932

                                                                          
Query: 341    ctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtc 400
              || ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||||||||
Sbjct: 207933 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 207992

                                      
Query: 401    cttggccgcgttgccggcgagctc 424
                 |||||||||||| || |||||
Sbjct: 207993 gcgggccgcgttgcccgccagctc 208016

---

>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the
              Slc17a1 gene for solute carrier family 17 (vesicular
              glutamate transporter) member 1, two genes for novel solute
              carrier family 17 (Slc17) members, two novel genes, the
              gene for a novel C3HC4 type zinc finger (ring finger)
              protein, the gene for an H2a, an H2b, two genes for H3 and
              two genes for H4 histone family members, a H2a histone
              family pseudogene, the H1f1 and  H1f2 genes for H1 histone
              family members 1 and 2, the H3f2 gene for H3 histone
              family, member 2 (H3.2), a novel pseudogene, the Hfe gene
              for hemochromatosis protein (Mr2) and two CpG islands,
              complete sequence
          Length = 186062

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                          
Query: 257    cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
              ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 142180 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 142121

                                                                          
Query: 317    gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
              ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 142120 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 142061

                                                              
Query: 377    gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
              ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 142060 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 142013



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Plus

                                                                          
Query: 257    cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
              ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 136886 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 136945

                                                                          
Query: 317    gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
              ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 136946 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 137005

                                                              
Query: 377    gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
              ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 137006 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 137053

---

>gb|BC065803.1| Mus musculus histone 1, H2ag, mRNA (cDNA clone MGC:73771
           IMAGE:1263745), complete cds
          Length = 527

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 382 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 323

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 322 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 263

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 262 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 215

---

>gb|BC076498.1| Mus musculus histone 1, H2ae, mRNA (cDNA clone MGC:90847
           IMAGE:5713252), complete cds
          Length = 492

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 390 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 331

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 330 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 271

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 270 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 223

---

>dbj|AK145443.1| Mus musculus 5 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:I0C0045N09 product:histone 1,
           H2ad, full insert sequence
          Length = 446

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 393 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 334

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 333 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 274

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 273 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 226

---

>dbj|AK146117.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
           clone:I730004H15 product:histone 1, H2ai, full insert
           sequence
          Length = 1396

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 139/168 (82%), Gaps = 1/168 (0%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 371 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 312

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||  || |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 311 gcg-gccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 253

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 252 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 205

---

>dbj|AK146846.1| Mus musculus 17 days embryo heart cDNA, RIKEN full-length enriched
           library, clone:I920064A15 product:histone 1, H2ad, full
           insert sequence
          Length = 445

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 391 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 332

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 331 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 272

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 271 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 224

---

>ref|NM_175660.2| Mus musculus histone 1, H2ab (Hist1h2ab), mRNA
          Length = 506

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 405 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 346

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 345 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 286

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 285 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 238

---

>gb|BC090402.1| Mus musculus cDNA clone MGC:103288 IMAGE:5150365, complete cds
          Length = 447

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 372 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 313

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 312 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 253

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 252 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 205

---

>gb|BC062251.1| Mus musculus cDNA clone MGC:73635 IMAGE:1224905, complete cds
          Length = 444

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 372 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 313

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 312 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 253

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 252 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 205

---

>gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016
          Length = 2110

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 630 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 571

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 570 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 511

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 510 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 463

---

>gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108
          Length = 2221

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 628 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 569

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 568 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 509

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 508 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 461

---

>ref|NM_178186.2| Mus musculus histone 1, H2ag (Hist1h2ag), mRNA
          Length = 527

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 382 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 323

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 322 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 263

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 262 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 215

---

>ref|NM_178187.2| Mus musculus histone 1, H2ae (Hist1h2ae), mRNA
          Length = 705

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 473 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 414

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 413 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 354

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 353 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 306

---

>ref|NM_178188.3| Mus musculus histone 1, H2ad (Hist1h2ad), mRNA
          Length = 393

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193

---

>gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone H2a.1-F (H2a-F), histone
            H2b-F (H2b-F) genes, complete cds
          Length = 2822

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Plus

                                                                        
Query: 257  cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
            ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 1469 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 1528

                                                                        
Query: 317  gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
            ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 1529 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 1588

                                                            
Query: 377  gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
            ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 1589 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 1636

---

>dbj|AK028026.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
           enriched library, clone:1190022L06 product:HISTONE H2A
           homolog [Homo sapiens], full insert sequence
          Length = 705

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 473 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 414

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 413 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 354

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 353 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 306

---

>dbj|AK033518.1| Mus musculus adult male colon cDNA, RIKEN full-length enriched
           library, clone:9030420B16 product:histone 1, H2ac, full
           insert sequence
          Length = 2493

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 404 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 345

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 344 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 285

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 284 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 237

---

>ref|NM_178182.1| Mus musculus histone 1, H2ai (Hist1h2ai), mRNA
          Length = 393

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193

---

>gb|AY158920.1| Mus musculus histone protein Hist1h2ab gene, complete cds
          Length = 1390

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 860 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 801

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 800 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 741

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 740 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 693

---

>gb|AY158919.1| Mus musculus histone protein Hist1h2ac gene, complete cds
          Length = 1390

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 860 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 801

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 800 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 741

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 740 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 693

---

>gb|AY158918.1| Mus musculus histone protein Hist1h2ad gene, complete cds
          Length = 1390

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 860 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 801

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 800 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 741

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 740 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 693

---

>gb|AY158917.1| Mus musculus histone protein Hist1h2ae gene, complete cds
          Length = 1390

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 860 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 801

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 800 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 741

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 740 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 693

---

>gb|AY158915.1| Mus musculus histone protein Hist1h2ag gene, complete cds
          Length = 1392

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 859 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 800

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 799 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 740

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 739 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 692

---

>gb|AY158914.1| Mus musculus histone protein Hist1h2ah gene, complete cds
          Length = 1381

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 857 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 798

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 797 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 738

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 737 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 690

---

>gb|AY158913.1| Mus musculus histone protein Hist1h2ao gene, complete cds
          Length = 1390

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 860 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 801

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 800 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 741

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 740 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 693

---

>gb|AY158910.1| Mus musculus histone protein Hist1h2aj pseudogene, partial sequence
          Length = 1357

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 842 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 783

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 782 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 723

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 722 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 675

---

>gb|AY158909.1| Mus musculus histone protein Hist1h2ai gene, complete cds
          Length = 1387

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 857 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 798

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 797 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 738

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 737 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 690

---

>ref|NM_175659.1| Mus musculus histone 1, H2ah (Hist1h2ah), mRNA
          Length = 387

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193

---

>gb|M37736.1|MUSHIS2AR Mouse replication-dependent histone H2A.1 gene
          Length = 668

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 483 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 424

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 423 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 364

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 363 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 316

---

>gb|U95109.1|MSU95109 Mus spicilegus histone H2a pseudogene, complete sequence
          Length = 531

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 131/159 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 387 cttcttgggcagcagcacggcctggatgttgggcacgacgccgccctgcgcgatggtcac 328

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 327 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 268

                                                  
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgcc 415
           ||||||||| ||||||||||||||   ||||||||||||
Sbjct: 267 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcc 229

---

>ref|XM_482492.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 405

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 147/181 (81%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           |||||||||||| |||| |  || ||||||||| || |||||||||| ||||||||||||
Sbjct: 363 cttcttggggaggagcaggttgtggatgttgggcatgacgccgccgttggcgatggtgac 304

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           | |  ||||||| |     ||||||| ||||||||| ||||||||  | | ||||| |||
Sbjct: 303 ggcgccgagcaggcgcgacagctcctcgtcgttgcgcacggcgagctggatgtgcctcgg 244

                                                                       
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctcaancacctcggc 436
            | ||| || |||||||||||||||   |||||||| |||||||||||||  ||||||||
Sbjct: 243 cacgatccgcgtcttcttgttgtcccgcgccgcgttcccggcgagctcaagaacctcggc 184

            
Query: 437 g 437
           |
Sbjct: 183 g 183

---

>ref|XM_868899.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC616790), mRNA
          Length = 413

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 79/90 (87%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||||||||||||
Sbjct: 302 gagctcctcgtcgttgcggatggccagctgcaggtgacgcgggatgatgcgggtcttctt 243

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           |||||||  |||||||||||| || |||||
Sbjct: 242 gttgtcccgggccgcgttgcccgccagctc 213

---

>ref|XM_545421.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488299),
           mRNA
          Length = 387

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 137/168 (81%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||||||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaagacgccgccctgcgcgatggtgac 301

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
                | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 300 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193

---

>ref|XM_545419.2| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488297),
           mRNA
          Length = 393

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 137/168 (81%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||||||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaagacgccgccctgcgcgatggtgac 301

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
                | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 300 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193

---

>ref|XM_543796.2| PREDICTED: Canis familiaris similar to H2A histone family, member J
           isoform 2 (LOC486669), mRNA
          Length = 598

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 119/144 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||||||
Sbjct: 438 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtgac 379

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
              | | |||||| ||  |||||||| ||||||||||| ||||||  | ||||| |||||
Sbjct: 378 tttccccagcagcttgttgagctcctcgtcgttgcggatggcgagttgcaggtggcgcgg 319

                                   
Query: 377 gatgatgcgggtcttcttgttgtc 400
           |||||| | |||||||||||||||
Sbjct: 318 gatgatcctggtcttcttgttgtc 295

---

>emb|CR700361.2|CNS0G3CL Tetraodon nigroviridis full-length cDNA
          Length = 547

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 119/144 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| |||||||| |  | ||||||||| | ||||||||| ||||||||||| ||
Sbjct: 389 cttcttgggcagcagcaccgcctggatgttgggcagcacgccgccctgggcgatggtcac 330

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
            ||  | |||||| ||   ||||||| ||||||||| ||||| ||  | |||||||||||
Sbjct: 329 tccgcccagcagcttgttcagctcctcgtcgttgcgcacggccagctgcaggtgccgcgg 270

                                   
Query: 377 gatgatgcgggtcttcttgttgtc 400
           |||||| | |||||||||||||||
Sbjct: 269 gatgatcctggtcttcttgttgtc 246

---

>emb|BX016452.1|CNS08KUW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24CG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 594

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 119/144 (82%)
 Strand = Plus / Plus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| | ||||||||| ||||||||||| ||
Sbjct: 74  cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 133

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
            || |  |||||| ||   ||||||| ||||||||||| ||| |   | ||||| |||||
Sbjct: 134 cccggacagcagcttgttcagctcctcgtcgttgcggatggccaactgcaggtggcgcgg 193

                                   
Query: 377 gatgatgcgggtcttcttgttgtc 400
           ||||||||| ||||||||||||||
Sbjct: 194 gatgatgcgcgtcttcttgttgtc 217

---

>gb|AF255740.1|AF255740 Bufo bufo gagarizans histone H1 (H1) and histone H2A variant (H2AInr)
            genes, complete cds
          Length = 2396

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 116/140 (82%)
 Strand = Plus / Minus

                                                                        
Query: 257  cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
            ||||||||| ||||||||||  | ||||||||| |  |||||||| ||||||||||||||
Sbjct: 1584 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgggcgatggtgac 1525

                                                                        
Query: 317  gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
             ||  | |||||| ||  |||||||| ||||||||| ||||| ||  | ||||| || ||
Sbjct: 1524 tccgcccagcagcttgttgagctcctcgtcgttgcgcacggccagctgcaggtgacgggg 1465

                                
Query: 377  gatgatgcgggtcttcttgt 396
            ||||||||||||||| ||||
Sbjct: 1464 gatgatgcgggtcttgttgt 1445

---

>ref|NM_178183.1| Mus musculus histone 1, H2ak (Hist1h2ak), mRNA
          Length = 393

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 137/168 (81%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||| ||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 240 gataatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193

---

>ref|XM_225386.2| PREDICTED: Rattus norvegicus histone 1, H2an (predicted)
           (Hist1h2an_predicted), mRNA
          Length = 546

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 137/168 (81%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| |||||||| |  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcaccgcctggatgttgggcaggacgccgccctgtgcgatggtcac 301

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||| | || |||||||| || |||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtccctcgctgcgttgcccgccagctc 193

---

>gb|AY158916.1| Mus musculus histone protein Hist1h2af gene, complete cds
          Length = 1390

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 137/168 (81%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 884 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 825

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | | |||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 824 gcggcccaacagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 765

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 764 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 717

---

>gb|AY158911.1| Mus musculus histone protein Hist1h2ak gene, complete cds
          Length = 1201

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 137/168 (81%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 894 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 835

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 834 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 775

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||| ||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 774 gataatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 727

---

>ref|XM_314447.2| Anopheles gambiae str. PEST ENSANGP00000016040
           (ENSANGG00000013551), partial mRNA
          Length = 375

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 119/144 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| | ||||||||| ||||||||||| ||
Sbjct: 357 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 298

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
            || |  |||||| ||   ||||||| ||||||||||| ||| ||  | || || |||||
Sbjct: 297 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcagatggcgcgg 238

                                   
Query: 377 gatgatgcgggtcttcttgttgtc 400
           ||||||||| ||||||||||||||
Sbjct: 237 gatgatgcgcgtcttcttgttgtc 214

---

>ref|XM_306256.1| Anopheles gambiae str. PEST ENSANGP00000000004
           (ENSANGG00000000004), mRNA
          Length = 630

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 119/144 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| | ||||||||| ||||||||||| ||
Sbjct: 471 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 412

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
            || |  |||||| ||   ||||||| ||||||||||| ||| ||  | || || |||||
Sbjct: 411 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcagatggcgcgg 352

                                   
Query: 377 gatgatgcgggtcttcttgttgtc 400
           ||||||||| ||||||||||||||
Sbjct: 351 gatgatgcgcgtcttcttgttgtc 328

---

>ref|NM_175661.1| Mus musculus histone 1, H2af (Hist1h2af), mRNA
          Length = 393

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 137/168 (81%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | | |||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 300 gcggcccaacagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193

---

>gb|AY109370.1| Zea mays CL2029_4 mRNA sequence
          Length = 1051

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 137/168 (81%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||| || | |||||| ||||||| ||| |||||||| |||||||| ||
Sbjct: 486 cttcttgggcagcagaacagggttgatattggggagcacaccgccgtgagcgatggtcac 427

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           |||  | |||||| | || ||||||| |||||| ||||  || ||||| | ||| |||||
Sbjct: 426 gccgcccagcagcttcccaagctcctcgtcgttccggatcgccagaagcacgtggcgcgg 367

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
            || ||||| ||||||||||||||| |||| || || || ||||||||
Sbjct: 366 aataatgcgagtcttcttgttgtccctggcagcattaccagcgagctc 319

---

>gb|U95111.1|MSU95111 Mus spretus histone H2a pseudogene, complete sequence
          Length = 567

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 137/168 (81%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 423 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 364

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||  ||||||||||| ||| ||  | ||||| |||||
Sbjct: 363 gcggcccagcagcttgttgagctccacgtcgttgcggatggccagctgcaggtggcgcgg 304

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 303 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 256

---

>gb|U08225.1|ZMU08225 Zea mays W-22 histone H2A mRNA, complete cds
          Length = 714

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 137/168 (81%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||| || | |||||| ||||||| ||| |||||||| |||||||| ||
Sbjct: 467 cttcttgggcagcagaacagggttgatattggggagcacaccgccgtgagcgatggtcac 408

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           |||  | | |||| | || ||||||| |||||| ||||  || ||||| | ||| |||||
Sbjct: 407 gccgcccaacagcttcccaagctcctcgtcgttccggatcgccagaagcacgtggcgcgg 348

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
            || ||||| ||||||||||||||| |||| || || |||||||||||
Sbjct: 347 aataatgcgagtcttcttgttgtccctggcagcattaccggcgagctc 300

---

>gb|M33988.1|MUSH2AX1 Mouse histone H2A.1 gene, complete cds
          Length = 929

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 119/144 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 523 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 464

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 463 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 404

                                   
Query: 377 gatgatgcgggtcttcttgttgtc 400
           ||||||||| ||||||||||||||
Sbjct: 403 gatgatgcgcgtcttcttgttgtc 380

---

>ref|XM_607721.2| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC529277), mRNA
          Length = 522

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 78/90 (86%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 283 gagctcctcgtcgttgcggatggccagctgcaggtgacgcgggatgatgcgcgtcttctt 224

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           |||||||  |||||||||||| || |||||
Sbjct: 223 gttgtcccgggccgcgttgcccgccagctc 194

---

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 138/170 (81%)
 Strand = Plus / Minus

                                                                            
Query: 257      cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
                |||||||||||| |||| |  || ||||||||| || |||||||||| ||||||||||||
Sbjct: 20566519 cttcttggggaggagcaggttgtggatgttgggcatgacgccgccgttggcgatggtgac 20566460

                                                                            
Query: 317      gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
                | |  ||||||| |     ||||||| ||||||||| ||||||||  | | ||||| |||
Sbjct: 20566459 ggcgccgagcaggcgcgacagctcctcgtcgttgcgcacggcgagctggatgtgcctcgg 20566400

                                                                  
Query: 377      gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctcaa 426
                 | ||| || |||||||||||||||   |||||||| |||||||||||||
Sbjct: 20566399 cacgatccgcgtcttcttgttgtcccgcgccgcgttcccggcgagctcaa 20566350



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 232     cctccttctcggcggcggcggcgga 256
               ||||||||||| |||||||||||||
Sbjct: 2335842 cctccttctcgccggcggcggcgga 2335818

---

>ref|XM_225372.2| PREDICTED: Rattus norvegicus similar to Histone H2A.1 (LOC306962),
           mRNA
          Length = 437

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 78/90 (86%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 296 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 237

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           ||||||| | ||||||||||| || |||||
Sbjct: 236 gttgtccctcgccgcgttgcccgccagctc 207

---

>dbj|AP005734.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OSJNBb0032E15
          Length = 120419

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 138/170 (81%)
 Strand = Plus / Minus

                                                                         
Query: 257   cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
             |||||||||||| |||| |  || ||||||||| || |||||||||| ||||||||||||
Sbjct: 70480 cttcttggggaggagcaggttgtggatgttgggcatgacgccgccgttggcgatggtgac 70421

                                                                         
Query: 317   gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
             | |  ||||||| |     ||||||| ||||||||| ||||||||  | | ||||| |||
Sbjct: 70420 ggcgccgagcaggcgcgacagctcctcgtcgttgcgcacggcgagctggatgtgcctcgg 70361

                                                               
Query: 377   gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctcaa 426
              | ||| || |||||||||||||||   |||||||| |||||||||||||
Sbjct: 70360 cacgatccgcgtcttcttgttgtcccgcgccgcgttcccggcgagctcaa 70311

---

>dbj|AP003898.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1663_D06
          Length = 139103

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 138/170 (81%)
 Strand = Plus / Minus

                                                                         
Query: 257   cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
             |||||||||||| |||| |  || ||||||||| || |||||||||| ||||||||||||
Sbjct: 40891 cttcttggggaggagcaggttgtggatgttgggcatgacgccgccgttggcgatggtgac 40832

                                                                         
Query: 317   gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
             | |  ||||||| |     ||||||| ||||||||| ||||||||  | | ||||| |||
Sbjct: 40831 ggcgccgagcaggcgcgacagctcctcgtcgttgcgcacggcgagctggatgtgcctcgg 40772

                                                               
Query: 377   gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctcaa 426
              | ||| || |||||||||||||||   |||||||| |||||||||||||
Sbjct: 40771 cacgatccgcgtcttcttgttgtcccgcgccgcgttcccggcgagctcaa 40722

---

>dbj|AK121752.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033087P07, full
           insert sequence
          Length = 747

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 128/157 (81%)
 Strand = Plus / Minus

                                                                       
Query: 281 gatgttggggatcacgccgccgtgggcgatggtgacgcccgcgagcagcctgccgagctc 340
           ||||||||| | ||||||||||  ||||||||||||| |  ||||||||||||  |||||
Sbjct: 455 gatgttgggcagcacgccgccggcggcgatggtgacggcgccgagcagcctgctcagctc 396

                                                                       
Query: 341 ctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtc 400
           || ||||||||| || || ||  | | ||||| ||| | ||| ||| |||||||||||||
Sbjct: 395 ctcgtcgttgcgcaccgccagctggatgtgcctcggcacgatccggttcttcttgttgtc 336

                                                
Query: 401 cttggccgcgttgccggcgagctcaancacctcggcg 437
           | | |||||||| || || ||||| | ||||||||||
Sbjct: 335 cctcgccgcgttccccgccagctccagcacctcggcg 299

---

>gb|AY108339.1| Zea mays PCO070432 mRNA sequence
          Length = 811

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 78/90 (86%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||||||||||  | | ||| ||||||| |||||||||||||||
Sbjct: 395 gagctcctcgtcgttgcggacggcgagctggatgtggcgcgggacgatgcgggtcttctt 336

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           |||||||   |||||||| ||||| |||||
Sbjct: 335 gttgtcccgagccgcgttcccggcaagctc 306

---

>gb|BC077427.1| Xenopus laevis MGC82198 protein, mRNA (cDNA clone MGC:82198
           IMAGE:3402168), complete cds
          Length = 1591

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 131/161 (81%)
 Strand = Plus / Minus

                                                                       
Query: 258 ttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgacg 317
           |||||||| ||||||||||| | ||||||||| |  || ||||| || ||||| ||||| 
Sbjct: 367 ttcttgggcagcagcacggactggatgttgggcaggaccccgccctgagcgatagtgact 308

                                                                       
Query: 318 cccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcggg 377
           ||  |||||||  ||  ||||||||  |||||||| || |||||  | |||||||  |||
Sbjct: 307 cctccgagcagtttgttgagctcctcatcgttgcgcacagcgagctgcaggtgcctgggg 248

                                                    
Query: 378 atgatgcgggtcttcttgttgtccttggccgcgttgccggc 418
           |||||||||||||||||||| |||  ||| |||||||||||
Sbjct: 247 atgatgcgggtcttcttgttatcccgggcagcgttgccggc 207

---

>emb|BX008487.1|CNS08EPN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 408

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 120/145 (82%), Gaps = 1/145 (0%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| | ||||||||| ||||||||||| ||
Sbjct: 231 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 172

                                                                       
Query: 317 gcccgcg-agcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcg 375
             |||   |||||| ||   ||||||| ||||||||||| ||| ||  | ||||| ||||
Sbjct: 171 ctccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcg 112

                                    
Query: 376 ggatgatgcgggtcttcttgttgtc 400
           |||||||||| ||||||||||||||
Sbjct: 111 ggatgatgcgcgtcttcttgttgtc 87

---

>gb|DQ214188.1| Taeniopygia guttata clone 0058P0024E05 histone 1 H2ai-like mRNA,
           complete sequence
          Length = 786

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 136/168 (80%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| | ||||||||| || ||||| || ||
Sbjct: 443 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgcgcgatcgtcac 384

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
                | |||||| ||  |||||||| ||||||||||| ||||||  | ||||| || ||
Sbjct: 383 cttgcccagcagcttgttgagctcctcgtcgttgcggatggcgagctgcaggtggcgggg 324

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 323 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 276

---

>gb|DQ214187.1| Taeniopygia guttata clone 0058P0044E04 histone 1 H2ai-like mRNA,
           complete sequence
          Length = 786

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 136/168 (80%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| | ||||||||| || ||||| || ||
Sbjct: 443 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgcgcgatcgtcac 384

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
                | |||||| ||  |||||||| ||||||||||| ||||||  | ||||| || ||
Sbjct: 383 cttgcccagcagcttgttgagctcctcgtcgttgcggatggcgagctgcaggtggcgggg 324

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 323 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 276

---

>ref|XM_525084.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC469700),
           mRNA
          Length = 393

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 136/168 (80%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || || |||||||| ||
Sbjct: 360 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 301

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||    |||||||||||||| |||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctc 193

---

>gb|BC001193.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC:3165
           IMAGE:3355200), complete cds
          Length = 897

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 136/168 (80%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || || |||||||| ||
Sbjct: 402 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 343

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 342 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 283

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||    |||||||||||||| |||||
Sbjct: 282 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctc 235

---

>gb|BC082269.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC:99456
           IMAGE:6671338), complete cds
          Length = 889

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 136/168 (80%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || || |||||||| ||
Sbjct: 392 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 333

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 332 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 273

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||    |||||||||||||| |||||
Sbjct: 272 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctc 225

---

>ref|XM_868674.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC616611), mRNA
          Length = 393

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 136/168 (80%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| |||||||| |  | ||||||||| |  |||||||| || |||||||||||
Sbjct: 360 cttcttgggcagcagcaccgcctggatgttgggcaggacgccgccctgagcgatggtgac 301

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
                | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 300 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtgacgcgg 241

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||| || ||||||||||||||||||  |||||||||||| || |||||
Sbjct: 240 gataatacgggtcttcttgttgtcccgggccgcgttgcccgccagctc 193

---

>ref|NM_177688.2| Mus musculus H2A histone family, member J (H2afj), mRNA
          Length = 1754

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 136/168 (80%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||| ||||| |  |||||||| || |||||||| ||
Sbjct: 377 cttcttgggcagcagcacggcctggatattgggcaggacgccgccctgcgcgatggtcac 318

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
            |   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| || ||
Sbjct: 317 acggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtgacgagg 258

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||| | ||||||||||| || |||||
Sbjct: 257 gatgatgcgcgtcttcttgttgtccctcgccgcgttgcccgccagctc 210

---

>ref|NM_033445.2| Homo sapiens histone 3, H2a (HIST3H2A), mRNA
          Length = 496

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 136/168 (80%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || || |||||||| ||
Sbjct: 402 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 343

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 342 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 283

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||    |||||||||||||| |||||
Sbjct: 282 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctc 235

---

>ref|XM_906486.2| PREDICTED: Mus musculus similar to H2A histone family, member J
           (LOC632401), mRNA
          Length = 1833

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 136/168 (80%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||| ||||| |  |||||||| || |||||||| ||
Sbjct: 456 cttcttgggcagcagcacggcctggatattgggcaggacgccgccctgcgcgatggtcac 397

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
            |   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| || ||
Sbjct: 396 acggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgagg 337

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||| | ||||||||||| || |||||
Sbjct: 336 gatgatgcgcgtcttcttgttgtccctcgccgcgttgcccgccagctc 289

---

>gb|AC122804.4| Mus musculus BAC clone RP23-296J10 from 6, complete sequence
          Length = 205659

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 136/168 (80%)
 Strand = Plus / Plus

                                                                          
Query: 257    cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
              ||||||||| ||||||||||  | ||| ||||| |  |||||||| || |||||||| ||
Sbjct: 108584 cttcttgggcagcagcacggcctggatattgggcaggacgccgccctgcgcgatggtcac 108643

                                                                          
Query: 317    gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
               |   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| || ||
Sbjct: 108644 acggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtgacgagg 108703

                                                              
Query: 377    gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
              ||||||||| ||||||||||||||| | ||||||||||| || |||||
Sbjct: 108704 gatgatgcgcgtcttcttgttgtccctcgccgcgttgcccgccagctc 108751

---

>ref|XM_848163.1| PREDICTED: Canis familiaris similar to Histone H2A.x (H2a/x)
           (LOC489372), mRNA
          Length = 841

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 136/168 (80%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  ||||| || || ||||| || ||
Sbjct: 657 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgcgcgatcgtcac 598

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           |||  | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| || ||
Sbjct: 597 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 538

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 537 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 490

---

>emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chromosome 1q42.11-42.3,
              complete sequence
          Length = 151563

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 136/168 (80%)
 Strand = Plus / Minus

                                                                          
Query: 257    cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
              ||||||||| ||||| ||||  | ||||||||| |  ||||| || || |||||||| ||
Sbjct: 100907 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 100848

                                                                          
Query: 317    gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
              ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 100847 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 100788

                                                              
Query: 377    gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
              ||||||||| ||||||||||||||    |||||||||||||| |||||
Sbjct: 100787 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctc 100740

---

>emb|BX007458.1|CNS08DX2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12BG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 349

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 100/120 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 gatgttggggatcacgccgccgtgggcgatggtgacgcccgcgagcagcctgccgagctc 340
           ||||||||| | ||||||||| ||||||||||| || || |  |||||| ||   |||||
Sbjct: 141 gatgttgggcagcacgccgccctgggcgatggtcaccccggacagcagcttgttcagctc 82

                                                                       
Query: 341 ctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtc 400
           || ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||||||||
Sbjct: 81  ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 22

---

>dbj|AK053755.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched
           library, clone:E130307C13 product:HISTONE H2A homolog
           [Gallus gallus], full insert sequence
          Length = 1754

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 136/168 (80%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||| ||||| |  |||||||| || |||||||| ||
Sbjct: 377 cttcttgggcagcagcacggcctggatattgggcaggacgccgccctgcgcgatggtcac 318

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
            |   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| || ||
Sbjct: 317 acggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtgacgagg 258

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||| | ||||||||||| || |||||
Sbjct: 257 gatgatgcgcgtcttcttgttgtccctcgccgcgttgcccgccagctc 210

---

>ref|NM_178184.1| Mus musculus histone 1, H2an (Hist1h2an), mRNA
          Length = 393

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 118/144 (81%)
 Strand = Plus / Minus

                                                                       
Query: 281 gatgttggggatcacgccgccgtgggcgatggtgacgcccgcgagcagcctgccgagctc 340
           ||||||||| |  |||||||| || |||||||| ||||   | |||||| ||  ||||||
Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277

                                                                       
Query: 341 ctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtc 400
           || ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||||||||
Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217

                                   
Query: 401 cttggccgcgttgccggcgagctc 424
              |||||||||||| || |||||
Sbjct: 216 gcgggccgcgttgcccgccagctc 193

---

>ref|XM_577577.1| PREDICTED: Rattus norvegicus similar to Histone H2A.1 (LOC502129),
           mRNA
          Length = 393

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 136/168 (80%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| |||||||| |  | |||||| || |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcaccgcctggatgtttggcagaacgccgccctgtgcgatggtcac 301

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||| | || |||||||| || |||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtccctcgctgcgttgcccgccagctc 193

---

>ref|XM_576399.1| PREDICTED: Rattus norvegicus similar to Histone H2A.x (H2a/x)
           (LOC500987), mRNA
          Length = 1569

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 136/168 (80%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || ||||| || ||
Sbjct: 639 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatagtcac 580

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           |||  | |||||| ||  |||||||| |||||||||||  || ||  | ||||| |||||
Sbjct: 579 gccgcccagcagcttgttgagctcctcgtcgttgcggatagccagctgcaggtggcgcgg 520

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||| ||||| |||||||||||||||   ||||||||||| || |||||
Sbjct: 519 gataatgcgcgtcttcttgttgtcccgagccgcgttgcccgccagctc 472

---

>gb|AY158912.1| Mus musculus histone protein Hist1h2an gene, complete cds
          Length = 1390

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 118/144 (81%)
 Strand = Plus / Minus

                                                                       
Query: 281 gatgttggggatcacgccgccgtgggcgatggtgacgcccgcgagcagcctgccgagctc 340
           ||||||||| |  |||||||| || |||||||| ||||   | |||||| ||  ||||||
Sbjct: 836 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 777

                                                                       
Query: 341 ctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtc 400
           || ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||||||||
Sbjct: 776 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 717

                                   
Query: 401 cttggccgcgttgccggcgagctc 424
              |||||||||||| || |||||
Sbjct: 716 gcgggccgcgttgcccgccagctc 693

---

>dbj|D38091.1|WHTPH2AE Triticum aestivum mRNA for protein H2A, complete cds, clone
           wcH2A-10
          Length = 691

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 73/84 (86%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||||||||||  | | ||| ||||| | |||||||||||||||
Sbjct: 369 gagctcctcgtcgttgcggacggcgagctggatgtggcgcggcacgatgcgggtcttctt 310

                                   
Query: 395 gttgtccttggccgcgttgccggc 418
           ||||||| | |||||||| |||||
Sbjct: 309 gttgtccctcgccgcgttcccggc 286

---

>dbj|D38089.1|WHTPH2AC Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-4
          Length = 725

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 73/84 (86%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||||||||||  | | ||| ||||| | |||||||||||||||
Sbjct: 367 gagctcctcgtcgttgcggacggcgagctggatgtggcgcggcacgatgcgggtcttctt 308

                                   
Query: 395 gttgtccttggccgcgttgccggc 418
           ||||||| | |||||||| |||||
Sbjct: 307 gttgtccctcgccgcgttcccggc 284

---

>gb|BC099606.1| Mus musculus H2A histone family, member J, mRNA (cDNA clone
           MGC:118637 IMAGE:1383389), complete cds
          Length = 587

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 136/168 (80%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||| ||||| |  |||||||| || |||||||| ||
Sbjct: 434 cttcttgggcagcagcacggcctggatattgggcaggacgccgccctgcgcgatggtcac 375

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
            |   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| || ||
Sbjct: 374 acggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtgacgagg 315

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||| | ||||||||||| || |||||
Sbjct: 314 gatgatgcgcgtcttcttgttgtccctcgccgcgttgcccgccagctc 267

---

>gb|BC024397.1| Mus musculus H2A histone family, member J, mRNA (cDNA clone
           MGC:36202 IMAGE:5055276), complete cds
          Length = 550

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 136/168 (80%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||| ||||| |  |||||||| || |||||||| ||
Sbjct: 412 cttcttgggcagcagcacggcctggatattgggcaggacgccgccctgcgcgatggtcac 353

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
            |   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| || ||
Sbjct: 352 acggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgagg 293

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||| | ||||||||||| || |||||
Sbjct: 292 gatgatgcgcgtcttcttgttgtccctcgccgcgttgcccgccagctc 245

---

>gb|AY131974.1| Homo sapiens histone H2A (HIST3H2A) gene, complete cds
          Length = 1173

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 136/168 (80%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || || |||||||| ||
Sbjct: 752 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 693

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           ||   | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 692 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 633

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||    |||||||||||||| |||||
Sbjct: 632 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctc 585

---

>ref|XM_478633.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 830

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 78/91 (85%)
 Strand = Plus / Minus

                                                                       
Query: 336 agctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttg 395
           ||||||| ||||||||||||||||||  | | ||| || || |  |||||||||||||||
Sbjct: 439 agctcctcgtcgttgcggacggcgagctggatgtggcggggcactatgcgggtcttcttg 380

                                          
Query: 396 ttgtccttggccgcgttgccggcgagctcaa 426
           |||||| | |||||||| |||||||||||||
Sbjct: 379 ttgtccctcgccgcgttcccggcgagctcaa 349

---

>ref|XM_870470.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC618143), mRNA
          Length = 270

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                      
Query: 366 aggtgccgcgggatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||| ||||||||||||||||||||||||||||||  |||||||||||| || |||||
Sbjct: 128 aggtgacgcgggatgatgcgggtcttcttgttgtcccgggccgcgttgcccgccagctc 70

---

>ref|XM_545426.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488304), mRNA
          Length = 588

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 108/131 (82%)
 Strand = Plus / Minus

                                                                       
Query: 294 acgccgccgtgggcgatggtgacgcccgcgagcagcctgccgagctcctggtcgttgcgg 353
           |||||||| || |||||||| ||||   | |||||| ||  |||||||| ||||||||||
Sbjct: 470 acgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcgg 411

                                                                       
Query: 354 acggcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtccttggccgcgttg 413
           | ||| ||  | ||||| |||||||||||||| ||||||||||||||   ||||||||||
Sbjct: 410 atggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttg 351

                      
Query: 414 ccggcgagctc 424
           || || |||||
Sbjct: 350 cccgccagctc 340

---

>emb|X14730.1|CMHIST2A Duck H2A histone gene
          Length = 845

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 135/167 (80%)
 Strand = Plus / Minus

                                                                       
Query: 258 ttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgacg 317
           |||||||| ||||||||||  | ||||||||| | ||| ||||| || ||||||||||| 
Sbjct: 509 ttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtgacc 450

                                                                       
Query: 318 cccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcggg 377
               | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| || |||
Sbjct: 449 ttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcggggg 390

                                                          
Query: 378 atgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           |||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 389 atgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgctagctc 343

---

>dbj|AK059228.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-024-D11, full
           insert sequence
          Length = 830

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 78/91 (85%)
 Strand = Plus / Minus

                                                                       
Query: 336 agctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttg 395
           ||||||| ||||||||||||||||||  | | ||| || || |  |||||||||||||||
Sbjct: 439 agctcctcgtcgttgcggacggcgagctggatgtggcggggcactatgcgggtcttcttg 380

                                          
Query: 396 ttgtccttggccgcgttgccggcgagctcaa 426
           |||||| | |||||||| |||||||||||||
Sbjct: 379 ttgtccctcgccgcgttcccggcgagctcaa 349

---

>gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, complete cds
          Length = 2132

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 138/171 (80%)
 Strand = Plus / Plus

                                                                       
Query: 254 ggacttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggt 313
           |||||||||||| ||||| |||| ||  |||||||| | ||| ||||||   || |||||
Sbjct: 468 ggacttcttgggcagcagaacggcgtgaatgttgggcagcacaccgccggacgcaatggt 527

                                                                       
Query: 314 gacgcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccg 373
            ||| |  | |||||| |||| ||||||| ||||||||||| ||||||  | | ||| ||
Sbjct: 528 cacgtcgcccagcagcttgcccagctcctcgtcgttgcggatggcgagctggatgtggcg 587

                                                              
Query: 374 cgggatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||| ||||||| |||||||||||||   |||||||||||| || |||||
Sbjct: 588 cgggacgatgcggttcttcttgttgtcgcgggccgcgttgccagccagctc 638

---

>ref|NM_175662.1| Mus musculus histone 2, H2ac (Hist2h2ac), mRNA
          Length = 390

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           ||||||   |||||||||||| || |||||
Sbjct: 222 gttgtcgcgggccgcgttgcccgccagctc 193

---

>ref|NM_013549.1| Mus musculus histone 2, H2aa1 (Hist2h2aa1), mRNA
          Length = 578

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 325 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 266

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           ||||||   |||||||||||| || |||||
Sbjct: 265 gttgtcgcgggccgcgttgcccgccagctc 236

---

>gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339
          Length = 2972

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 309 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 250

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           ||||||   |||||||||||| || |||||
Sbjct: 249 gttgtcgcgggccgcgttgcccgccagctc 220

---

>ref|XM_603142.2| PREDICTED: Bos taurus similar to histone 1, H2ad (LOC524808), mRNA
          Length = 393

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  ||||||| |||||||| || |||||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgtaggtgacgcgggataatacgggtcttctt 223

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           |||||||  |||||| ||||| || |||||
Sbjct: 222 gttgtcccgggccgcattgcctgccagctc 193

---

>ref|XM_602496.2| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC524176), mRNA
          Length = 449

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | ||||| |||||||| ||||| ||||||||
Sbjct: 283 gagctcctcgtcgttgcggatggccagctgcaggtgacgcgggataatgcgcgtcttctt 224

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           |||||||  |||||||||||| || |||||
Sbjct: 223 gttgtcccgggccgcgttgcccgccagctc 194

---

>ref|XM_871147.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC618824), mRNA
          Length = 453

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| |||||||||||  || ||  | ||||| |||||||||||||||||||||||
Sbjct: 282 gagctcctcgtcgttgcggattgccagctgcaggtgacgcgggatgatgcgggtcttctt 223

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           ||| |||  |||||||||||| || |||||
Sbjct: 222 gttatcccgggccgcgttgcccgccagctc 193

---

>gb|BC010564.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone IMAGE:3582122),
           partial cds
          Length = 543

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 309 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 250

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           ||||||   |||||||||||| || |||||
Sbjct: 249 gttgtcgcgggccgcgttgcccgccagctc 220

---

>ref|XM_869001.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC616875), mRNA
          Length = 449

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | ||||| || ||||||||||| ||||||||
Sbjct: 283 gagctcctcgtcgttgcggatggccagctgcaggtgacgagggatgatgcgcgtcttctt 224

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           |||||||  |||||||||||| || |||||
Sbjct: 223 gttgtcccgggccgcgttgcccgccagctc 194

---

>ref|XM_865976.1| PREDICTED: Bos taurus similar to Histone H2A.g (H2A/g) (H2A.3)
           (LOC614970), mRNA
          Length = 447

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | || || |||||||||||||||||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcagatgacgcgggatgatgcgggtcttctt 223

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           |||||||  ||| |||||||| || |||||
Sbjct: 222 gttgtcccgggctgcgttgcccgccagctc 193

---

>ref|NM_178213.2| Mus musculus histone 2, H2ab (Hist2h2ab), mRNA
          Length = 390

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           ||||||   |||||||||||| || |||||
Sbjct: 222 gttgtcgcgggccgcgttgcccgccagctc 193

---

>ref|XM_981616.1| PREDICTED: Mus musculus similar to H2A histone family, member O
           (LOC670497), mRNA
          Length = 3003

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 288 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgagtcttctt 229

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           ||||||   |||||||||||| || |||||
Sbjct: 228 gttgtcgcgggccgcgttgcccgccagctc 199

---

>ref|XM_992084.1| PREDICTED: Mus musculus similar to H2A histone family, member O
           (LOC667728), mRNA
          Length = 3054

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 339 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgagtcttctt 280

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           ||||||   |||||||||||| || |||||
Sbjct: 279 gttgtcgcgggccgcgttgcccgccagctc 250

---

>ref|XM_994730.1| PREDICTED: Mus musculus similar to H2A histone family, member O
           (LOC677006), mRNA
          Length = 2991

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 276 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgagtcttctt 217

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           ||||||   |||||||||||| || |||||
Sbjct: 216 gttgtcgcgggccgcgttgcccgccagctc 187

---

>ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h3c1), mRNA
          Length = 2956

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 309 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 250

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           ||||||   |||||||||||| || |||||
Sbjct: 249 gttgtcgcgggccgcgttgcccgccagctc 220

---

>gb|BC064002.1| Mus musculus cDNA clone IMAGE:6823756, partial cds
          Length = 819

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 308 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 249

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           ||||||   |||||||||||| || |||||
Sbjct: 248 gttgtcgcgggccgcgttgcccgccagctc 219

---

>gb|AY158922.2| Mus musculus histone protein Hist2h2ab gene, complete cds
          Length = 1680

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 490 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 431

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           ||||||   |||||||||||| || |||||
Sbjct: 430 gttgtcgcgggccgcgttgcccgccagctc 401



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 372 cgcgggatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           |||||||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 893 cgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 945

---

>emb|Z30940.1|MDH2AHIST M.domesticus (CD-1) mRNA for histone H2A (partial)
          Length = 523

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 304 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgagtcttctt 245

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           ||||||   |||||||||||| || |||||
Sbjct: 244 gttgtcgcgggccgcgttgcccgccagctc 215

---

>emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23
          Length = 2724

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                        
Query: 335  gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
            |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 1098 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 1039

                                          
Query: 395  gttgtccttggccgcgttgccggcgagctc 424
            ||||||   |||||||||||| || |||||
Sbjct: 1038 gttgtcgcgggccgcgttgcccgccagctc 1009

---

>emb|X16148.1|MMHIS2A3 Mouse H2a and H3 histone genes
          Length = 3098

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                        
Query: 335  gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
            |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 1139 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 1080

                                          
Query: 395  gttgtccttggccgcgttgccggcgagctc 424
            ||||||   |||||||||||| || |||||
Sbjct: 1079 gttgtcgcgggccgcgttgcccgccagctc 1050

---

>dbj|AK158457.1| Mus musculus adult inner ear cDNA, RIKEN full-length enriched
           library, clone:F930118D21 product:unclassifiable, full
           insert sequence
          Length = 2833

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Plus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 520 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 579

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           ||||||   |||||||||||| || |||||
Sbjct: 580 gttgtcgcgggccgcgttgcccgccagctc 609

---

>dbj|AK006728.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:1700048I17 product:histone gene complex
           2, full insert sequence
          Length = 578

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 325 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 266

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           ||||||   |||||||||||| || |||||
Sbjct: 265 gttgtcgcgggccgcgttgcccgccagctc 236

---

>dbj|AK077055.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4932439K17 product:histone gene complex
           2, full insert sequence
          Length = 2876

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 140 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgagtcttctt 81

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           ||||||   |||||||||||| || |||||
Sbjct: 80  gttgtcgcgggccgcgttgcccgccagctc 51

---

>dbj|AK002725.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched
           library, clone:0610031H01 product:histone gene complex
           2, full insert sequence
          Length = 545

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 326 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 267

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           ||||||   |||||||||||| || |||||
Sbjct: 266 gttgtcgcgggccgcgttgcccgccagctc 237

---

>dbj|AK016171.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4930558E18 product:histone gene complex
           2, full insert sequence
          Length = 1059

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Plus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 100 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 159

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           ||||||   |||||||||||| || |||||
Sbjct: 160 gttgtcgcgggccgcgttgcccgccagctc 189

---

>gb|U62674.1|MMU62674 Mus musculus histone H2a.2-615 (H2a-615),  and histone H3.2-615
            (H3-615) genes, complete cds
          Length = 2997

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                        
Query: 335  gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
            |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 1288 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 1229

                                          
Query: 395  gttgtccttggccgcgttgccggcgagctc 424
            ||||||   |||||||||||| || |||||
Sbjct: 1228 gttgtcgcgggccgcgttgcccgccagctc 1199

---

>gb|U62673.1|MMU62673 Mus musculus histone H2a(A)-613, histone H2a(B)-613, and histone
            H2b-613 (H2b) genes, complete cds
          Length = 2618

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Plus

                                                                        
Query: 335  gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
            |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 1311 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 1370

                                          
Query: 395  gttgtccttggccgcgttgccggcgagctc 424
            ||||||   |||||||||||| || |||||
Sbjct: 1371 gttgtcgcgggccgcgttgcccgccagctc 1400



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 372 cgcgggatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           |||||||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 908 cgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 856

---

>dbj|AK028129.1| Mus musculus adult male stomach cDNA, RIKEN full-length enriched
           library, clone:2210403F13 product:histone gene complex
           2, full insert sequence
          Length = 2428

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Plus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 578 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 637

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           ||||||   |||||||||||| || |||||
Sbjct: 638 gttgtcgcgggccgcgttgcccgccagctc 667

---

>ref|NM_178212.1| Mus musculus histone 2, H2aa2 (Hist2h2aa2), mRNA
          Length = 393

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           ||||||   |||||||||||| || |||||
Sbjct: 222 gttgtcgcgggccgcgttgcccgccagctc 193

---

>ref|XM_344599.2| PREDICTED: Rattus norvegicus histone 1, H2ao (predicted)
           (Hist1h2ao_predicted), mRNA
          Length = 483

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | ||||| ||||| |||||||| ||||| ||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtgacgcggaatgatgcgtgtcttttt 223

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           ||||||| | ||||||||||| ||||||||
Sbjct: 222 gttgtccctcgccgcgttgcctgcgagctc 193

---

>gb|AY158953.1| Mus musculus histone protein Hist2h3c2 gene, complete cds
          Length = 1440

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Plus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 502 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 561

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           ||||||   |||||||||||| || |||||
Sbjct: 562 gttgtcgcgggccgcgttgcccgccagctc 591

---

>gb|AY158925.1| Mus musculus histone protein Hist2h2aa1 gene, complete cds
          Length = 1387

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 779 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 720

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           ||||||   |||||||||||| || |||||
Sbjct: 719 gttgtcgcgggccgcgttgcccgccagctc 690

---

>gb|AY158924.1| Mus musculus histone protein Hist2h2aa2 gene, complete cds
          Length = 1387

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 779 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 720

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           ||||||   |||||||||||| || |||||
Sbjct: 719 gttgtcgcgggccgcgttgcccgccagctc 690

---

>gb|AY158923.1| Mus musculus histone protein Hist2h2ac gene, complete cds
          Length = 1200

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 590 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 531

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           ||||||   |||||||||||| || |||||
Sbjct: 530 gttgtcgcgggccgcgttgcccgccagctc 501



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                 
Query: 372  cgcgggatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
            |||||||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 993  cgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 1045

---

>gb|BC062255.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone MGC:73680
           IMAGE:1448126), complete cds
          Length = 552

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 309 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 250

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           ||||||   |||||||||||| || |||||
Sbjct: 249 gttgtcgcgggccgcgttgcccgccagctc 220

---

>gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, complete sequence
          Length = 200326

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                         
Query: 335   gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
             |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 70501 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 70442

                                           
Query: 395   gttgtccttggccgcgttgccggcgagctc 424
             ||||||   |||||||||||| || |||||
Sbjct: 70441 gttgtcgcgggccgcgttgcccgccagctc 70412



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Plus

                                                                         
Query: 335   gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
             |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 64608 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 64667

                                           
Query: 395   gttgtccttggccgcgttgccggcgagctc 424
             ||||||   |||||||||||| || |||||
Sbjct: 64668 gttgtcgcgggccgcgttgcccgccagctc 64697



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 76/90 (84%)
 Strand = Plus / Plus

                                                                         
Query: 335   gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
             |||||||| ||||||||||| ||| ||  | || || |||||||||||||| ||||||||
Sbjct: 45202 gagctcctcgtcgttgcggatggccagctgcagatggcgcgggatgatgcgcgtcttctt 45261

                                           
Query: 395   gttgtccttggccgcgttgccggcgagctc 424
             ||||||   |||||||||||| || |||||
Sbjct: 45262 gttgtcgcgggccgcgttgcccgccagctc 45291



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                  
Query: 372   cgcgggatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
             |||||||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 44799 cgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 44747

---

>gb|AC157656.3| Mus musculus BAC clone RP23-406A5 from chromosome 13, complete sequence
          Length = 189500

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                          
Query: 335    gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
              |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 132628 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgagtcttctt 132569

                                            
Query: 395    gttgtccttggccgcgttgccggcgagctc 424
              ||||||   |||||||||||| || |||||
Sbjct: 132568 gttgtcgcgggccgcgttgcccgccagctc 132539

---

>gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, complete sequence
          Length = 166720

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                         
Query: 335   gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
             |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 36085 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 36026

                                           
Query: 395   gttgtccttggccgcgttgccggcgagctc 424
             ||||||   |||||||||||| || |||||
Sbjct: 36025 gttgtcgcgggccgcgttgcccgccagctc 35996



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Plus

                                                                         
Query: 335   gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
             |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 30192 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 30251

                                           
Query: 395   gttgtccttggccgcgttgccggcgagctc 424
             ||||||   |||||||||||| || |||||
Sbjct: 30252 gttgtcgcgggccgcgttgcccgccagctc 30281



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 76/90 (84%)
 Strand = Plus / Minus

                                                                         
Query: 335   gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
             |||||||| ||||||||||| ||| ||  | || || |||||||||||||| ||||||||
Sbjct: 55491 gagctcctcgtcgttgcggatggccagctgcagatggcgcgggatgatgcgcgtcttctt 55432

                                           
Query: 395   gttgtccttggccgcgttgccggcgagctc 424
             ||||||   |||||||||||| || |||||
Sbjct: 55431 gttgtcgcgggccgcgttgcccgccagctc 55402



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                  
Query: 372   cgcgggatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
             |||||||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 55894 cgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 55946

---

>gb|BC053966.1| Mus musculus histone 2, H2aa2, mRNA (cDNA clone IMAGE:1349026)
          Length = 570

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 318 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 259

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           ||||||   |||||||||||| || |||||
Sbjct: 258 gttgtcgcgggccgcgttgcccgccagctc 229

---

>ref|XM_667061.1| Plasmodium berghei strain ANKA histone h2a (PB300144.00.0), partial
           mRNA
          Length = 378

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 267 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgagtcttctt 208

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           ||||||   |||||||||||| || |||||
Sbjct: 207 gttgtcgcgggccgcgttgcccgccagctc 178

---

>gb|BC089519.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone MGC:107211
           IMAGE:6771160), complete cds
          Length = 637

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 366 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 307

                                         
Query: 395 gttgtccttggccgcgttgccggcgagctc 424
           ||||||   |||||||||||| || |||||
Sbjct: 306 gttgtcgcgggccgcgttgcccgccagctc 277

---

>gb|U70133.1|BBU70133 Bufo bufo gagarizans replication-dependent histone H2A mRNA,
           complete cds
          Length = 466

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 116/142 (81%)
 Strand = Plus / Minus

                                                                       
Query: 259 tcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgacgc 318
           ||||||| ||||||||||  | ||||||||| |  || || || |||||||||||||| |
Sbjct: 379 tcttgggcagcagcacggcctggatgttgggcaggacccccccctgggcgatggtgactc 320

                                                                       
Query: 319 ccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcggga 378
           |  | |||||| ||  |||||||| ||||||||| ||||| ||  | ||||| || ||||
Sbjct: 319 cgcccagcagcttgttgagctcctcgtcgttgcgcacggccagctgcaggtgacggggga 260

                                 
Query: 379 tgatgcgggtcttcttgttgtc 400
           ||||||| ||||||||||||||
Sbjct: 259 tgatgcgagtcttcttgttgtc 238

---

>gb|AC160122.2| Mus musculus BAC clone RP23-390G1 from chromosome 13, complete sequence
          Length = 208856

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Plus

                                                                          
Query: 335    gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
              |||||||| ||||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 184237 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgagtcttctt 184296

                                            
Query: 395    gttgtccttggccgcgttgccggcgagctc 424
              ||||||   |||||||||||| || |||||
Sbjct: 184297 gttgtcgcgggccgcgttgcccgccagctc 184326

---

>ref|XM_527272.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC471894),
           mRNA
          Length = 372

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | ||||| ||||||||||| |||||||||||
Sbjct: 261 gagctcctcgtcgttgcggatggccagttggaggtgacgcgggatgatacgggtcttctt 202

                                
Query: 395 gttgtccttggccgcgttgcc 415
           ||||||   ||||||||||||
Sbjct: 201 gttgtcgcgggccgcgttgcc 181

---

>ref|XM_518300.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC462507),
           mRNA
          Length = 846

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | | ||| |||||||||||||||||||||||
Sbjct: 228 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 169

                                
Query: 395 gttgtccttggccgcgttgcc 415
           ||||||   ||||||||||||
Sbjct: 168 gttgtcgcgggccgcgttgcc 148

---

>ref|XM_527262.1| PREDICTED: Pan troglodytes similar to histone protein Hist1h2af
           (LOC471884), mRNA
          Length = 420

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                       
Query: 336 agctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttg 395
           ||||||| ||||||||||| ||| ||  | ||||| ||||||||||||||||||||||||
Sbjct: 281 agctcctcgtcgttgcggatggctagctgcaggtggcgcgggatgatgcgggtcttcttg 222

                
Query: 396 ttgtc 400
           |||||
Sbjct: 221 ttgtc 217

---

>ref|XM_518289.1| PREDICTED: Pan troglodytes similar to Histone H2A.g (H2A/g) (H2A.3)
           (LOC462493), mRNA
          Length = 1052

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                       
Query: 336 agctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttg 395
           ||||||| ||||||||||| ||| ||  | ||||| || |||||||||||||||||||||
Sbjct: 331 agctcctcgtcgttgcggatggctagctgcaggtgtcgggggatgatgcgggtcttcttg 272

                                        
Query: 396 ttgtccttggccgcgttgccggcgagctc 424
           |||||   |||||||||||| || |||||
Sbjct: 271 ttgtcgcgggccgcgttgcccgccagctc 243

---

>gb|BC104198.1| Homo sapiens histone 1, H2ak, mRNA (cDNA clone MGC:125892
           IMAGE:40031339), complete cds
          Length = 438

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | | ||| |||||||||||||||||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 223

                                
Query: 395 gttgtccttggccgcgttgcc 415
           ||||||   ||||||||||||
Sbjct: 222 gttgtcgcgggccgcgttgcc 202

---

>gb|BC104199.1| Homo sapiens histone 1, H2ak, mRNA (cDNA clone MGC:125893
           IMAGE:40031340), complete cds
          Length = 438

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | | ||| |||||||||||||||||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 223

                                
Query: 395 gttgtccttggccgcgttgcc 415
           ||||||   ||||||||||||
Sbjct: 222 gttgtcgcgggccgcgttgcc 202

---

>gb|BC016677.1| Homo sapiens histone 1, H2ag, mRNA (cDNA clone MGC:17204
           IMAGE:4342191), complete cds
          Length = 2256

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | || || |||||||||||||||||||||||
Sbjct: 301 gagctcctcgtcgttgcggatggccagttggagatgacgcgggatgatgcgggtcttctt 242

                                
Query: 395 gttgtccttggccgcgttgcc 415
           ||||||   ||||||||||||
Sbjct: 241 gttgtcgcgggccgcgttgcc 221

---

>gb|BC067782.1| Homo sapiens histone 1, H2ag, mRNA (cDNA clone IMAGE:5314244),
           partial cds
          Length = 2270

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | || || |||||||||||||||||||||||
Sbjct: 312 gagctcctcgtcgttgcggatggccagttggagatgacgcgggatgatgcgggtcttctt 253

                                
Query: 395 gttgtccttggccgcgttgcc 415
           ||||||   ||||||||||||
Sbjct: 252 gttgtcgcgggccgcgttgcc 232

---

>gb|BC034487.2| Homo sapiens histone 1, H2ak, mRNA (cDNA clone IMAGE:4825623), with
           apparent retained intron
          Length = 2884

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | | ||| |||||||||||||||||||||||
Sbjct: 318 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 259

                                
Query: 395 gttgtccttggccgcgttgcc 415
           ||||||   ||||||||||||
Sbjct: 258 gttgtcgcgggccgcgttgcc 238

---

>ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@) on chromosome 6
          Length = 91567

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                         
Query: 335   gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
             |||||||| ||||||||||| ||| ||  | | ||| |||||||||||||||||||||||
Sbjct: 56394 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 56335

                                  
Query: 395   gttgtccttggccgcgttgcc 415
             ||||||   ||||||||||||
Sbjct: 56334 gttgtcgcgggccgcgttgcc 56314



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 76/90 (84%)
 Strand = Plus / Plus

                                                                         
Query: 335   gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
             ||||||||  |||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 85961 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 86020

                                           
Query: 395   gttgtccttggccgcgttgccggcgagctc 424
             ||||||   |||||||||||| || |||||
Sbjct: 86021 gttgtcgcgggccgcgttgccagccagctc 86050



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 76/90 (84%)
 Strand = Plus / Minus

                                                                         
Query: 335   gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
             ||||||||  |||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 79993 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 79934

                                           
Query: 395   gttgtccttggccgcgttgccggcgagctc 424
             ||||||   |||||||||||| || |||||
Sbjct: 79933 gttgtcgcgggccgcgttgccagccagctc 79904



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                         
Query: 335   gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
             |||||||| ||||||||||| ||| ||  | | ||| |||||||| ||||||||||||||
Sbjct: 28816 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggataatgcgggtcttctt 28875

                   
Query: 395   gttgtc 400
             ||||||
Sbjct: 28876 gttgtc 28881



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                        
Query: 335  gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
            |||||||| ||||||||||| ||| ||  | | ||| |||||||||||||||||||| ||
Sbjct: 1584 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttttt 1525

                  
Query: 395  gttgtc 400
            ||||||
Sbjct: 1524 gttgtc 1519

---

>ref|NM_021064.3| Homo sapiens histone 1, H2ag (HIST1H2AG), mRNA
          Length = 2267

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | || || |||||||||||||||||||||||
Sbjct: 312 gagctcctcgtcgttgcggatggccagttggagatgacgcgggatgatgcgggtcttctt 253

                                
Query: 395 gttgtccttggccgcgttgcc 415
           ||||||   ||||||||||||
Sbjct: 252 gttgtcgcgggccgcgttgcc 232

---

>ref|NM_003510.2| Homo sapiens histone 1, H2ak (HIST1H2AK), mRNA
          Length = 460

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | | ||| |||||||||||||||||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 223

                                
Query: 395 gttgtccttggccgcgttgcc 415
           ||||||   ||||||||||||
Sbjct: 222 gttgtcgcgggccgcgttgcc 202

---

>emb|Z98744.2|HS193B12 Human DNA sequence from clone RP1-193B12 on chromosome 6p21.3-22.3
            Contains the H2AFD, H2BFD, H2AFI, H1F5, H3FF, H4FK, H3FJ,
            H2AFN, and H2BFN histone genes, the OR2B2 gene for
            olfactory receptor 2B2, histone H2B family member I
            pseudogene H2BFIP, a hypothetical protein pseudogene,
            ESTs, STSs, GSSs and CpG islands, complete sequence
          Length = 100374

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 70/81 (86%)
 Strand = Plus / Plus

                                                                        
Query: 335  gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
            |||||||| ||||||||||| ||| ||  | | ||| |||||||||||||||||||||||
Sbjct: 1799 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 1858

                                 
Query: 395  gttgtccttggccgcgttgcc 415
            ||||||   ||||||||||||
Sbjct: 1859 gttgtcgcgggccgcgttgcc 1879



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                         
Query: 335   gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
             |||||||| ||||||||||| ||| ||  | | ||| |||||||||||||||||||| ||
Sbjct: 56609 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttttt 56668

                   
Query: 395   gttgtc 400
             ||||||
Sbjct: 56669 gttgtc 56674



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                         
Query: 335   gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
             |||||||| ||||||||||| ||| ||  | | ||| |||||||| ||||||||||||||
Sbjct: 29377 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggataatgcgggtcttctt 29318

                   
Query: 395   gttgtc 400
             ||||||
Sbjct: 29317 gttgtc 29312

---

>emb|AL021807.2|HS86C11 Human DNA sequence from clone RP1-86C11 on chromosome 6p21.31-22.1
             Contains a vomeronasal olfactory 1 receptor chromosome 6-2
             (VN1R6-2P) pseudogene, histone genes H2BFN and H2AFA, the
             gene for a novel protein identical to H2B histone family
             member A (H2BFA), the gene for a novel protein identical
             to H2A histone family member I (H2AFI), a novel histone
             gene similar to H4F2 and three CpG islands, complete
             sequence
          Length = 89016

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                         
Query: 335   gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
             |||||||| ||||||||||| ||| ||  | || || |||||||||||||||||||||||
Sbjct: 56658 gagctcctcgtcgttgcggatggccagttggagatgacgcgggatgatgcgggtcttctt 56599

                                  
Query: 395   gttgtccttggccgcgttgcc 415
             ||||||   ||||||||||||
Sbjct: 56598 gttgtcgcgggccgcgttgcc 56578



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                         
Query: 335   gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
             |||||||| ||||||||||| ||| ||  | ||||| ||||||||||| |||||||||||
Sbjct: 70715 gagctcctcgtcgttgcggatggccagttggaggtgacgcgggatgatacgggtcttctt 70656

                   
Query: 395   gttgtc 400
             ||||||
Sbjct: 70655 gttgtc 70650

---

>emb|Z83739.1|HSZ83739 H.sapiens hH2A/d gene
          Length = 650

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | | ||| |||||||||||||||||||||||
Sbjct: 425 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 366

                                
Query: 395 gttgtccttggccgcgttgcc 415
           ||||||   ||||||||||||
Sbjct: 365 gttgtcgcgggccgcgttgcc 345

---

>emb|X80330.1|CLH2A232 C.longicaudatus genes for histones H2a.2 and H3.2
          Length = 2927

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                        
Query: 344  gtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtcctt 403
            ||||||||||| ||| ||  | ||||| |||||||||||||||||||||||||||||   
Sbjct: 1273 gtcgttgcggatggccagctgcaggtggcgcgggatgatgcgggtcttcttgttgtcgcg 1214

                                 
Query: 404  ggccgcgttgccggcgagctc 424
            |||||||||||| || |||||
Sbjct: 1213 ggccgcgttgcccgccagctc 1193

---

>ref|XM_577573.1| PREDICTED: Rattus norvegicus similar to Histone H2A.l (H2A/l)
           (LOC502125), mRNA
          Length = 393

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 55/61 (90%)
 Strand = Plus / Minus

                                                                       
Query: 364 gtaggtgccgcgggatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagct 423
           ||||||| |||||||||||||| ||||||||||||||| | ||||||||||| || ||||
Sbjct: 253 gtaggtggcgcgggatgatgcgtgtcttcttgttgtccctcgccgcgttgcccgccagct 194

            
Query: 424 c 424
           |
Sbjct: 193 c 193

---

>ref|XM_345255.2| PREDICTED: Rattus norvegicus histone 2, H2aa (predicted)
           (Hist2h2aa_predicted), mRNA
          Length = 591

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 gtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtcctt 403
           ||||||||||| ||| ||  | ||||| |||||||||||||||||||||||||||||   
Sbjct: 471 gtcgttgcggatggccagctgcaggtggcgcgggatgatgcgggtcttcttgttgtcgcg 412

                                
Query: 404 ggccgcgttgccggcgagctc 424
           |||||||||||| || |||||
Sbjct: 411 ggccgcgttgcccgccagctc 391

---

>ref|XM_574998.1| PREDICTED: Rattus norvegicus similar to Hist2h2aa1 protein
           (LOC499676), mRNA
          Length = 675

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 gtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtcctt 403
           ||||||||||| ||| ||  | ||||| |||||||||||||||||||||||||||||   
Sbjct: 546 gtcgttgcggatggccagctgcaggtggcgcgggatgatgcgggtcttcttgttgtcgcg 487

                                
Query: 404 ggccgcgttgccggcgagctc 424
           |||||||||||| || |||||
Sbjct: 486 ggccgcgttgcccgccagctc 466

---

>ref|XM_574997.1| PREDICTED: Rattus norvegicus similar to histone H2a(A)-613
           (LOC499675), mRNA
          Length = 510

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 gtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtcctt 403
           ||||||||||| ||| ||  | ||||| |||||||||||||||||||||||||||||   
Sbjct: 387 gtcgttgcggatggccagctgcaggtggcgcgggatgatgcgggtcttcttgttgtcgcg 328

                                
Query: 404 ggccgcgttgccggcgagctc 424
           |||||||||||| || |||||
Sbjct: 327 ggccgcgttgcccgccagctc 307

---

>gb|AY131991.1| Homo sapiens histone H2A (HIST1H2AK) gene, complete cds
          Length = 1119

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | | ||| |||||||||||||||||||||||
Sbjct: 655 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 596

                                
Query: 395 gttgtccttggccgcgttgcc 415
           ||||||   ||||||||||||
Sbjct: 595 gttgtcgcgggccgcgttgcc 575

---

>gb|AY131987.1| Homo sapiens histone H2A (HIST1H2AG) gene, complete cds
          Length = 1173

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | || || |||||||||||||||||||||||
Sbjct: 674 gagctcctcgtcgttgcggatggccagttggagatgacgcgggatgatgcgggtcttctt 615

                                
Query: 395 gttgtccttggccgcgttgcc 415
           ||||||   ||||||||||||
Sbjct: 614 gttgtcgcgggccgcgttgcc 594

---

>dbj|AK130106.1| Homo sapiens cDNA FLJ26596 fis, clone LNF08501
          Length = 1723

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 70/81 (86%)
 Strand = Plus / Plus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | | ||| |||||||||||||||||||||||
Sbjct: 299 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 358

                                
Query: 395 gttgtccttggccgcgttgcc 415
           ||||||   ||||||||||||
Sbjct: 359 gttgtcgcgggccgcgttgcc 379

---

>gb|AY893520.1| Synthetic construct Homo sapiens clone FLH130895.01X histone 1 H2ak
           (HIST1H2AK) mRNA, complete cds
          Length = 393

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | | ||| |||||||||||||||||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 223

                                
Query: 395 gttgtccttggccgcgttgcc 415
           ||||||   ||||||||||||
Sbjct: 222 gttgtcgcgggccgcgttgcc 202

---

>gb|L19778.1|HUMH2A1B Homo sapiens histone H2A.1b mRNA, complete cds
          Length = 2250

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                       
Query: 335 gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
           |||||||| ||||||||||| ||| ||  | || || |||||||||||||||||||||||
Sbjct: 312 gagctcctcgtcgttgcggatggccagttggagatgacgcgggatgatgcgggtcttctt 253

                                
Query: 395 gttgtccttggccgcgttgcc 415
           ||||||   ||||||||||||
Sbjct: 252 gttgtcgcgggccgcgttgcc 232

---

>emb|AL713943.3|CNS07YPC Oryza sativa chromosome 12, . BAC OSJNBa0030G16 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 182172

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 123/152 (80%)
 Strand = Plus / Plus

                                                                         
Query: 281   gatgttggggatcacgccgccgtgggcgatggtgacgcccgcgagcagcctgccgagctc 340
             ||||||||| | ||||||||||  ||||||||||||| |  ||||||||||||  |||||
Sbjct: 9947  gatgttgggcagcacgccgccggcggcgatggtgacggcgccgagcagcctgctcagctc 10006

                                                                         
Query: 341   ctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtc 400
             || ||||||||| || || ||  | | ||||| ||| | ||| ||| |||||||||||||
Sbjct: 10007 ctcgtcgttgcgcaccgccagctggatgtgcctcggcacgatccggttcttcttgttgtc 10066

                                             
Query: 401   cttggccgcgttgccggcgagctcaancacct 432
             | | |||||||| || || ||||| | |||||
Sbjct: 10067 cctcgccgcgttccccgccagctccagcacct 10098

---

>emb|AL731880.3|CNS08C8J Oryza sativa chromosome 12, . BAC OSJNBa0035E02 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 107819

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 123/152 (80%)
 Strand = Plus / Minus

                                                                         
Query: 281   gatgttggggatcacgccgccgtgggcgatggtgacgcccgcgagcagcctgccgagctc 340
             ||||||||| | ||||||||||  ||||||||||||| |  ||||||||||||  |||||
Sbjct: 34538 gatgttgggcagcacgccgccggcggcgatggtgacggcgccgagcagcctgctcagctc 34479

                                                                         
Query: 341   ctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttcttgttgtc 400
             || ||||||||| || || ||  | | ||||| ||| | ||| ||| |||||||||||||
Sbjct: 34478 ctcgtcgttgcgcaccgccagctggatgtgcctcggcacgatccggttcttcttgttgtc 34419

                                             
Query: 401   cttggccgcgttgccggcgagctcaancacct 432
             | | |||||||| || || ||||| | |||||
Sbjct: 34418 cctcgccgcgttccccgccagctccagcacct 34387

---

>ref|NG_000827.2| Homo sapiens genomic histone family microcluster (HFM@) on chromosome
            6
          Length = 20621

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                        
Query: 335  gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
            |||||||| ||||||||||| ||| ||  | || || |||||||||||||||||||||||
Sbjct: 5859 gagctcctcgtcgttgcggatggccagttggagatgacgcgggatgatgcgggtcttctt 5800

                                 
Query: 395  gttgtccttggccgcgttgcc 415
            ||||||   ||||||||||||
Sbjct: 5799 gttgtcgcgggccgcgttgcc 5779



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                         
Query: 335   gagctcctggtcgttgcggacggcgagaagtaggtgccgcgggatgatgcgggtcttctt 394
             |||||||| ||||||||||| ||| ||  | ||||| ||||||||||| |||||||||||
Sbjct: 19916 gagctcctcgtcgttgcggatggccagttggaggtgacgcgggatgatacgggtcttctt 19857

                   
Query: 395   gttgtc 400
             ||||||
Sbjct: 19856 gttgtc 19851

---

>ref|XM_522264.1| PREDICTED: Pan troglodytes similar to Histone H2A.x (H2a/x)
           (LOC466864), mRNA
          Length = 432

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 117/144 (81%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| |  ||||| || |||||||| || ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 301

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
           |||  | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| || ||
Sbjct: 300 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 241

                                   
Query: 377 gatgatgcgggtcttcttgttgtc 400
           |||||| || ||||||||||||||
Sbjct: 240 gatgattcgcgtcttcttgttgtc 217

---

>ref|XM_425469.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427895),
           mRNA
          Length = 390

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 135/168 (80%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| | ||| ||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 301

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
                | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| || ||
Sbjct: 300 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 241

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193

---

>ref|XM_425465.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427891),
           mRNA
          Length = 390

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 135/168 (80%)
 Strand = Plus / Minus

                                                                       
Query: 257 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgggcgatggtgac 316
           ||||||||| ||||||||||  | ||||||||| | ||| ||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 301

                                                                       
Query: 317 gcccgcgagcagcctgccgagctcctggtcgttgcggacggcgagaagtaggtgccgcgg 376
                | |||||| ||  |||||||| ||||||||||| ||| ||  | ||||| || ||
Sbjct: 300 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 241

                                                           
Query: 377 gatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagctc 424
           ||||||||| ||||||||||||||   |||||||||||| || |||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctc 193


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,754,052
Number of Sequences: 3902068
Number of extensions: 3754052
Number of successful extensions: 244742
Number of sequences better than 10.0: 671
Number of HSP's better than 10.0 without gapping: 677
Number of HSP's successfully gapped in prelim test: 14
Number of HSP's that attempted gapping in prelim test: 224375
Number of HSP's gapped (non-prelim): 20251
length of query: 437
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 415
effective length of database: 17,147,199,772
effective search space: 7116087905380
effective search space used: 7116087905380
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---