ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbaal35f17 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AK060135.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-D07, full insert sequence Length = 1060 Score = 278 bits (140), Expect = 2e-71 Identities = 251/288 (87%) Strand = Plus / Minus Query: 231 accctagactacgcggaatgattctgctatttgcttcagatccttgtaatgcctcttcca 290 ||||||||| || || |||||||| |||||||||||||| || ||||||| ||||||||| Sbjct: 920 accctagacaacacgaaatgattcagctatttgcttcaggtcattgtaattcctcttcca 861 Query: 291 ttgtagcccgtttgcagttacgctgaacaggtagagcctattcccagcagccgtagctgt 350 ||||||||| ||||||||||| |||||||||||||||| || ||||| || || || || Sbjct: 860 ttgtagcccatttgcagttacattgaacaggtagagcctgtttccagcggcagttgcagt 801 Query: 351 gatgaagatatggggtggttccagctcgaactggtagtaagttcttccggagtactctgc 410 |||||||||||| |||||||||||||| |||||||||||||||||||| || |||||||| Sbjct: 800 gatgaagatatgaggtggttccagctcaaactggtagtaagttcttcctgaatactctgc 741 Query: 411 tgtggctgtggacaaaaccttcccttccacattctcgccaatgacctccggtccaaaggc 470 ||| || ||||||||||||||||||| ||||| || || || ||||| ||||| ||||| Sbjct: 740 tgttgccatggacaaaaccttcccttcaacattttcaccgatcacctctggtccgaaggc 681 Query: 471 gttgatcaccttctccggcgtgccgatcttctcgatcgttgcatcgtc 518 || ||||||||||||||| || |||||||| || || || |||||||| Sbjct: 680 gtcgatcaccttctccggtgtaccgatcttttcaattgtcgcatcgtc 633 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 589 cgcaggtcgatctccgtgccaccgagatcagcgatcgagaccgg 632 |||||||||||||| |||||||| |||||||| ||||| ||||| Sbjct: 565 cgcaggtcgatctcggtgccaccaagatcagcaatcgacaccgg 522
>dbj|AK058893.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E10, full insert sequence Length = 1007 Score = 278 bits (140), Expect = 2e-71 Identities = 251/288 (87%) Strand = Plus / Minus Query: 231 accctagactacgcggaatgattctgctatttgcttcagatccttgtaatgcctcttcca 290 ||||||||| || || |||||||| |||||||||||||| || ||||||| ||||||||| Sbjct: 914 accctagacaacacgaaatgattcagctatttgcttcaggtcattgtaattcctcttcca 855 Query: 291 ttgtagcccgtttgcagttacgctgaacaggtagagcctattcccagcagccgtagctgt 350 ||||||||| ||||||||||| |||||||||||||||| || ||||| || || || || Sbjct: 854 ttgtagcccatttgcagttacattgaacaggtagagcctgtttccagcggcagttgcagt 795 Query: 351 gatgaagatatggggtggttccagctcgaactggtagtaagttcttccggagtactctgc 410 |||||||||||| |||||||||||||| |||||||||||||||||||| || |||||||| Sbjct: 794 gatgaagatatgaggtggttccagctcaaactggtagtaagttcttcctgaatactctgc 735 Query: 411 tgtggctgtggacaaaaccttcccttccacattctcgccaatgacctccggtccaaaggc 470 ||| || ||||||||||||||||||| ||||| || || || ||||| ||||| ||||| Sbjct: 734 tgttgccatggacaaaaccttcccttcaacattttcaccgatcacctctggtccgaaggc 675 Query: 471 gttgatcaccttctccggcgtgccgatcttctcgatcgttgcatcgtc 518 || ||||||||||||||| || |||||||| || || || |||||||| Sbjct: 674 gtcgatcaccttctccggtgtaccgatcttttcaattgtcgcatcgtc 627 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 589 cgcaggtcgatctccgtgccaccgagatcagcgatcgagaccgg 632 |||||||||||||| |||||||| |||||||| ||||| ||||| Sbjct: 559 cgcaggtcgatctcggtgccaccaagatcagcaatcgacaccgg 516
>gb|AY109944.1| Zea mays CL24591_1 mRNA sequence Length = 1069 Score = 250 bits (126), Expect = 5e-63 Identities = 312/374 (83%) Strand = Plus / Plus Query: 247 aatgattctgctatttgcttcagatccttgtaatgcctcttccattgtagcccgtttgca 306 ||||||| |||||| || || || || ||||||||||||||||| || || ||||||||| Sbjct: 293 aatgattgtgctatctgtttgaggtctttgtaatgcctcttccactgcagaccgtttgca 352 Query: 307 gttacgctgaacaggtagagcctattcccagcagccgtagctgtgatgaagatatggggt 366 ||||| ||||| ||||| ||||| |||||||| ||||| || |||||||| | |||||| Sbjct: 353 gttacactgaagaggtacagcctgttcccagctgccgtggcggtgatgaacacatggggc 412 Query: 367 ggttccagctcgaactggtagtaagttcttccggagtactctgctgtggctgtggacaaa 426 || ||||||||||||||||||||||||||||| || | | | || || | | ||||| Sbjct: 413 ggctccagctcgaactggtagtaagttcttcccgaatgcgccgccgtctccgaggacagg 472 Query: 427 accttcccttccacattctcgccaatgacctccggtccaaaggcgttgatcaccttctcc 486 |||||||||||||| ||||| || ||||||||||| || |||||| |||||||||||||| Sbjct: 473 accttcccttccacgttctctccgatgacctccggaccgaaggcggtgatcaccttctcc 532 Query: 487 ggcgtgccgatcttctcgatcgttgcatcgtcaaggtcatctgcaaacctacgagtgggc 546 || |||||||||||||||| || || ||||| ||||||||||| |||| | | || Sbjct: 533 gggctgccgatcttctcgatggtcgcgtcgtccaggtcatctgcgaaccggccaactggg 592 Query: 547 gccacgatgacagataaccggccctccttagggtttccgaaacgcaggtcgatctccgtg 606 ||||||||||| | | |||||| ||||| |||||| |||| |||||||||||||||||| Sbjct: 593 gccacgatgacgaacagccggccttccttggggtttgcgaagcgcaggtcgatctccgtg 652 Query: 607 ccaccgagatcagc 620 || || |||||||| Sbjct: 653 ccgcccagatcagc 666
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 202 bits (102), Expect = 1e-48 Identities = 189/218 (86%) Strand = Plus / Plus Query: 301 tttgcagttacgctgaacaggtagagcctattcccagcagccgtagctgtgatgaagata 360 ||||||||||| |||||||||||||||| || ||||| || || || |||||||||||| Sbjct: 4555451 tttgcagttacattgaacaggtagagcctgtttccagcggcagttgcagtgatgaagata 4555510 Query: 361 tggggtggttccagctcgaactggtagtaagttcttccggagtactctgctgtggctgtg 420 || |||||||||||||| |||||||||||||||||||| || ||||||||||| || || Sbjct: 4555511 tgaggtggttccagctcaaactggtagtaagttcttcctgaatactctgctgttgccatg 4555570 Query: 421 gacaaaaccttcccttccacattctcgccaatgacctccggtccaaaggcgttgatcacc 480 ||||||||||||||||| ||||| || || || ||||| ||||| ||||||| ||||||| Sbjct: 4555571 gacaaaaccttcccttcaacattttcaccgatcacctctggtccgaaggcgtcgatcacc 4555630 Query: 481 ttctccggcgtgccgatcttctcgatcgttgcatcgtc 518 |||||||| || |||||||| || || || |||||||| Sbjct: 4555631 ttctccggtgtaccgatcttttcaattgtcgcatcgtc 4555668 Score = 81.8 bits (41), Expect = 3e-12 Identities = 62/69 (89%) Strand = Plus / Plus Query: 231 accctagactacgcggaatgattctgctatttgcttcagatccttgtaatgcctcttcca 290 ||||||||| || || |||||||| |||||||||||||| || ||||||| ||||||||| Sbjct: 4555297 accctagacaacacgaaatgattcagctatttgcttcaggtcattgtaattcctcttcca 4555356 Query: 291 ttgtagccc 299 ||||||||| Sbjct: 4555357 ttgtagccc 4555365 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Plus Query: 589 cgcaggtcgatctccgtgccaccgagatcagcgatcgagaccgg 632 |||||||||||||| |||||||| |||||||| ||||| ||||| Sbjct: 4555837 cgcaggtcgatctcggtgccaccaagatcagcaatcgacaccgg 4555880
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 202 bits (102), Expect = 1e-48 Identities = 189/218 (86%) Strand = Plus / Plus Query: 301 tttgcagttacgctgaacaggtagagcctattcccagcagccgtagctgtgatgaagata 360 ||||||||||| |||||||||||||||| || ||||| || || || |||||||||||| Sbjct: 4555432 tttgcagttacattgaacaggtagagcctgtttccagcggcagttgcagtgatgaagata 4555491 Query: 361 tggggtggttccagctcgaactggtagtaagttcttccggagtactctgctgtggctgtg 420 || |||||||||||||| |||||||||||||||||||| || ||||||||||| || || Sbjct: 4555492 tgaggtggttccagctcaaactggtagtaagttcttcctgaatactctgctgttgccatg 4555551 Query: 421 gacaaaaccttcccttccacattctcgccaatgacctccggtccaaaggcgttgatcacc 480 ||||||||||||||||| ||||| || || || ||||| ||||| ||||||| ||||||| Sbjct: 4555552 gacaaaaccttcccttcaacattttcaccgatcacctctggtccgaaggcgtcgatcacc 4555611 Query: 481 ttctccggcgtgccgatcttctcgatcgttgcatcgtc 518 |||||||| || |||||||| || || || |||||||| Sbjct: 4555612 ttctccggtgtaccgatcttttcaattgtcgcatcgtc 4555649 Score = 81.8 bits (41), Expect = 3e-12 Identities = 62/69 (89%) Strand = Plus / Plus Query: 231 accctagactacgcggaatgattctgctatttgcttcagatccttgtaatgcctcttcca 290 ||||||||| || || |||||||| |||||||||||||| || ||||||| ||||||||| Sbjct: 4555278 accctagacaacacgaaatgattcagctatttgcttcaggtcattgtaattcctcttcca 4555337 Query: 291 ttgtagccc 299 ||||||||| Sbjct: 4555338 ttgtagccc 4555346 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Plus Query: 589 cgcaggtcgatctccgtgccaccgagatcagcgatcgagaccgg 632 |||||||||||||| |||||||| |||||||| ||||| ||||| Sbjct: 4555818 cgcaggtcgatctcggtgccaccaagatcagcaatcgacaccgg 4555861
>emb|AL928749.4|CNS08CBM Oryza sativa chromosome 12, . BAC OSJNBa0002O20 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 129155 Score = 202 bits (102), Expect = 1e-48 Identities = 189/218 (86%) Strand = Plus / Minus Query: 301 tttgcagttacgctgaacaggtagagcctattcccagcagccgtagctgtgatgaagata 360 ||||||||||| |||||||||||||||| || ||||| || || || |||||||||||| Sbjct: 49327 tttgcagttacattgaacaggtagagcctgtttccagcggcagttgcagtgatgaagata 49268 Query: 361 tggggtggttccagctcgaactggtagtaagttcttccggagtactctgctgtggctgtg 420 || |||||||||||||| |||||||||||||||||||| || ||||||||||| || || Sbjct: 49267 tgaggtggttccagctcaaactggtagtaagttcttcctgaatactctgctgttgccatg 49208 Query: 421 gacaaaaccttcccttccacattctcgccaatgacctccggtccaaaggcgttgatcacc 480 ||||||||||||||||| ||||| || || || ||||| ||||| ||||||| ||||||| Sbjct: 49207 gacaaaaccttcccttcaacattttcaccgatcacctctggtccgaaggcgtcgatcacc 49148 Query: 481 ttctccggcgtgccgatcttctcgatcgttgcatcgtc 518 |||||||| || |||||||| || || || |||||||| Sbjct: 49147 ttctccggtgtaccgatcttttcaattgtcgcatcgtc 49110 Score = 81.8 bits (41), Expect = 3e-12 Identities = 62/69 (89%) Strand = Plus / Minus Query: 231 accctagactacgcggaatgattctgctatttgcttcagatccttgtaatgcctcttcca 290 ||||||||| || || |||||||| |||||||||||||| || ||||||| ||||||||| Sbjct: 49481 accctagacaacacgaaatgattcagctatttgcttcaggtcattgtaattcctcttcca 49422 Query: 291 ttgtagccc 299 ||||||||| Sbjct: 49421 ttgtagccc 49413 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 589 cgcaggtcgatctccgtgccaccgagatcagcgatcgagaccgg 632 |||||||||||||| |||||||| |||||||| ||||| ||||| Sbjct: 48941 cgcaggtcgatctcggtgccaccaagatcagcaatcgacaccgg 48898
>gb|AY616049.1| Prototheca wickerhamii plastid thylakoid lumenal 29-like protein mRNA, partial cds; nuclear gene for plastid product Length = 739 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 589 cgcaggtcgatctccgtgccaccgagatcagcgatcgagaccggcgtctc 638 |||||||||||||| ||||| || || |||||||| ||||| |||||||| Sbjct: 527 cgcaggtcgatctcagtgccccccaggtcagcgattgagactggcgtctc 478
>ref|NM_106359.2| Arabidopsis thaliana unknown protein AT1G77090 mRNA, complete cds Length = 1009 Score = 48.1 bits (24), Expect = 0.036 Identities = 36/40 (90%) Strand = Plus / Minus Query: 264 cttcagatccttgtaatgcctcttccattgtagcccgttt 303 ||||||||||||||| || ||||||||||| || |||||| Sbjct: 800 cttcagatccttgtagtgtctcttccattgaagaccgttt 761 Score = 42.1 bits (21), Expect = 2.2 Identities = 48/57 (84%) Strand = Plus / Minus Query: 427 accttcccttccacattctcgccaatgacctccggtccaaaggcgttgatcaccttc 483 ||||||||||| || || || ||||| || || |||||||| ||||| ||||||||| Sbjct: 637 accttcccttctacgttttctccaataacttctggtccaaacgcgttaatcaccttc 581 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 598 atctccgtgccaccgagatcagcgatcga 626 ||||| |||||||| |||||||||||||| Sbjct: 463 atctcggtgccaccaagatcagcgatcga 435
>gb|AF370571.1|AF370571 Arabidopsis thaliana Unknown protein (F22K20.16) mRNA, complete cds Length = 870 Score = 48.1 bits (24), Expect = 0.036 Identities = 36/40 (90%) Strand = Plus / Minus Query: 264 cttcagatccttgtaatgcctcttccattgtagcccgttt 303 ||||||||||||||| || ||||||||||| || |||||| Sbjct: 751 cttcagatccttgtagtgtctcttccattgaagaccgttt 712 Score = 42.1 bits (21), Expect = 2.2 Identities = 48/57 (84%) Strand = Plus / Minus Query: 427 accttcccttccacattctcgccaatgacctccggtccaaaggcgttgatcaccttc 483 ||||||||||| || || || ||||| || || |||||||| ||||| ||||||||| Sbjct: 587 accttcccttctacgttttctccaataacttctggtccaaacgcgttaatcaccttc 531
>emb|BX818244.1|CNS0AEDP Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL69ZE06 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 944 Score = 48.1 bits (24), Expect = 0.036 Identities = 36/40 (90%) Strand = Plus / Minus Query: 264 cttcagatccttgtaatgcctcttccattgtagcccgttt 303 ||||||||||||||| || ||||||||||| || |||||| Sbjct: 771 cttcagatccttgtagtgtctcttccattgaagaccgttt 732 Score = 42.1 bits (21), Expect = 2.2 Identities = 48/57 (84%) Strand = Plus / Minus Query: 427 accttcccttccacattctcgccaatgacctccggtccaaaggcgttgatcaccttc 483 ||||||||||| || || || ||||| || || |||||||| ||||| ||||||||| Sbjct: 608 accttcccttctacgttttctccaataacttctggtccaaacgcgttaatcaccttc 552 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 598 atctccgtgccaccgagatcagcgatcga 626 ||||| |||||||| |||||||||||||| Sbjct: 434 atctcggtgccaccaagatcagcgatcga 406
>emb|BX814327.1|CNS0AEIX Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB68ZD10 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 965 Score = 48.1 bits (24), Expect = 0.036 Identities = 36/40 (90%) Strand = Plus / Minus Query: 264 cttcagatccttgtaatgcctcttccattgtagcccgttt 303 ||||||||||||||| || ||||||||||| || |||||| Sbjct: 779 cttcagatccttgtagtgtctcttccattgaagaccgttt 740 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 598 atctccgtgccaccgagatcagcgatcga 626 ||||| |||||||| |||||||||||||| Sbjct: 440 atctcggtgccaccaagatcagcgatcga 412
>emb|BX817429.1|CNS0ADW3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL22ZA09 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 861 Score = 48.1 bits (24), Expect = 0.036 Identities = 36/40 (90%) Strand = Plus / Minus Query: 264 cttcagatccttgtaatgcctcttccattgtagcccgttt 303 ||||||||||||||| || ||||||||||| || |||||| Sbjct: 784 cttcagatccttgtagtgtctcttccattgaagaccgttt 745 Score = 42.1 bits (21), Expect = 2.2 Identities = 48/57 (84%) Strand = Plus / Minus Query: 427 accttcccttccacattctcgccaatgacctccggtccaaaggcgttgatcaccttc 483 ||||||||||| || || || ||||| || || |||||||| ||||| ||||||||| Sbjct: 621 accttcccttctacgttttctccaataacttctggtccaaacgcgttaatcaccttc 565 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 598 atctccgtgccaccgagatcagcgatcga 626 ||||| |||||||| |||||||||||||| Sbjct: 447 atctcggtgccaccaagatcagcgatcga 419
>gb|AC002291.1| Arabidopsis thaliana chromosome I BAC F22K20 genomic sequence, complete sequence Length = 96642 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Plus Query: 264 cttcagatccttgtaatgcctcttccattg 293 ||||||||||||||| || ||||||||||| Sbjct: 79557 cttcagatccttgtagtgtctcttccattg 79586 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 598 atctccgtgccaccgagatcagcgatcga 626 ||||| |||||||| |||||||||||||| Sbjct: 80116 atctcggtgccaccaagatcagcgatcga 80144 Score = 42.1 bits (21), Expect = 2.2 Identities = 48/57 (84%) Strand = Plus / Plus Query: 427 accttcccttccacattctcgccaatgacctccggtccaaaggcgttgatcaccttc 483 ||||||||||| || || || ||||| || || |||||||| ||||| ||||||||| Sbjct: 79825 accttcccttctacgttttctccaataacttctggtccaaacgcgttaatcaccttc 79881
>gb|AC005912.1| Homo sapiens 12 BAC RPCI11-543P15 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 165516 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Plus Query: 106 tcagtttcttcagctagaaaat 127 |||||||||||||||||||||| Sbjct: 92640 tcagtttcttcagctagaaaat 92661
>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence Length = 3181762 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 481 ttctccggcgtgccgatcttctcga 505 ||||||||||||||||||| ||||| Sbjct: 1037336 ttctccggcgtgccgatctgctcga 1037360
>gb|AC157597.4| Mus musculus BAC clone RP23-231O9 from chromosome 16, complete sequence Length = 171299 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 416 ctgtggacaaaaccttccctt 436 ||||||||||||||||||||| Sbjct: 73890 ctgtggacaaaaccttccctt 73870
>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence Length = 3173005 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 481 ttctccggcgtgccgatcttctcga 505 ||||||||||||||||||| ||||| Sbjct: 2354864 ttctccggcgtgccgatctgctcga 2354888
>emb|AL591985.1|RME591985 Sinorhizobium meliloti 1021 complete pSymB Length = 1683333 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 484 tccggcgtgccgatcttctcgatcg 508 |||||||||||||||| |||||||| Sbjct: 850415 tccggcgtgccgatctgctcgatcg 850391
>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence Length = 2325379 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 481 ttctccggcgtgccgatcttctcga 505 ||||||||||||||||||| ||||| Sbjct: 1903356 ttctccggcgtgccgatctgctcga 1903380
>gb|AC160029.3| Mus musculus 10 BAC RP24-105I7 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 184696 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 97 atacaatgttcagtttcttca 117 ||||||||||||||||||||| Sbjct: 121380 atacaatgttcagtttcttca 121360
>gb|AE000782.1| Archaeoglobus fulgidus DSM 4304, complete genome Length = 2178400 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 341 ccgtagctgtgatgaagatat 361 ||||||||||||||||||||| Sbjct: 1801104 ccgtagctgtgatgaagatat 1801124
>gb|AC113292.6| Mus musculus chromosome 15, clone RP23-418M3, complete sequence Length = 218109 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 104 gttcagtttcttcagctagaaaat 127 |||| ||||||||||||||||||| Sbjct: 191874 gttccgtttcttcagctagaaaat 191851
>gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, complete sequence Length = 4895836 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 493 ccgatcttctcgatcgttgc 512 |||||||||||||||||||| Sbjct: 991958 ccgatcttctcgatcgttgc 991939
>emb|AL353607.20| Human DNA sequence from clone RP11-652B19 on chromosome 9 Contains part of the PCSK5 gene for proprotein convertase subtilisin/kexin type 5, complete sequence Length = 141170 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 108 agtttcttcagctagaaaat 127 |||||||||||||||||||| Sbjct: 82395 agtttcttcagctagaaaat 82414
>emb|AL138694.18| Human DNA sequence from clone RP11-330C15 on chromosome 13q33.1-34 Contains a pseudogene similar to part of host cell factor 2 (HCF-2) and a CpG island, complete sequence Length = 157264 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 105 ttcagtttcttcagctagaa 124 |||||||||||||||||||| Sbjct: 54057 ttcagtttcttcagctagaa 54076
>gb|AC094241.9| Rattus norvegicus 1 BAC CH230-3C7 (Children's Hospital Oakland Research Institute) complete sequence Length = 215638 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 477 caccttctccggcgtgccga 496 |||||||||||||||||||| Sbjct: 27948 caccttctccggcgtgccga 27967
>emb|AL021106.1|DMC63B12 Drosophila melanogaster cosmid clone 63B12 Length = 36401 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 480 cttctccggcgtgccgatct 499 |||||||||||||||||||| Sbjct: 25781 cttctccggcgtgccgatct 25800
>gb|AC158633.7| Mus musculus 10 BAC RP23-407I4 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 206282 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 110 tttcttcagctagaaaatca 129 |||||||||||||||||||| Sbjct: 149840 tttcttcagctagaaaatca 149859
>gb|AC104147.4| Drosophila melanogaster X BAC RP98-33I18 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 170490 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 480 cttctccggcgtgccgatct 499 |||||||||||||||||||| Sbjct: 79771 cttctccggcgtgccgatct 79790
>ref|NM_166911.3| Drosophila melanogaster trithorax-related CG3848-RD, transcript variant D (trr), mRNA Length = 8145 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 480 cttctccggcgtgccgatct 499 |||||||||||||||||||| Sbjct: 2226 cttctccggcgtgccgatct 2207
>ref|NM_080301.2| Drosophila melanogaster trithorax-related CG3848-RC, transcript variant C (trr), mRNA Length = 8082 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 480 cttctccggcgtgccgatct 499 |||||||||||||||||||| Sbjct: 2163 cttctccggcgtgccgatct 2144
>gb|AC159335.10| Mus musculus 10 BAC RP24-447O4 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 135177 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 253 tctgctatttgcttcagatc 272 |||||||||||||||||||| Sbjct: 10028 tctgctatttgcttcagatc 10009
>gb|AC154706.2| Mus musculus BAC clone RP23-132D23 from chromosome 14, complete sequence Length = 215330 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 108 agtttcttcagctagaaaat 127 |||||||||||||||||||| Sbjct: 109019 agtttcttcagctagaaaat 109038
>gb|AC159204.2| Mus musculus BAC clone RP23-229H13 from chromosome 12, complete sequence Length = 211156 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 144 gtgtacttagcctcccttta 163 |||||||||||||||||||| Sbjct: 192078 gtgtacttagcctcccttta 192059
>gb|AC154485.2| Mus musculus BAC clone RP24-117M9 from chromosome 12, complete sequence Length = 154864 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 144 gtgtacttagcctcccttta 163 |||||||||||||||||||| Sbjct: 123691 gtgtacttagcctcccttta 123710
>tpg|BK005736.1| TPA: TPA_exp: Drosophila melanogaster dosage compensation complex binding fragment 1, complete sequence Length = 5340 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 480 cttctccggcgtgccgatct 499 |||||||||||||||||||| Sbjct: 4869 cttctccggcgtgccgatct 4888
>gb|AC153937.11| Mus musculus 10 BAC RP24-458J4 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 195695 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 253 tctgctatttgcttcagatc 272 |||||||||||||||||||| Sbjct: 194111 tctgctatttgcttcagatc 194092
>ref|XM_392924.2| PREDICTED: Apis mellifera similar to intestinal cell kinase (LOC409409), mRNA Length = 2054 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 479 ccttctccggcgtgccgatc 498 |||||||||||||||||||| Sbjct: 848 ccttctccggcgtgccgatc 829
>gb|AE003422.2| Drosophila melanogaster chromosome X, section 6 of 74 of the complete sequence Length = 300933 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 480 cttctccggcgtgccgatct 499 |||||||||||||||||||| Sbjct: 122061 cttctccggcgtgccgatct 122080
>emb|BX293555.7| Mouse DNA sequence from clone RP23-202M10 on chromosome 2, complete sequence Length = 192154 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 194 tagaacagattatgtgatga 213 |||||||||||||||||||| Sbjct: 48949 tagaacagattatgtgatga 48930 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,090,453 Number of Sequences: 3902068 Number of extensions: 5090453 Number of successful extensions: 111467 Number of sequences better than 10.0: 40 Number of HSP's better than 10.0 without gapping: 40 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 111169 Number of HSP's gapped (non-prelim): 298 length of query: 643 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 620 effective length of database: 17,143,297,704 effective search space: 10628844576480 effective search space used: 10628844576480 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
