ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal35m06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome 38 5.0
2ref|XM_765823.1| Giardia lamblia ATCC 50803 hypothetical protein... 38 5.0
3emb|BX572599.1| Rhodopseudomonas palustris CGA009 complete genom... 38 5.0
4gb|AE016820.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 38 5.0
5ref|NM_211432.1| Eremothecium gossypii AGL297Cp (AGL297C), mRNA 38 5.0
6gb|U53327.1|RSU53327 Rhizobium sp. orfZ, NodA, NodF, NodE, NodG,... 38 5.0
7gb|AF509565.1| Streptomyces sp. JP95 griseorhodin biosynthesis g... 38 5.0

>gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome
          Length = 3345170

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                          
Query: 71      cggcatcgccttggcgcacgacgcgat 97
               |||||||||||| |||| |||||||||
Sbjct: 3069417 cggcatcgcctttgcgctcgacgcgat 3069391



to top

>ref|XM_765823.1| Giardia lamblia ATCC 50803 hypothetical protein (GLP_608_11121_12716)
            partial mRNA
          Length = 1596

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 20   tgccccgacgaggcccttc 38
            |||||||||||||||||||
Sbjct: 1186 tgccccgacgaggcccttc 1168



to top

>emb|BX572599.1| Rhodopseudomonas palustris CGA009 complete genome; segment 7/16
          Length = 349142

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 69     ctcggcatcgccttggcgc 87
              |||||||||||||||||||
Sbjct: 323396 ctcggcatcgccttggcgc 323414



to top

>gb|AE016820.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VII,
              complete sequence
          Length = 1476513

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 2      gaagcccgaagcaagtctt 20
              |||||||||||||||||||
Sbjct: 150132 gaagcccgaagcaagtctt 150114



to top

>ref|NM_211432.1| Eremothecium gossypii AGL297Cp (AGL297C), mRNA
          Length = 2913

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 2   gaagcccgaagcaagtctt 20
           |||||||||||||||||||
Sbjct: 771 gaagcccgaagcaagtctt 789



to top

>gb|U53327.1|RSU53327 Rhizobium sp. orfZ, NodA, NodF, NodE, NodG, NodB, NodC, NodI, NodJ,
            NodH, NodP, and NodQ genes, complete cds
          Length = 16124

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 66   gcactcggcatcgccttgg 84
            |||||||||||||||||||
Sbjct: 4237 gcactcggcatcgccttgg 4219



to top

>gb|AF509565.1| Streptomyces sp. JP95 griseorhodin biosynthesis gene cluster, complete
             sequence
          Length = 36905

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 83    ggcgcacgacgcgatgcgg 101
             |||||||||||||||||||
Sbjct: 15622 ggcgcacgacgcgatgcgg 15640


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 443,450
Number of Sequences: 3902068
Number of extensions: 443450
Number of successful extensions: 28331
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 28255
Number of HSP's gapped (non-prelim): 76
length of query: 111
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 90
effective length of database: 17,151,101,840
effective search space: 1543599165600
effective search space used: 1543599165600
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top