ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal35j11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_475153.1| Oryza sativa (japonica cultivar-group), predic... 90 9e-15
2gb|AC119289.2| Oryza sativa (japonica cultivar-group) chromosome... 90 9e-15
3gb|AC108874.2| Oryza sativa (japonica cultivar-group) chromosome... 90 9e-15
4dbj|AB110178.1| Oryza sativa (japonica cultivar-group) mRNA for ... 90 9e-15
5dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 90 9e-15
6dbj|AK058906.1| Oryza sativa (japonica cultivar-group) cDNA clon... 90 9e-15
7ref|NM_190087.1| Oryza sativa (japonica cultivar-group), predic... 78 3e-11
8dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 78 3e-11
9dbj|AP003412.4| Oryza sativa (japonica cultivar-group) genomic D... 78 3e-11
10dbj|AP003269.2| Oryza sativa (japonica cultivar-group) genomic D... 78 3e-11
11dbj|AK109341.2| Oryza sativa (japonica cultivar-group) cDNA clon... 78 3e-11
12dbj|AK101971.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 3e-11
13dbj|AK070627.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 3e-11
14dbj|AK059437.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 3e-11
15ref|NM_114807.2| Arabidopsis thaliana unknown protein AT3G49470 ... 50 0.007
16emb|AL132964.2|ATT9C5 Arabidopsis thaliana DNA chromosome 3, BAC... 50 0.007
17gb|AY072536.1| Arabidopsis thaliana alpha NAC-like protein (At3g... 50 0.007
18gb|AF370545.1|AF370545 Arabidopsis thaliana alpha NAC-like prote... 50 0.007
19emb|BX825921.1|CNS0A553 Arabidopsis thaliana Full-length cDNA Co... 50 0.007
20gb|AC012329.5|AC012329 Arabidopsis thaliana chromosome 1 BAC T1G... 50 0.007
21gb|BT016475.1| Zea mays clone Contig308 mRNA sequence 46 0.12
22gb|AY231744.1| Drosophila yakuba clone yak-em_Nacalpha mRNA sequ... 46 0.12
23gb|BC091311.1| Rattus norvegicus hypothetical protein LOC289786,... 46 0.12
24ref|XM_214092.3| PREDICTED: Rattus norvegicus similar to mKIAA03... 46 0.12
25gb|AF220200.1|AF220200 Pinus taeda nascent polypeptide associate... 46 0.12
26ref|NM_112074.2| Arabidopsis thaliana unknown protein AT3G12390 ... 44 0.45
27gb|AY522625.1| Oreochromis mossambicus nascent polypeptide-assoc... 44 0.45
28emb|CR712159.2|CNS0GCGB Tetraodon nigroviridis full-length cDNA 44 0.45
29emb|CR722249.2|CNS0GK8F Tetraodon nigroviridis full-length cDNA 44 0.45
30emb|CR722169.2|CNS0GK67 Tetraodon nigroviridis full-length cDNA 44 0.45
31emb|CR717966.2|CNS0GGXG Tetraodon nigroviridis full-length cDNA 44 0.45
32emb|CR717497.2|CNS0GGKF Tetraodon nigroviridis full-length cDNA 44 0.45
33emb|CR716901.2|CNS0GG3Y Tetraodon nigroviridis full-length cDNA 44 0.45
34emb|CR716022.2|CNS0GFFM Tetraodon nigroviridis full-length cDNA 44 0.45
35emb|CR715618.2|CNS0GF4E Tetraodon nigroviridis full-length cDNA 44 0.45
36emb|CR715460.2|CNS0GF00 Tetraodon nigroviridis full-length cDNA 44 0.45
37emb|CR714862.2|CNS0GEJE Tetraodon nigroviridis full-length cDNA 44 0.45
38emb|CR714224.2|CNS0GE1O Tetraodon nigroviridis full-length cDNA 44 0.45
39emb|CR712921.2|CNS0GD1H Tetraodon nigroviridis full-length cDNA 44 0.45
40emb|CR712868.2|CNS0GD00 Tetraodon nigroviridis full-length cDNA 44 0.45
41emb|CR710910.2|CNS0GBHM Tetraodon nigroviridis full-length cDNA 44 0.45
42emb|CR710585.2|CNS0GB8L Tetraodon nigroviridis full-length cDNA 44 0.45
43emb|CR709573.2|CNS0GAGH Tetraodon nigroviridis full-length cDNA 44 0.45
44emb|CR706444.2|CNS0G81K Tetraodon nigroviridis full-length cDNA 44 0.45
45emb|CR704473.2|CNS0G6IT Tetraodon nigroviridis full-length cDNA 44 0.45
46emb|CR702894.2|CNS0G5AY Tetraodon nigroviridis full-length cDNA 44 0.45
47emb|CR702653.2|CNS0G549 Tetraodon nigroviridis full-length cDNA 44 0.45
48emb|CR702124.2|CNS0G4PK Tetraodon nigroviridis full-length cDNA 44 0.45
49emb|CR701979.2|CNS0G4LJ Tetraodon nigroviridis full-length cDNA 44 0.45
50emb|CR701629.2|CNS0G4BT Tetraodon nigroviridis full-length cDNA 44 0.45
51emb|CR699096.2|CNS0G2DG Tetraodon nigroviridis full-length cDNA 44 0.45
52emb|CR698619.2|CNS0G207 Tetraodon nigroviridis full-length cDNA 44 0.45
53emb|CR698352.2|CNS0G1SS Tetraodon nigroviridis full-length cDNA 44 0.45
54emb|CR697288.2|CNS0G0Z8 Tetraodon nigroviridis full-length cDNA 44 0.45
55emb|CR696825.2|CNS0G0MD Tetraodon nigroviridis full-length cDNA 44 0.45
56emb|CR696554.2|CNS0G0EU Tetraodon nigroviridis full-length cDNA 44 0.45
57emb|CR696276.2|CNS0G074 Tetraodon nigroviridis full-length cDNA 44 0.45
58emb|CR695626.2|CNS0FZP2 Tetraodon nigroviridis full-length cDNA 44 0.45
59emb|CR695732.2|CNS0FZS0 Tetraodon nigroviridis full-length cDNA 44 0.45
60emb|CR694436.2|CNS0FYS0 Tetraodon nigroviridis full-length cDNA 44 0.45
61emb|CR688523.2|CNS0FU7R Tetraodon nigroviridis full-length cDNA 44 0.45
62emb|CR688181.2|CNS0FTY9 Tetraodon nigroviridis full-length cDNA 44 0.45
63emb|CR688138.2|CNS0FTX2 Tetraodon nigroviridis full-length cDNA 44 0.45
64emb|CR687296.2|CNS0FT9O Tetraodon nigroviridis full-length cDNA 44 0.45
65emb|CR682385.2|CNS0FPH9 Tetraodon nigroviridis full-length cDNA 44 0.45
66emb|CR675609.2|CNS0FK9R Tetraodon nigroviridis full-length cDNA 44 0.45
67emb|CR664046.2|CNS0FBCK Tetraodon nigroviridis full-length cDNA 44 0.45
68emb|CR663607.2|CNS0FB0D Tetraodon nigroviridis full-length cDNA 44 0.45
69emb|CR661227.2|CNS0F969 Tetraodon nigroviridis full-length cDNA 44 0.45
70emb|CR660613.2|CNS0F8P7 Tetraodon nigroviridis full-length cDNA 44 0.45
71emb|CR660539.2|CNS0F8N5 Tetraodon nigroviridis full-length cDNA 44 0.45
72emb|CR655127.2|CNS0F4GT Tetraodon nigroviridis full-length cDNA 44 0.45
73emb|CR653087.2|CNS0F2W5 Tetraodon nigroviridis full-length cDNA 44 0.45
74emb|CR652468.2|CNS0F2EY Tetraodon nigroviridis full-length cDNA 44 0.45
75emb|CR651752.2|CNS0F1V2 Tetraodon nigroviridis full-length cDNA 44 0.45
76emb|CR651630.2|CNS0F1RO Tetraodon nigroviridis full-length cDNA 44 0.45
77emb|CR650255.2|CNS0F0PH Tetraodon nigroviridis full-length cDNA 44 0.45
78emb|CR647893.2|CNS0EYVV Tetraodon nigroviridis full-length cDNA 44 0.45
79emb|CR647713.2|CNS0EYQV Tetraodon nigroviridis full-length cDNA 44 0.45
80emb|CR639196.2|CNS0ES6A Tetraodon nigroviridis full-length cDNA 44 0.45
81emb|CR637873.2|CNS0ER5J Tetraodon nigroviridis full-length cDNA 44 0.45
82emb|CR636835.2|CNS0EQCP Tetraodon nigroviridis full-length cDNA 44 0.45
83emb|CR634963.2|CNS0EOWP Tetraodon nigroviridis full-length cDNA 44 0.45
84emb|CR632932.2|CNS0ENCA Tetraodon nigroviridis full-length cDNA 44 0.45
85emb|CR632678.2|CNS0EN58 Tetraodon nigroviridis full-length cDNA 44 0.45
86emb|CR632573.2|CNS0EN2B Tetraodon nigroviridis full-length cDNA 44 0.45
87emb|CR632323.2|CNS0EMVD Tetraodon nigroviridis full-length cDNA 44 0.45
88emb|CR632317.2|CNS0EMV7 Tetraodon nigroviridis full-length cDNA 44 0.45
89emb|CR631332.2|CNS0EM3T Tetraodon nigroviridis full-length cDNA 44 0.45
90emb|CR631747.2|CNS0EMFD Tetraodon nigroviridis full-length cDNA 44 0.45
91gb|AY094022.1| Arabidopsis thaliana AT3g12390/T2E22_130 mRNA, co... 44 0.45
92gb|AY048232.1| Arabidopsis thaliana AT3g12390/T2E22_130 mRNA, co... 44 0.45
93emb|BX824815.1|CNS0A5HP Arabidopsis thaliana Full-length cDNA Co... 44 0.45
94gb|AC069474.4|AC069474 Arabidopsis thaliana chromosome 3 BAC T2E... 44 0.45
95gb|AY168640.1| Oreochromis niloticus nascent polypeptide-associa... 44 0.45
96dbj|AP002047.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 44 0.45
97emb|CT033503.1| Platynereis dumerilii EST IB0AAA19AH12EM1 44 0.45
98emb|CT033502.1| Platynereis dumerilii EST IB0AAA19AH12FM1 44 0.45
99emb|CT033318.1| Platynereis dumerilii EST IB0AAA22CF02EM1 44 0.45
100emb|CT033317.1| Platynereis dumerilii EST IB0AAA22CF02FM1 44 0.45
101emb|CT032495.1| Platynereis dumerilii EST IB0AAA37BF03EM1 44 0.45
102emb|CT032494.1| Platynereis dumerilii EST IB0AAA37BF03FM1 44 0.45
103gb|BT016765.1| Zea mays clone Contig598 mRNA sequence 42 1.8
104ref|XM_609695.2| PREDICTED: Bos taurus similar to Nascent polype... 42 1.8
105gb|AC079440.38| Mus musculus strain 129/Sv clone ct7-340l7 map 2... 42 1.8
106gb|AC083797.16| Homo sapiens 3 BAC RP11-114A6 (Roswell Park Canc... 42 1.8
107emb|AL954374.4| Mouse DNA sequence from clone RP23-445A5 on chro... 42 1.8
108gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome 42 1.8
109gb|AY103873.1| Zea mays PCO094039 mRNA sequence 42 1.8
110gb|AC091499.2| Drosophila melanogaster clone BACR33L22, complete... 40 7.1
111gb|BT012765.1| Lycopersicon esculentum clone 113714F, mRNA sequence 40 7.1
112gb|AC161217.7| Mus musculus chromosome 8, clone RP23-80D9, compl... 40 7.1
113ref|XM_883486.1| Leishmania major strain Friedlin nascent polype... 40 7.1
114emb|AL139794.3|LMFLCHR4B Leishmania major Friedlin chromosome 4,... 40 7.1
115ref|XM_847221.1| PREDICTED: Canis familiaris similar to nascent ... 40 7.1
116gb|AC114819.4| Mus musculus BAC clone RP23-52J20 from chromosome... 40 7.1
117gb|AC117211.3| Mus musculus BAC clone RP23-287M3 from 3, complet... 40 7.1
118emb|CR688321.2|CNS0FU25 Tetraodon nigroviridis full-length cDNA 40 7.1
119emb|CR686631.2|CNS0FSR7 Tetraodon nigroviridis full-length cDNA 40 7.1
120emb|X04891.1|TN21TNPA Transposon Tn21 tnpA gene for transposase 40 7.1
121emb|BX927338.6| Zebrafish DNA sequence from clone CH211-223O15 i... 40 7.1
122ref|NM_165950.1| Drosophila melanogaster Nascent polypeptide ass... 40 7.1
123ref|NM_134312.2| Drosophila melanogaster Nascent polypeptide ass... 40 7.1
124ref|NM_057868.3| Drosophila melanogaster Nascent polypeptide ass... 40 7.1
125gb|AY075332.1| Drosophila melanogaster GH11940 full length cDNA 40 7.1
126gb|AC018695.6| Homo sapiens BAC clone RP11-568J23 from 16, compl... 40 7.1
127gb|AC154213.3| Mus musculus BAC clone RP24-120I12 from chromosom... 40 7.1
128gb|AE003821.4| Drosophila melanogaster chromosome 2R, section 29... 40 7.1
129gb|AF017783.2|AF017783 Drosophila melanogaster alpha NAC, diacyl... 40 7.1
130emb|AL845306.9| Zebrafish DNA sequence from clone DKEY-217M5 in ... 40 7.1
131gb|AY109787.1| Zea mays CL9345_1 mRNA sequence 40 7.1
132gb|AC007453.1|AC007453 Drosophila melanogaster, chromosome 2R, r... 40 7.1
133dbj|AP001690.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 7.1
134emb|BX255901.3| Mouse DNA sequence from clone RP23-200D14 on chr... 40 7.1
135emb|Y08969.1|DMNACPRAL D.melanogaster mRNA for NAC protein alpha... 40 7.1
136dbj|AP000954.2| Homo sapiens genomic DNA, chromosome 21q21.1-q21... 40 7.1

>ref|XM_475153.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 618

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 125/151 (82%), Gaps = 3/151 (1%)
 Strand = Plus / Minus

                                                                       
Query: 140 tccatgatggcgctgacgatgtcgccatccgcagccttgagcgactccacagccctggat 199
           |||||||||||  |||||||||||||||  ||||||||||| | || ||| ||| |||| 
Sbjct: 605 tccatgatggctgtgacgatgtcgccattggcagccttgagtgccttcaccgccttggac 546

                                                                       
Query: 200 ctcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtcaacaccagtctca 259
           |||||||||| ||||||  ||||||| ||||||| |||||||   || ||||||||||| 
Sbjct: 545 ctcgacacggtggcctgggtcatcaccagctcgatgtccttcggctcgacaccagtctcg 486

                                          
Query: 260 tcga---tctcctcatcgtcctgggctgctg 287
           ||||    ||| ||||| |||||||||||||
Sbjct: 485 tcgacggcctcatcatcttcctgggctgctg 455



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 468 tcttgctctttttgatagttacacggttcacaccagtaatggccttcatgccaagctt 525
           |||||||||| |||| ||| |||||| |||||||||| || | |||||||||||||||
Sbjct: 280 tcttgctcttcttgacagtaacacggctcacaccagtgatagacttcatgccaagctt 223



to top

>gb|AC119289.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0025P09,
              complete sequence
          Length = 167318

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 125/151 (82%), Gaps = 3/151 (1%)
 Strand = Plus / Minus

                                                                          
Query: 140    tccatgatggcgctgacgatgtcgccatccgcagccttgagcgactccacagccctggat 199
              |||||||||||  |||||||||||||||  ||||||||||| | || ||| ||| |||| 
Sbjct: 129674 tccatgatggctgtgacgatgtcgccattggcagccttgagtgccttcaccgccttggac 129615

                                                                          
Query: 200    ctcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtcaacaccagtctca 259
              |||||||||| ||||||  ||||||| ||||||| |||||||   || ||||||||||| 
Sbjct: 129614 ctcgacacggtggcctgggtcatcaccagctcgatgtccttcggctcgacaccagtctcg 129555

                                             
Query: 260    tcga---tctcctcatcgtcctgggctgctg 287
              ||||    ||| ||||| |||||||||||||
Sbjct: 129554 tcgacggcctcatcatcttcctgggctgctg 129524



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                        
Query: 468    tcttgctctttttgatagttacacggttcacaccagtaatggccttcatgccaagctt 525
              |||||||||| |||| ||| |||||| |||||||||| || | |||||||||||||||
Sbjct: 129257 tcttgctcttcttgacagtaacacggctcacaccagtgatagacttcatgccaagctt 129200



to top

>gb|AC108874.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
           OJ1005_E12, complete sequence
          Length = 121293

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 125/151 (82%), Gaps = 3/151 (1%)
 Strand = Plus / Minus

                                                                       
Query: 140 tccatgatggcgctgacgatgtcgccatccgcagccttgagcgactccacagccctggat 199
           |||||||||||  |||||||||||||||  ||||||||||| | || ||| ||| |||| 
Sbjct: 469 tccatgatggctgtgacgatgtcgccattggcagccttgagtgccttcaccgccttggac 410

                                                                       
Query: 200 ctcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtcaacaccagtctca 259
           |||||||||| ||||||  ||||||| ||||||| |||||||   || ||||||||||| 
Sbjct: 409 ctcgacacggtggcctgggtcatcaccagctcgatgtccttcggctcgacaccagtctcg 350

                                          
Query: 260 tcga---tctcctcatcgtcctgggctgctg 287
           ||||    ||| ||||| |||||||||||||
Sbjct: 349 tcgacggcctcatcatcttcctgggctgctg 319



to top

>dbj|AB110178.1| Oryza sativa (japonica cultivar-group) mRNA for nascent polypeptide
           associated complex alpha chain, complete cds, clone:
           13YPG044
          Length = 878

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 125/151 (82%), Gaps = 3/151 (1%)
 Strand = Plus / Minus

                                                                       
Query: 140 tccatgatggcgctgacgatgtcgccatccgcagccttgagcgactccacagccctggat 199
           |||||||||||  |||||||||||||||  ||||||||||| | || ||| ||| |||| 
Sbjct: 622 tccatgatggctgtgacgatgtcgccattggcagccttgagtgccttcaccgccttggac 563

                                                                       
Query: 200 ctcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtcaacaccagtctca 259
           |||||||||| ||||||  ||||||| ||||||| |||||||   || ||||||||||| 
Sbjct: 562 ctcgacacggtggcctgggtcatcaccagctcgatgtccttcggctcgacaccagtctcg 503

                                          
Query: 260 tcga---tctcctcatcgtcctgggctgctg 287
           ||||    ||| ||||| |||||||||||||
Sbjct: 502 tcgacggcctcatcatcttcctgggctgctg 472



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 468 tcttgctctttttgatagttacacggttcacaccagtaatggccttcatgccaagctt 525
           |||||||||| |||| ||| |||||| |||||||||| || | |||||||||||||||
Sbjct: 297 tcttgctcttcttgacagtaacacggctcacaccagtgatagacttcatgccaagctt 240



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 125/151 (82%), Gaps = 3/151 (1%)
 Strand = Plus / Minus

                                                                            
Query: 140      tccatgatggcgctgacgatgtcgccatccgcagccttgagcgactccacagccctggat 199
                |||||||||||  |||||||||||||||  ||||||||||| | || ||| ||| |||| 
Sbjct: 17869720 tccatgatggctgtgacgatgtcgccattggcagccttgagtgccttcaccgccttggac 17869661

                                                                            
Query: 200      ctcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtcaacaccagtctca 259
                |||||||||| ||||||  ||||||| ||||||| |||||||   || ||||||||||| 
Sbjct: 17869660 ctcgacacggtggcctgggtcatcaccagctcgatgtccttcggctcgacaccagtctcg 17869601

                                               
Query: 260      tcga---tctcctcatcgtcctgggctgctg 287
                ||||    ||| ||||| |||||||||||||
Sbjct: 17869600 tcgacggcctcatcatcttcctgggctgctg 17869570



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                          
Query: 468      tcttgctctttttgatagttacacggttcacaccagtaatggccttcatgccaagctt 525
                |||||||||| |||| ||| |||||| |||||||||| || | |||||||||||||||
Sbjct: 17869303 tcttgctcttcttgacagtaacacggctcacaccagtgatagacttcatgccaagctt 17869246



to top

>dbj|AK058906.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-008-D09, full
           insert sequence
          Length = 930

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 125/151 (82%), Gaps = 3/151 (1%)
 Strand = Plus / Minus

                                                                       
Query: 140 tccatgatggcgctgacgatgtcgccatccgcagccttgagcgactccacagccctggat 199
           |||||||||||  |||||||||||||||  ||||||||||| | || ||| ||| |||| 
Sbjct: 684 tccatgatggctgtgacgatgtcgccattggcagccttgagtgccttcaccgccttggac 625

                                                                       
Query: 200 ctcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtcaacaccagtctca 259
           |||||||||| ||||||  ||||||| ||||||| |||||||   || ||||||||||| 
Sbjct: 624 ctcgacacggtggcctgggtcatcaccagctcgatgtccttcggctcgacaccagtctcg 565

                                          
Query: 260 tcga---tctcctcatcgtcctgggctgctg 287
           ||||    ||| ||||| |||||||||||||
Sbjct: 564 tcgacggcctcatcatcttcctgggctgctg 534



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 468 tcttgctctttttgatagttacacggttcacaccagtaatggccttcatgccaagctt 525
           |||||||||| |||| ||| |||||| |||||||||| || | |||||||||||||||
Sbjct: 359 tcttgctcttcttgacagtaacacggctcacaccagtgatagacttcatgccaagctt 302



to top

>ref|NM_190087.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 609

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Minus

                                                                       
Query: 380 tcctcgagcttaacctccccgaacatgacataggtttctgagcgcgagctcttgaagaca 439
           ||||||| |||  |||| ||||| ||||| ||||| ||||||   | |||||||||||||
Sbjct: 362 tcctcgatcttcgcctcaccgaagatgacgtaggtgtctgagtttgggctcttgaagaca 303

                                                                       
Query: 440 tctggcttggagaggacatacgtcaccgtcttgctctttttgatagttacacggttcaca 499
           ||||| || |||| |||  ||   |   ||||||||||||||||||| |||||| |||||
Sbjct: 302 tctggtttagagatgacgaacagaatgttcttgctctttttgatagtgacacggctcaca 243

                                  
Query: 500 ccagtaatggccttcatgccaag 522
           ||||| |||| ||||||||||||
Sbjct: 242 ccagtgatggtcttcatgccaag 220



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 131/162 (80%)
 Strand = Plus / Minus

                                                                       
Query: 127 ctagttagtcaactccatgatggcgctgacgatgtcgccatccgcagccttgagcgactc 186
           |||||| |||| ||||||||||||  |||| ||||| || |  |||||||| |||| || 
Sbjct: 609 ctagttcgtcagctccatgatggcagtgacaatgtcaccgttagcagccttcagcgcctt 550

                                                                       
Query: 187 cacagccctggatctcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtc 246
           ||| ||||| ||||||||||||| ||||||  ||||||| || || | |||||||   ||
Sbjct: 549 caccgccctcgatctcgacacggtggcctgtgtcatcaccagttcaatgtccttcggctc 490

                                                     
Query: 247 aacaccagtctcatcgatctcctcatcgtcctgggctgctgc 288
            || |||| |||||||| |||||| || ||||| ||||||||
Sbjct: 489 gacgccagactcatcgacctcctcgtcatcctgagctgctgc 448



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 51/55 (92%)
 Strand = Plus / Minus

                                                                       
Query: 468      tcttgctctttttgatagttacacggttcacaccagtaatggccttcatgccaag 522
                ||||||||||||||||||| |||||| |||||||||| |||| ||||||||||||
Sbjct: 41208715 tcttgctctttttgatagtgacacggctcacaccagtgatggtcttcatgccaag 41208661



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 131/162 (80%)
 Strand = Plus / Minus

                                                                            
Query: 127      ctagttagtcaactccatgatggcgctgacgatgtcgccatccgcagccttgagcgactc 186
                |||||| |||| ||||||||||||  |||| ||||| || |  |||||||| |||| || 
Sbjct: 41209147 ctagttcgtcagctccatgatggcagtgacaatgtcaccgttagcagccttcagcgcctt 41209088

                                                                            
Query: 187      cacagccctggatctcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtc 246
                ||| ||||| ||||||||||||| ||||||  ||||||| || || | |||||||   ||
Sbjct: 41209087 caccgccctcgatctcgacacggtggcctgtgtcatcaccagttcaatgtccttcggctc 41209028

                                                          
Query: 247      aacaccagtctcatcgatctcctcatcgtcctgggctgctgc 288
                 || |||| |||||||| |||||| || ||||| ||||||||
Sbjct: 41209027 gacgccagactcatcgacctcctcgtcatcctgagctgctgc 41208986



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                            
Query: 380      tcctcgagcttaacctccccgaacatgacataggtttctgagcgcgagctcttgaagaca 439
                ||||||| |||  |||| ||||| ||||| ||||| ||||||   | |||||||||||||
Sbjct: 41208900 tcctcgatcttcgcctcaccgaagatgacgtaggtgtctgagtttgggctcttgaagaca 41208841

                     
Query: 440      tctgg 444
                |||||
Sbjct: 41208840 tctgg 41208836



to top

>dbj|AP003412.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1150F11
          Length = 130355

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 51/55 (92%)
 Strand = Plus / Minus

                                                                    
Query: 468   tcttgctctttttgatagttacacggttcacaccagtaatggccttcatgccaag 522
             ||||||||||||||||||| |||||| |||||||||| |||| ||||||||||||
Sbjct: 25630 tcttgctctttttgatagtgacacggctcacaccagtgatggtcttcatgccaag 25576



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 131/162 (80%)
 Strand = Plus / Minus

                                                                         
Query: 127   ctagttagtcaactccatgatggcgctgacgatgtcgccatccgcagccttgagcgactc 186
             |||||| |||| ||||||||||||  |||| ||||| || |  |||||||| |||| || 
Sbjct: 26062 ctagttcgtcagctccatgatggcagtgacaatgtcaccgttagcagccttcagcgcctt 26003

                                                                         
Query: 187   cacagccctggatctcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtc 246
             ||| ||||| ||||||||||||| ||||||  ||||||| || || | |||||||   ||
Sbjct: 26002 caccgccctcgatctcgacacggtggcctgtgtcatcaccagttcaatgtccttcggctc 25943

                                                       
Query: 247   aacaccagtctcatcgatctcctcatcgtcctgggctgctgc 288
              || |||| |||||||| |||||| || ||||| ||||||||
Sbjct: 25942 gacgccagactcatcgacctcctcgtcatcctgagctgctgc 25901



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                         
Query: 380   tcctcgagcttaacctccccgaacatgacataggtttctgagcgcgagctcttgaagaca 439
             ||||||| |||  |||| ||||| ||||| ||||| ||||||   | |||||||||||||
Sbjct: 25815 tcctcgatcttcgcctcaccgaagatgacgtaggtgtctgagtttgggctcttgaagaca 25756

                  
Query: 440   tctgg 444
             |||||
Sbjct: 25755 tctgg 25751



to top

>dbj|AP003269.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0504E02
          Length = 137468

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 51/55 (92%)
 Strand = Plus / Minus

                                                                     
Query: 468    tcttgctctttttgatagttacacggttcacaccagtaatggccttcatgccaag 522
              ||||||||||||||||||| |||||| |||||||||| |||| ||||||||||||
Sbjct: 105770 tcttgctctttttgatagtgacacggctcacaccagtgatggtcttcatgccaag 105716



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 131/162 (80%)
 Strand = Plus / Minus

                                                                          
Query: 127    ctagttagtcaactccatgatggcgctgacgatgtcgccatccgcagccttgagcgactc 186
              |||||| |||| ||||||||||||  |||| ||||| || |  |||||||| |||| || 
Sbjct: 106202 ctagttcgtcagctccatgatggcagtgacaatgtcaccgttagcagccttcagcgcctt 106143

                                                                          
Query: 187    cacagccctggatctcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtc 246
              ||| ||||| ||||||||||||| ||||||  ||||||| || || | |||||||   ||
Sbjct: 106142 caccgccctcgatctcgacacggtggcctgtgtcatcaccagttcaatgtccttcggctc 106083

                                                        
Query: 247    aacaccagtctcatcgatctcctcatcgtcctgggctgctgc 288
               || |||| |||||||| |||||| || ||||| ||||||||
Sbjct: 106082 gacgccagactcatcgacctcctcgtcatcctgagctgctgc 106041



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                          
Query: 380    tcctcgagcttaacctccccgaacatgacataggtttctgagcgcgagctcttgaagaca 439
              ||||||| |||  |||| ||||| ||||| ||||| ||||||   | |||||||||||||
Sbjct: 105955 tcctcgatcttcgcctcaccgaagatgacgtaggtgtctgagtttgggctcttgaagaca 105896

                   
Query: 440    tctgg 444
              |||||
Sbjct: 105895 tctgg 105891



to top

>dbj|AK109341.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-202-F04, full
           insert sequence
          Length = 909

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Minus

                                                                       
Query: 380 tcctcgagcttaacctccccgaacatgacataggtttctgagcgcgagctcttgaagaca 439
           ||||||| |||  |||| ||||| ||||| ||||| ||||||   | |||||||||||||
Sbjct: 474 tcctcgatcttcgcctcaccgaagatgacgtaggtgtctgagtttgggctcttgaagaca 415

                                                                       
Query: 440 tctggcttggagaggacatacgtcaccgtcttgctctttttgatagttacacggttcaca 499
           ||||| || |||| |||  ||   |   ||||||||||||||||||| |||||| |||||
Sbjct: 414 tctggtttagagatgacgaacagaatgttcttgctctttttgatagtgacacggctcaca 355

                                  
Query: 500 ccagtaatggccttcatgccaag 522
           ||||| |||| ||||||||||||
Sbjct: 354 ccagtgatggtcttcatgccaag 332



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 131/162 (80%)
 Strand = Plus / Minus

                                                                       
Query: 127 ctagttagtcaactccatgatggcgctgacgatgtcgccatccgcagccttgagcgactc 186
           |||||| |||| ||||||||||||  |||| ||||| || |  |||||||| |||| || 
Sbjct: 721 ctagttcgtcagctccatgatggcagtgacaatgtcaccgttagcagccttcagcgcctt 662

                                                                       
Query: 187 cacagccctggatctcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtc 246
           ||| ||||| ||||||||||||| ||||||  ||||||| || || | |||||||   ||
Sbjct: 661 caccgccctcgatctcgacacggtggcctgtgtcatcaccagttcaatgtccttcggctc 602

                                                     
Query: 247 aacaccagtctcatcgatctcctcatcgtcctgggctgctgc 288
            || |||| |||||||| |||||| || ||||| ||||||||
Sbjct: 601 gacgccagactcatcgacctcctcgtcatcctgagctgctgc 560



to top

>dbj|AK101971.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033076L24, full
           insert sequence
          Length = 976

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Minus

                                                                       
Query: 380 tcctcgagcttaacctccccgaacatgacataggtttctgagcgcgagctcttgaagaca 439
           ||||||| |||  |||| ||||| ||||| ||||| ||||||   | |||||||||||||
Sbjct: 453 tcctcgatcttcgcctcaccgaagatgacgtaggtgtctgagtttgggctcttgaagaca 394

                                                                       
Query: 440 tctggcttggagaggacatacgtcaccgtcttgctctttttgatagttacacggttcaca 499
           ||||| || |||| |||  ||   |   ||||||||||||||||||| |||||| |||||
Sbjct: 393 tctggtttagagatgacgaacagaatgttcttgctctttttgatagtgacacggctcaca 334

                                  
Query: 500 ccagtaatggccttcatgccaag 522
           ||||| |||| ||||||||||||
Sbjct: 333 ccagtgatggtcttcatgccaag 311



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 130/162 (80%)
 Strand = Plus / Minus

                                                                       
Query: 127 ctagttagtcaactccatgatggcgctgacgatgtcgccatccgcagccttgagcgactc 186
           |||||| |||| ||||||||||||  |||| ||||| || |  |||||||| |||| || 
Sbjct: 700 ctagttcgtcagctccatgatggcagtgacaatgtcaccgttagcagccttcagcgcctt 641

                                                                       
Query: 187 cacagccctggatctcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtc 246
           ||| ||||| ||||||||||||| ||||||  ||||||| || || | |||||||   ||
Sbjct: 640 caccgccctcgatctcgacacggtggcctgtgtcatcaccagttcaatgtccttcggctc 581

                                                     
Query: 247 aacaccagtctcatcgatctcctcatcgtcctgggctgctgc 288
            || |||| |||||||| | |||| || ||||| ||||||||
Sbjct: 580 gacgccagactcatcgaccccctcgtcatcctgagctgctgc 539



to top

>dbj|AK070627.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023055N09, full
            insert sequence
          Length = 3171

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Minus

                                                                        
Query: 380  tcctcgagcttaacctccccgaacatgacataggtttctgagcgcgagctcttgaagaca 439
            ||||||| |||  |||| ||||| ||||| ||||| ||||||   | |||||||||||||
Sbjct: 2732 tcctcgatcttcgcctcaccgaagatgacgtaggtgtctgagtttgggctcttgaagaca 2673

                                                                        
Query: 440  tctggcttggagaggacatacgtcaccgtcttgctctttttgatagttacacggttcaca 499
            ||||| || |||| |||  ||   |   ||||||||||||||||||| |||||| |||||
Sbjct: 2672 tctggtttagagatgacgaacagaatgttcttgctctttttgatagtgacacggctcaca 2613

                                   
Query: 500  ccagtaatggccttcatgccaag 522
            ||||| |||| ||||||||||||
Sbjct: 2612 ccagtgatggtcttcatgccaag 2590



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 131/162 (80%)
 Strand = Plus / Minus

                                                                        
Query: 127  ctagttagtcaactccatgatggcgctgacgatgtcgccatccgcagccttgagcgactc 186
            |||||| |||| ||||||||||||  |||| ||||| || |  |||||||| |||| || 
Sbjct: 2979 ctagttcgtcagctccatgatggcagtgacaatgtcaccgttagcagccttcagcgcctt 2920

                                                                        
Query: 187  cacagccctggatctcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtc 246
            ||| ||||| ||||||||||||| ||||||  ||||||| || || | |||||||   ||
Sbjct: 2919 caccgccctcgatctcgacacggtggcctgtgtcatcaccagttcaatgtccttcggctc 2860

                                                      
Query: 247  aacaccagtctcatcgatctcctcatcgtcctgggctgctgc 288
             || |||| |||||||| |||||| || ||||| ||||||||
Sbjct: 2859 gacgccagactcatcgacctcctcgtcatcctgagctgctgc 2818



to top

>dbj|AK059437.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-G10, full
           insert sequence
          Length = 873

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Minus

                                                                       
Query: 380 tcctcgagcttaacctccccgaacatgacataggtttctgagcgcgagctcttgaagaca 439
           ||||||| |||  |||| ||||| ||||| ||||| ||||||   | |||||||||||||
Sbjct: 452 tcctcgatcttcgcctcaccgaagatgacgtaggtgtctgagtttgggctcttgaagaca 393

                                                                       
Query: 440 tctggcttggagaggacatacgtcaccgtcttgctctttttgatagttacacggttcaca 499
           ||||| || |||| |||  ||   |   ||||||||||||||||||| |||||| |||||
Sbjct: 392 tctggtttagagatgacgaacagaatgttcttgctctttttgatagtgacacggctcaca 333

                                  
Query: 500 ccagtaatggccttcatgccaag 522
           ||||| |||| ||||||||||||
Sbjct: 332 ccagtgatggtcttcatgccaag 310



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 125/155 (80%)
 Strand = Plus / Minus

                                                                       
Query: 134 gtcaactccatgatggcgctgacgatgtcgccatccgcagccttgagcgactccacagcc 193
           |||| ||||||||||||  |||| ||||| || |  |||||||| |||| || ||| |||
Sbjct: 692 gtcagctccatgatggcagtgacaatgtcaccgttagcagccttcagcgccttcaccgcc 633

                                                                       
Query: 194 ctggatctcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtcaacacca 253
           || ||||||||||||| ||||||  ||||||| || || | |||||||   || || |||
Sbjct: 632 ctcgatctcgacacggtggcctgtgtcatcaccagttcaatgtccttcggctcgacgcca 573

                                              
Query: 254 gtctcatcgatctcctcatcgtcctgggctgctgc 288
           | |||||||| |||||| || ||||| ||||||||
Sbjct: 572 gactcatcgacctcctcgtcatcctgagctgctgc 538



to top

>ref|NM_114807.2| Arabidopsis thaliana unknown protein AT3G49470 mRNA, complete cds
          Length = 938

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 61/73 (83%)
 Strand = Plus / Minus

                                                                       
Query: 380 tcctcgagcttaacctccccgaacatgacataggtttctgagcgcgagctcttgaagaca 439
           ||||||| |||  |||| ||||| || ||||||||||||||  ||| |||||| ||||||
Sbjct: 472 tcctcgatcttggcctcaccgaatataacataggtttctgaatgcgggctcttaaagaca 413

                        
Query: 440 tctggcttggaga 452
           || ||||| ||||
Sbjct: 412 tcaggcttagaga 400



to top

>emb|AL132964.2|ATT9C5 Arabidopsis thaliana DNA chromosome 3, BAC clone T9C5
          Length = 104204

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 61/73 (83%)
 Strand = Plus / Minus

                                                                         
Query: 380   tcctcgagcttaacctccccgaacatgacataggtttctgagcgcgagctcttgaagaca 439
             ||||||| |||  |||| ||||| || ||||||||||||||  ||| |||||| ||||||
Sbjct: 17660 tcctcgatcttggcctcaccgaatataacataggtttctgaatgcgggctcttaaagaca 17601

                          
Query: 440   tctggcttggaga 452
             || ||||| ||||
Sbjct: 17600 tcaggcttagaga 17588



to top

>gb|AY072536.1| Arabidopsis thaliana alpha NAC-like protein (At3g49470; T9C5.70)
           mRNA, complete cds
          Length = 706

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 61/73 (83%)
 Strand = Plus / Minus

                                                                       
Query: 380 tcctcgagcttaacctccccgaacatgacataggtttctgagcgcgagctcttgaagaca 439
           ||||||| |||  |||| ||||| || ||||||||||||||  ||| |||||| ||||||
Sbjct: 389 tcctcgatcttggcctcaccgaatataacataggtttctgaatgcgggctcttaaagaca 330

                        
Query: 440 tctggcttggaga 452
           || ||||| ||||
Sbjct: 329 tcaggcttagaga 317



to top

>gb|AF370545.1|AF370545 Arabidopsis thaliana alpha NAC-like protein (T9C5.70) mRNA,
           complete cds
          Length = 966

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 61/73 (83%)
 Strand = Plus / Minus

                                                                       
Query: 380 tcctcgagcttaacctccccgaacatgacataggtttctgagcgcgagctcttgaagaca 439
           ||||||| |||  |||| ||||| || ||||||||||||||  ||| |||||| ||||||
Sbjct: 472 tcctcgatcttggcctcaccgaatataacataggtttctgaatgcgggctcttaaagaca 413

                        
Query: 440 tctggcttggaga 452
           || ||||| ||||
Sbjct: 412 tcaggcttagaga 400



to top

>emb|BX825921.1|CNS0A553 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL72ZG01 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 923

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 61/73 (83%)
 Strand = Plus / Minus

                                                                       
Query: 380 tcctcgagcttaacctccccgaacatgacataggtttctgagcgcgagctcttgaagaca 439
           ||||||| |||  |||| ||||| || ||||||||||||||  ||| |||||| ||||||
Sbjct: 450 tcctcgatcttggcctcaccgaatataacataggtttctgaatgcgggctcttaaagaca 391

                        
Query: 440 tctggcttggaga 452
           || ||||| ||||
Sbjct: 390 tcaggcttagaga 378



to top

>gb|AC012329.5|AC012329 Arabidopsis thaliana chromosome 1 BAC T1G12 genomic sequence, complete
             sequence
          Length = 80367

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 61/73 (83%)
 Strand = Plus / Minus

                                                                         
Query: 380   tcctcgagcttaacctccccgaacatgacataggtttctgagcgcgagctcttgaagaca 439
             ||||||| |||  |||| ||||| || ||||||||||||||  ||| |||||| ||||||
Sbjct: 62800 tcctcgatcttggcctcaccgaatataacataggtttctgaatgcgggctcttaaagaca 62741

                          
Query: 440   tctggcttggaga 452
             || ||||| ||||
Sbjct: 62740 tcaggcttagaga 62728



to top

>gb|BT016475.1| Zea mays clone Contig308 mRNA sequence
          Length = 891

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 116/147 (78%)
 Strand = Plus / Minus

                                                                       
Query: 379 gtcctcgagcttaacctccccgaacatgacataggtttctgagcgcgagctcttgaagac 438
           |||||||| |||  |||| ||||| ||||||||||| || |||   | ||||||||| ||
Sbjct: 441 gtcctcgatcttcgcctcgccgaatatgacataggtgtccgagtttgggctcttgaacac 382

                                                                       
Query: 439 atctggcttggagaggacatacgtcaccgtcttgctctttttgatagttacacggttcac 498
           ||||||||| |||| |||| |   ||   ||||||| || || | ||| || ||| | ||
Sbjct: 381 atctggcttcgagatgacaaaaagcatattcttgcttttcttcacagtgacccggctgac 322

                                      
Query: 499 accagtaatggccttcatgccaagctt 525
           |||||| |||| |||||||||||||||
Sbjct: 321 accagtgatgggcttcatgccaagctt 295



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 334 cttgaactgctctgccgcttgtgtctgcag 363
           ||||||||||||||| ||||| ||||||||
Sbjct: 483 cttgaactgctctgcagcttgggtctgcag 454



to top

>gb|AY231744.1| Drosophila yakuba clone yak-em_Nacalpha mRNA sequence
          Length = 198

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 132 tagtcaactccatgatggcgctgacgatgtc 162
           |||||| ||||||||||||| ||||||||||
Sbjct: 193 tagtcagctccatgatggcgttgacgatgtc 163



to top

>gb|BC091311.1| Rattus norvegicus hypothetical protein LOC289786, mRNA (cDNA clone
            IMAGE:7311803), partial cds
          Length = 1864

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 427  gctcttgaagacatctggcttgg 449
            |||||||||||||||||||||||
Sbjct: 1447 gctcttgaagacatctggcttgg 1425



to top

>ref|XM_214092.3| PREDICTED: Rattus norvegicus similar to mKIAA0363 protein
            (LOC289786), mRNA
          Length = 4028

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 427  gctcttgaagacatctggcttgg 449
            |||||||||||||||||||||||
Sbjct: 3633 gctcttgaagacatctggcttgg 3611



to top

>gb|AF220200.1|AF220200 Pinus taeda nascent polypeptide associated complex alpha chain
           mRNA, complete cds
          Length = 1057

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 334 cttgaactgctctgccgcttgtgtctg 360
           ||||||||||||||| |||||||||||
Sbjct: 489 cttgaactgctctgcagcttgtgtctg 463



to top

>ref|NM_112074.2| Arabidopsis thaliana unknown protein AT3G12390 mRNA, complete cds
          Length = 884

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 468 tcttgctctttttgatagttacacggttcacaccagtaatggccttcatgccaagctt 525
           |||||||||||||||  || || ||| | |||||||| ||||  ||||||||||||||
Sbjct: 356 tcttgctctttttgacggtgactcggctaacaccagtgatgggtttcatgccaagctt 299



to top

>gb|AY522625.1| Oreochromis mossambicus nascent polypeptide-associated complex
           alpha polypeptide-like mRNA, partial sequence
          Length = 461

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           |||||||||||||||||  |||||||||||
Sbjct: 348 gtcaactccatgatggcattgacgatgtcg 319



to top

>emb|CR712159.2|CNS0GCGB Tetraodon nigroviridis full-length cDNA
          Length = 750

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618



to top

>emb|CR722249.2|CNS0GK8F Tetraodon nigroviridis full-length cDNA
          Length = 754

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 645 gtcaattccatgatggcgttgacgatgtcg 616



to top

>emb|CR722169.2|CNS0GK67 Tetraodon nigroviridis full-length cDNA
          Length = 1366

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 134  gtcaactccatgatggcgctgacgatgtcg 163
            ||||| |||||||||||| |||||||||||
Sbjct: 1263 gtcaattccatgatggcgttgacgatgtcg 1234



to top

>emb|CR717966.2|CNS0GGXG Tetraodon nigroviridis full-length cDNA
          Length = 755

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618



to top

>emb|CR717497.2|CNS0GGKF Tetraodon nigroviridis full-length cDNA
          Length = 456

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 347 gtcaattccatgatggcgttgacgatgtcg 318



to top

>emb|CR716901.2|CNS0GG3Y Tetraodon nigroviridis full-length cDNA
          Length = 750

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618



to top

>emb|CR716022.2|CNS0GFFM Tetraodon nigroviridis full-length cDNA
          Length = 520

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 411 gtcaattccatgatggcgttgacgatgtcg 382



to top

>emb|CR715618.2|CNS0GF4E Tetraodon nigroviridis full-length cDNA
          Length = 453

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 349 gtcaattccatgatggcgttgacgatgtcg 320



to top

>emb|CR715460.2|CNS0GF00 Tetraodon nigroviridis full-length cDNA
          Length = 755

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618



to top

>emb|CR714862.2|CNS0GEJE Tetraodon nigroviridis full-length cDNA
          Length = 754

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 646 gtcaattccatgatggcgttgacgatgtcg 617



to top

>emb|CR714224.2|CNS0GE1O Tetraodon nigroviridis full-length cDNA
          Length = 757

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618



to top

>emb|CR712921.2|CNS0GD1H Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618



to top

>emb|CR712868.2|CNS0GD00 Tetraodon nigroviridis full-length cDNA
          Length = 751

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618



to top

>emb|CR710910.2|CNS0GBHM Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618



to top

>emb|CR710585.2|CNS0GB8L Tetraodon nigroviridis full-length cDNA
          Length = 754

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618



to top

>emb|CR709573.2|CNS0GAGH Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 411 gtcaattccatgatggcgttgacgatgtcg 382



to top

>emb|CR706444.2|CNS0G81K Tetraodon nigroviridis full-length cDNA
          Length = 755

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618



to top

>emb|CR704473.2|CNS0G6IT Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 354 gtcaattccatgatggcgttgacgatgtcg 325



to top

>emb|CR702894.2|CNS0G5AY Tetraodon nigroviridis full-length cDNA
          Length = 1294

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 134  gtcaactccatgatggcgctgacgatgtcg 163
            ||||| |||||||||||| |||||||||||
Sbjct: 1184 gtcaattccatgatggcgttgacgatgtcg 1155



to top

>emb|CR702653.2|CNS0G549 Tetraodon nigroviridis full-length cDNA
          Length = 1355

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 134  gtcaactccatgatggcgctgacgatgtcg 163
            ||||| |||||||||||| |||||||||||
Sbjct: 1261 gtcaattccatgatggcgttgacgatgtcg 1232



to top

>emb|CR702124.2|CNS0G4PK Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 354 gtcaattccatgatggcgttgacgatgtcg 325



to top

>emb|CR701979.2|CNS0G4LJ Tetraodon nigroviridis full-length cDNA
          Length = 750

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618



to top

>emb|CR701629.2|CNS0G4BT Tetraodon nigroviridis full-length cDNA
          Length = 1355

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 134  gtcaactccatgatggcgctgacgatgtcg 163
            ||||| |||||||||||| |||||||||||
Sbjct: 1258 gtcaattccatgatggcgttgacgatgtcg 1229



to top

>emb|CR699096.2|CNS0G2DG Tetraodon nigroviridis full-length cDNA
          Length = 1361

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 134  gtcaactccatgatggcgctgacgatgtcg 163
            ||||| |||||||||||| |||||||||||
Sbjct: 1264 gtcaattccatgatggcgttgacgatgtcg 1235



to top

>emb|CR698619.2|CNS0G207 Tetraodon nigroviridis full-length cDNA
          Length = 655

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 551 gtcaattccatgatggcgttgacgatgtcg 522



to top

>emb|CR698352.2|CNS0G1SS Tetraodon nigroviridis full-length cDNA
          Length = 1052

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 646 gtcaattccatgatggcgttgacgatgtcg 617



to top

>emb|CR697288.2|CNS0G0Z8 Tetraodon nigroviridis full-length cDNA
          Length = 1362

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 134  gtcaactccatgatggcgctgacgatgtcg 163
            ||||| |||||||||||| |||||||||||
Sbjct: 1260 gtcaattccatgatggcgttgacgatgtcg 1231



to top

>emb|CR696825.2|CNS0G0MD Tetraodon nigroviridis full-length cDNA
          Length = 1370

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 134  gtcaactccatgatggcgctgacgatgtcg 163
            ||||| |||||||||||| |||||||||||
Sbjct: 1261 gtcaattccatgatggcgttgacgatgtcg 1232



to top

>emb|CR696554.2|CNS0G0EU Tetraodon nigroviridis full-length cDNA
          Length = 545

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 436 gtcaattccatgatggcgttgacgatgtcg 407



to top

>emb|CR696276.2|CNS0G074 Tetraodon nigroviridis full-length cDNA
          Length = 435

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 326 gtcaattccatgatggcgttgacgatgtcg 297



to top

>emb|CR695626.2|CNS0FZP2 Tetraodon nigroviridis full-length cDNA
          Length = 1055

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 646 gtcaattccatgatggcgttgacgatgtcg 617



to top

>emb|CR695732.2|CNS0FZS0 Tetraodon nigroviridis full-length cDNA
          Length = 750

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618



to top

>emb|CR694436.2|CNS0FYS0 Tetraodon nigroviridis full-length cDNA
          Length = 1018

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 644 gtcaattccatgatggcgttgacgatgtcg 615



to top

>emb|CR688523.2|CNS0FU7R Tetraodon nigroviridis full-length cDNA
          Length = 420

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 311 gtcaattccatgatggcgttgacgatgtcg 282



to top

>emb|CR688181.2|CNS0FTY9 Tetraodon nigroviridis full-length cDNA
          Length = 981

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 648 gtcaattccatgatggcgttgacgatgtcg 619



to top

>emb|CR688138.2|CNS0FTX2 Tetraodon nigroviridis full-length cDNA
          Length = 750

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618



to top

>emb|CR687296.2|CNS0FT9O Tetraodon nigroviridis full-length cDNA
          Length = 1052

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618



to top

>emb|CR682385.2|CNS0FPH9 Tetraodon nigroviridis full-length cDNA
          Length = 1363

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 134  gtcaactccatgatggcgctgacgatgtcg 163
            ||||| |||||||||||| |||||||||||
Sbjct: 1260 gtcaattccatgatggcgttgacgatgtcg 1231



to top

>emb|CR675609.2|CNS0FK9R Tetraodon nigroviridis full-length cDNA
          Length = 707

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 606 gtcaattccatgatggcgttgacgatgtcg 577



to top

>emb|CR664046.2|CNS0FBCK Tetraodon nigroviridis full-length cDNA
          Length = 1047

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 938 gtcaattccatgatggcgttgacgatgtcg 909



to top

>emb|CR663607.2|CNS0FB0D Tetraodon nigroviridis full-length cDNA
          Length = 1200

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 134  gtcaactccatgatggcgctgacgatgtcg 163
            ||||| |||||||||||| |||||||||||
Sbjct: 1089 gtcaattccatgatggcgttgacgatgtcg 1060



to top

>emb|CR661227.2|CNS0F969 Tetraodon nigroviridis full-length cDNA
          Length = 1044

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 935 gtcaattccatgatggcgttgacgatgtcg 906



to top

>emb|CR660613.2|CNS0F8P7 Tetraodon nigroviridis full-length cDNA
          Length = 1051

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 645 gtcaattccatgatggcgttgacgatgtcg 616



to top

>emb|CR660539.2|CNS0F8N5 Tetraodon nigroviridis full-length cDNA
          Length = 948

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 839 gtcaattccatgatggcgttgacgatgtcg 810



to top

>emb|CR655127.2|CNS0F4GT Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618



to top

>emb|CR653087.2|CNS0F2W5 Tetraodon nigroviridis full-length cDNA
          Length = 750

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618



to top

>emb|CR652468.2|CNS0F2EY Tetraodon nigroviridis full-length cDNA
          Length = 749

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618



to top

>emb|CR651752.2|CNS0F1V2 Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618



to top

>emb|CR651630.2|CNS0F1RO Tetraodon nigroviridis full-length cDNA
          Length = 1056

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 648 gtcaattccatgatggcgttgacgatgtcg 619



to top

>emb|CR650255.2|CNS0F0PH Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618



to top

>emb|CR647893.2|CNS0EYVV Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618



to top

>emb|CR647713.2|CNS0EYQV Tetraodon nigroviridis full-length cDNA
          Length = 755

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618



to top

>emb|CR639196.2|CNS0ES6A Tetraodon nigroviridis full-length cDNA
          Length = 755

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618



to top

>emb|CR637873.2|CNS0ER5J Tetraodon nigroviridis full-length cDNA
          Length = 749

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618



to top

>emb|CR636835.2|CNS0EQCP Tetraodon nigroviridis full-length cDNA
          Length = 755

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618



to top

>emb|CR634963.2|CNS0EOWP Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618



to top

>emb|CR632932.2|CNS0ENCA Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618



to top

>emb|CR632678.2|CNS0EN58 Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618



to top

>emb|CR632573.2|CNS0EN2B Tetraodon nigroviridis full-length cDNA
          Length = 749

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618



to top

>emb|CR632323.2|CNS0EMVD Tetraodon nigroviridis full-length cDNA
          Length = 749

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618



to top

>emb|CR632317.2|CNS0EMV7 Tetraodon nigroviridis full-length cDNA
          Length = 755

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618



to top

>emb|CR631332.2|CNS0EM3T Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618



to top

>emb|CR631747.2|CNS0EMFD Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618



to top

>gb|AY094022.1| Arabidopsis thaliana AT3g12390/T2E22_130 mRNA, complete cds
          Length = 612

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 468 tcttgctctttttgatagttacacggttcacaccagtaatggccttcatgccaagctt 525
           |||||||||||||||  || || ||| | |||||||| ||||  ||||||||||||||
Sbjct: 271 tcttgctctttttgacggtgactcggctaacaccagtgatgggtttcatgccaagctt 214



to top

>gb|AY048232.1| Arabidopsis thaliana AT3g12390/T2E22_130 mRNA, complete cds
          Length = 861

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 468 tcttgctctttttgatagttacacggttcacaccagtaatggccttcatgccaagctt 525
           |||||||||||||||  || || ||| | |||||||| ||||  ||||||||||||||
Sbjct: 356 tcttgctctttttgacggtgactcggctaacaccagtgatgggtttcatgccaagctt 299



to top

>emb|BX824815.1|CNS0A5HP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH74ZH02 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 635

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 468 tcttgctctttttgatagttacacggttcacaccagtaatggccttcatgccaagctt 525
           |||||||||||||||  || || ||| | |||||||| ||||  ||||||||||||||
Sbjct: 121 tcttgctctttttgacggtgactcggctaacaccagtgatgggtttcatgccaagctt 64



to top

>gb|AC069474.4|AC069474 Arabidopsis thaliana chromosome 3 BAC T2E22 genomic sequence, complete
             sequence
          Length = 105768

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 49/58 (84%)
 Strand = Plus / Plus

                                                                       
Query: 468   tcttgctctttttgatagttacacggttcacaccagtaatggccttcatgccaagctt 525
             |||||||||||||||  || || ||| | |||||||| ||||  ||||||||||||||
Sbjct: 84642 tcttgctctttttgacggtgactcggctaacaccagtgatgggtttcatgccaagctt 84699



to top

>gb|AY168640.1| Oreochromis niloticus nascent polypeptide-associated complex alpha
           polypeptide (naca) mRNA, complete cds
          Length = 808

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 134 gtcaactccatgatggcgctgacgatgtcg 163
           |||||||||||||||||  |||||||||||
Sbjct: 677 gtcaactccatgatggcattgacgatgtcg 648



to top

>dbj|AP002047.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MQC3
          Length = 86536

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                       
Query: 468   tcttgctctttttgatagttacacggttcacaccagtaatggccttcatgccaagctt 525
             |||||||||||||||  || || ||| | |||||||| ||||  ||||||||||||||
Sbjct: 56823 tcttgctctttttgacggtgactcggctaacaccagtgatgggtttcatgccaagctt 56766



to top

>emb|CT033503.1| Platynereis dumerilii EST IB0AAA19AH12EM1
          Length = 813

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 245 tcaacaccagtctcatcgatctcctcatcgtcct 278
           ||||| ||||| ||||||||||||||||| ||||
Sbjct: 593 tcaactccagtgtcatcgatctcctcatcatcct 560



to top

>emb|CT033502.1| Platynereis dumerilii EST IB0AAA19AH12FM1
          Length = 655

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 245 tcaacaccagtctcatcgatctcctcatcgtcct 278
           ||||| ||||| ||||||||||||||||| ||||
Sbjct: 221 tcaactccagtgtcatcgatctcctcatcatcct 254



to top

>emb|CT033318.1| Platynereis dumerilii EST IB0AAA22CF02EM1
          Length = 798

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 245 tcaacaccagtctcatcgatctcctcatcgtcct 278
           ||||| ||||| ||||||||||||||||| ||||
Sbjct: 586 tcaactccagtgtcatcgatctcctcatcatcct 553



to top

>emb|CT033317.1| Platynereis dumerilii EST IB0AAA22CF02FM1
          Length = 782

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 245 tcaacaccagtctcatcgatctcctcatcgtcct 278
           ||||| ||||| ||||||||||||||||| ||||
Sbjct: 213 tcaactccagtgtcatcgatctcctcatcatcct 246



to top

>emb|CT032495.1| Platynereis dumerilii EST IB0AAA37BF03EM1
          Length = 814

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 245 tcaacaccagtctcatcgatctcctcatcgtcct 278
           ||||| ||||| ||||||||||||||||| ||||
Sbjct: 590 tcaactccagtgtcatcgatctcctcatcatcct 557



to top

>emb|CT032494.1| Platynereis dumerilii EST IB0AAA37BF03FM1
          Length = 804

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 245 tcaacaccagtctcatcgatctcctcatcgtcct 278
           ||||| ||||| ||||||||||||||||| ||||
Sbjct: 225 tcaactccagtgtcatcgatctcctcatcatcct 258



to top

>gb|BT016765.1| Zea mays clone Contig598 mRNA sequence
          Length = 957

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 497 acaccagtaatggccttcatgccaagctt 525
           |||||||| |||| |||||||||||||||
Sbjct: 340 acaccagtgatgggcttcatgccaagctt 312



to top

>ref|XM_609695.2| PREDICTED: Bos taurus similar to Nascent polypeptide-associated
            complex alpha subunit, muscle-specific form (Alpha-NAC,
            muscle-specific form) (LOC531208), mRNA
          Length = 8513

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 134  gtcaactccatgatggcgctgacgatgtc 162
            |||| ||||||||||||| ||||||||||
Sbjct: 8264 gtcagctccatgatggcgttgacgatgtc 8236



to top

>gb|AC079440.38| Mus musculus strain 129/Sv clone ct7-340l7 map 2, complete sequence
          Length = 131387

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 505    aatggccttcatgccaagctt 525
              |||||||||||||||||||||
Sbjct: 129024 aatggccttcatgccaagctt 129044



to top

>gb|AC083797.16| Homo sapiens 3 BAC RP11-114A6 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 157113

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 106    cacaactccaccttccagaac 126
              |||||||||||||||||||||
Sbjct: 104829 cacaactccaccttccagaac 104849



to top

>emb|AL954374.4| Mouse DNA sequence from clone RP23-445A5 on chromosome 2, complete
             sequence
          Length = 87941

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 505   aatggccttcatgccaagctt 525
             |||||||||||||||||||||
Sbjct: 25818 aatggccttcatgccaagctt 25838



to top

>gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome
          Length = 3052398

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 144    tgatggcgctgacgatgtcgccatc 168
              ||||||||||| |||||||||||||
Sbjct: 675148 tgatggcgctggcgatgtcgccatc 675172



to top

>gb|AY103873.1| Zea mays PCO094039 mRNA sequence
          Length = 984

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 497 acaccagtaatggccttcatgccaagctt 525
           |||||||| |||| |||||||||||||||
Sbjct: 341 acaccagtgatgggcttcatgccaagctt 313



to top

>gb|AC091499.2| Drosophila melanogaster clone BACR33L22, complete sequence
          Length = 182105

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 139   ctccatgatggcgctgacgatgtc 162
             ||||||||||||| ||||||||||
Sbjct: 23136 ctccatgatggcgttgacgatgtc 23159



to top

>gb|BT012765.1| Lycopersicon esculentum clone 113714F, mRNA sequence
          Length = 820

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 248 acaccagtctcatcgatctcctcatcgtcctg 279
           |||||||||||||| |  ||||||||||||||
Sbjct: 512 acaccagtctcatctacatcctcatcgtcctg 481



to top

>gb|AC161217.7| Mus musculus chromosome 8, clone RP23-80D9, complete sequence
          Length = 234127

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 433    gaagacatctggcttggaga 452
              ||||||||||||||||||||
Sbjct: 220809 gaagacatctggcttggaga 220790



to top

>ref|XM_883486.1| Leishmania major strain Friedlin nascent polypeptide associated
           complex subunit (L4830.08) partial mRNA
          Length = 735

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 134 gtcaactccatgatggcgctgacgatgtcgcc 165
           |||| ||||||||||| | |||||||||||||
Sbjct: 728 gtcagctccatgatggtgttgacgatgtcgcc 697



to top

>emb|AL139794.3|LMFLCHR4B Leishmania major Friedlin chromosome 4, right end
          Length = 247462

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 134   gtcaactccatgatggcgctgacgatgtcgcc 165
             |||| ||||||||||| | |||||||||||||
Sbjct: 79339 gtcagctccatgatggtgttgacgatgtcgcc 79370



to top

>ref|XM_847221.1| PREDICTED: Canis familiaris similar to nascent
           polypeptide-associated complex alpha polypeptide
           (LOC609875), mRNA
          Length = 360

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 139 ctccatgatggcgctgacgatgtc 162
           ||||||||||||| ||||||||||
Sbjct: 348 ctccatgatggcgttgacgatgtc 325



to top

>gb|AC114819.4| Mus musculus BAC clone RP23-52J20 from chromosome 8, complete sequence
          Length = 204239

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 433   gaagacatctggcttggaga 452
             ||||||||||||||||||||
Sbjct: 16326 gaagacatctggcttggaga 16307



to top

>gb|AC117211.3| Mus musculus BAC clone RP23-287M3 from 3, complete sequence
          Length = 206579

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 498   caccagtaatggccttcatg 517
             ||||||||||||||||||||
Sbjct: 38895 caccagtaatggccttcatg 38876



to top

>emb|CR688321.2|CNS0FU25 Tetraodon nigroviridis full-length cDNA
          Length = 1371

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 140  tccatgatggcgctgacgatgtcg 163
            |||||||||||| |||||||||||
Sbjct: 1257 tccatgatggcgttgacgatgtcg 1234



to top

>emb|CR686631.2|CNS0FSR7 Tetraodon nigroviridis full-length cDNA
          Length = 1357

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 140  tccatgatggcgctgacgatgtcg 163
            |||||||||||| |||||||||||
Sbjct: 1260 tccatgatggcgttgacgatgtcg 1237



to top

>emb|X04891.1|TN21TNPA Transposon Tn21 tnpA gene for transposase
          Length = 3176

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 272  tcgtcctgggctgctgccat 291
            ||||||||||||||||||||
Sbjct: 2174 tcgtcctgggctgctgccat 2155



to top

>emb|BX927338.6| Zebrafish DNA sequence from clone CH211-223O15 in linkage group 5,
             complete sequence
          Length = 187498

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 429   tcttgaagacatctggcttg 448
             ||||||||||||||||||||
Sbjct: 24092 tcttgaagacatctggcttg 24111



to top

>ref|NM_165950.1| Drosophila melanogaster Nascent polypeptide associated complex
           protein alpha subunit CG8759-RC, transcript variant C
           (Nacalpha), mRNA
          Length = 874

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 139 ctccatgatggcgctgacgatgtc 162
           ||||||||||||| ||||||||||
Sbjct: 695 ctccatgatggcgttgacgatgtc 672



to top

>ref|NM_134312.2| Drosophila melanogaster Nascent polypeptide associated complex
           protein alpha subunit CG8759-RA, transcript variant A
           (Nacalpha), mRNA
          Length = 870

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 139 ctccatgatggcgctgacgatgtc 162
           ||||||||||||| ||||||||||
Sbjct: 686 ctccatgatggcgttgacgatgtc 663



to top

>ref|NM_057868.3| Drosophila melanogaster Nascent polypeptide associated complex
           protein alpha subunit CG8759-RB, transcript variant B
           (Nacalpha), mRNA
          Length = 897

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 139 ctccatgatggcgctgacgatgtc 162
           ||||||||||||| ||||||||||
Sbjct: 713 ctccatgatggcgttgacgatgtc 690



to top

>gb|AY075332.1| Drosophila melanogaster GH11940 full length cDNA
          Length = 890

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 139 ctccatgatggcgctgacgatgtc 162
           ||||||||||||| ||||||||||
Sbjct: 684 ctccatgatggcgttgacgatgtc 661



to top

>gb|AC018695.6| Homo sapiens BAC clone RP11-568J23 from 16, complete sequence
          Length = 211001

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 7      agtttaactttaacaggcac 26
              ||||||||||||||||||||
Sbjct: 107467 agtttaactttaacaggcac 107486



to top

>gb|AC154213.3| Mus musculus BAC clone RP24-120I12 from chromosome 14, complete sequence
          Length = 183773

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 54     ttcaagatgacatgaccaaa 73
              ||||||||||||||||||||
Sbjct: 118835 ttcaagatgacatgaccaaa 118854



to top

>gb|AE003821.4| Drosophila melanogaster chromosome 2R, section 29 of 73 of the complete
              sequence
          Length = 294168

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 139    ctccatgatggcgctgacgatgtc 162
              ||||||||||||| ||||||||||
Sbjct: 238219 ctccatgatggcgttgacgatgtc 238242



to top

>gb|AF017783.2|AF017783 Drosophila melanogaster alpha NAC, diacylglycerol kinase epsilon
           and ubiquinol-cytochrome C reductase complex genes,
           complete cds; and unknown gene
          Length = 4728

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 139 ctccatgatggcgctgacgatgtc 162
           ||||||||||||| ||||||||||
Sbjct: 779 ctccatgatggcgttgacgatgtc 756



to top

>emb|AL845306.9| Zebrafish DNA sequence from clone DKEY-217M5 in linkage group 20,
             complete sequence
          Length = 186675

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 50    aacattcaagatgacatgaccaaa 73
             ||||||||| ||||||||||||||
Sbjct: 73698 aacattcaacatgacatgaccaaa 73675



to top

>gb|AY109787.1| Zea mays CL9345_1 mRNA sequence
          Length = 846

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 257 tcatcgatctcctcatcgtc 276
           ||||||||||||||||||||
Sbjct: 347 tcatcgatctcctcatcgtc 366



to top

>gb|AC007453.1|AC007453 Drosophila melanogaster, chromosome 2R, region 49C1-49D3, P1 clones
             DS04499, DS06146, and DS00455, complete sequence
          Length = 145055

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 139   ctccatgatggcgctgacgatgtc 162
             ||||||||||||| ||||||||||
Sbjct: 59899 ctccatgatggcgttgacgatgtc 59922



to top

>dbj|AP001690.1| Homo sapiens genomic DNA, chromosome 21q, section 34/105
          Length = 340000

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 45     actacaacattcaagatgac 64
              ||||||||||||||||||||
Sbjct: 149761 actacaacattcaagatgac 149780



to top

>emb|BX255901.3| Mouse DNA sequence from clone RP23-200D14 on chromosome 4, complete
             sequence
          Length = 16695

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 242   ttgtcaacaccagtctcatc 261
             ||||||||||||||||||||
Sbjct: 14660 ttgtcaacaccagtctcatc 14679



to top

>emb|Y08969.1|DMNACPRAL D.melanogaster mRNA for NAC protein alpha subunit
          Length = 829

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 139 ctccatgatggcgctgacgatgtc 162
           ||||||||||||| ||||||||||
Sbjct: 646 ctccatgatggcgttgacgatgtc 623



to top

>dbj|AP000954.2| Homo sapiens genomic DNA, chromosome 21q21.1-q21.2 clone:B705D10,
            LL56-APP region, complete sequence
          Length = 25256

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 45   actacaacattcaagatgac 64
            ||||||||||||||||||||
Sbjct: 9663 actacaacattcaagatgac 9682


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,744,058
Number of Sequences: 3902068
Number of extensions: 3744058
Number of successful extensions: 68407
Number of sequences better than 10.0: 136
Number of HSP's better than 10.0 without gapping: 136
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 68128
Number of HSP's gapped (non-prelim): 272
length of query: 525
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 502
effective length of database: 17,143,297,704
effective search space: 8605935447408
effective search space used: 8605935447408
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top