ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal35c22
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|NM_190977.1| Oryza sativa (japonica cultivar-group), predic... 200 4e-48
2dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 159 1e-35
3dbj|AP003232.3| Oryza sativa (japonica cultivar-group) genomic D... 159 1e-35
4emb|CR555306.1| Azoarcus sp. EbN1 complete genome 48 0.034
5gb|AC010092.4| Homo sapiens BAC clone RP11-306M1 from 2, complet... 48 0.034
6gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, co... 46 0.13
7gb|U70855.2| Caenorhabditis elegans cosmid K08F11, complete sequ... 44 0.53
8gb|AC112270.3| Mus musculus BAC clone RP24-117A22 from 5, comple... 44 0.53
9ref|NM_058707.3| Caenorhabditis elegans LiPid Depleted family me... 44 0.53
10gb|AC024864.1|AC024864 Caenorhabditis elegans clone Y74C9A, comp... 44 0.53
11gb|AF043700.1| Caenorhabditis elegans cosmid K09H9, complete seq... 44 0.53
12gb|AC024206.1| Caenorhabditis elegans cosmid Y74C9A, complete se... 44 0.53
13gb|AC151721.2| Mus musculus BAC clone RP23-68E12 from 5, complet... 44 0.53
14gb|AC098829.3| Homo sapiens BAC clone RP11-665G4 from 4, complet... 42 2.1
15emb|AL163528.8|HS109K15 Homo sapiens chromosome 9 BAC RP11-109K1... 42 2.1
16emb|AL442637.4|HS495L19 Homo sapiens chromosome 9 BAC RP11-495L1... 42 2.1
17gb|AC087899.40| Mus musculus strain C57BL/6J chromosome 19 clone... 42 2.1
18gb|AC169037.4| Mus musculus BAC clone RP23-85E20 from chromosome... 42 2.1
19gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 40 8.2
20gb|AC124353.5| Mus musculus BAC clone RP24-481I14 from chromosom... 40 8.2
21gb|AY658369.1| Synthetic construct Peudomonas aeruginosa clone F... 40 8.2
22emb|AL929439.6| Mouse DNA sequence from clone RP23-207J10 on chr... 40 8.2
23emb|CR860965.1| Pongo pygmaeus mRNA; cDNA DKFZp469E1114 (from cl... 40 8.2
24gb|AE012265.1| Xanthomonas campestris pv. campestris str. ATCC 3... 40 8.2
25gb|AC027271.7| Homo sapiens BAC clone RP11-365H22 from 4, comple... 40 8.2
26gb|AF277846.2|AF277846 Pinus taeda clone 51k4f microsatellite Pt... 40 8.2
27gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 40 8.2
28ref|NM_075536.1| Caenorhabditis elegans B0250.8 (B0250.8) mRNA, ... 40 8.2
29ref|XM_395593.2| PREDICTED: Apis mellifera similar to CG3707-PA,... 40 8.2
30gb|DP000024.1| Eulemur macaco macaco target 1 genomic scaffold 40 8.2
31gb|AC068491.4| Homo sapiens BAC clone RP11-803D5 from 2, complet... 40 8.2
32gb|AC073896.41| Homo sapiens 12 BAC RP11-977G19 (Roswell Park Ca... 40 8.2
33dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 40 8.2
34gb|AE004642.1| Pseudomonas aeruginosa PAO1, section 203 of 529 o... 40 8.2
35gb|AC093616.5| Homo sapiens BAC clone RP13-511M20 from 2, comple... 40 8.2
36gb|AC145419.3| Dasypus novemcinctus clone VMRC5-468K1, complete ... 40 8.2
37emb|CR354403.16| Zebrafish DNA sequence from clone CH211-196E8 i... 40 8.2
38emb|Z81453.1|CEB0250 Caenorhabditis elegans Cosmid B0250, comple... 40 8.2
39gb|AC172859.1| Brassica rapa subsp. pekinensis clone KBrB023K01,... 40 8.2 
>ref|NM_190977.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 480

 Score =  200 bits (101), Expect = 4e-48
 Identities = 242/289 (83%)
 Strand = Plus / Minus

                                                                       
Query: 123 tcccagtgggtgagtttgactttgtgcagaggatcttccttcctttgtcacgtctacgct 182
           |||||||||| ||||| | |||||||||||| | | | ||||||||| | ||||| ||||
Sbjct: 463 tcccagtgggggagttcgtctttgtgcagagaacccttcttcctttggcgcgtctgcgct 404

                                                                       
Query: 183 tcagaacccttcttccagcagtagtccgcatccgccttcggaaaccatgcacacgggcaa 242
           |||| ||| ||||||| |||||||||| |||||| || || ||||||||   ||||||||
Sbjct: 403 tcaggacctttcttccggcagtagtcctcatccgtctgcgaaaaccatgtgtacgggcaa 344

                                                                       
Query: 243 gtgacttcctagatcttgacctcttagtcaggcagagggcagcctttccggccctaatct 302
           | ||||||||||||||    ||||| |||| ||| || ||||||||||| ||||||||||
Sbjct: 343 gcgacttcctagatctatttctcttggtcatgcacagagcagcctttccagccctaatct 284

                                                                       
Query: 303 gtagaccacgaggtcttcgtgttgttaatctgttgtaactgaactcaattcccaaagatg 362
           | |||   || | ||||| |||||| | ||||||||| ||||| ||||||||||||||||
Sbjct: 283 gcagaatccgggatcttcctgttgtaactctgttgtagctgaattcaattcccaaagatg 224

                                                            
Query: 363 aaccgccgaacgaggaggcagaggtgaaggcgagcgacgccgagaccgc 411
           ||||  | || |||||||||||||||||||  |||||||||||||||||
Sbjct: 223 aaccagcaaatgaggaggcagaggtgaaggtcagcgacgccgagaccgc 175



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 97/116 (83%)
 Strand = Plus / Minus

                                                                       
Query: 464 gagctccggagaaacggggaggcggaggcccccatggggccagccttatgggggcggaga 523
           ||||||||||| ||||||| ||||| ||| ||||| |||   ||| |  | | |||||| 
Sbjct: 116 gagctccggaggaacggggtggcggcggcgcccatcggggatgccctgcgagagcggagg 57

                                                                   
Query: 524 ccgccgccgatagccaccgccgagatcctcccggagtggagcgagagggacgccat 579
           ||||||||||||||| |||| |||||||||||||||||||| ||||| | ||||||
Sbjct: 56  ccgccgccgatagccgccgctgagatcctcccggagtggagtgagagagccgccat 1
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  159 bits (80), Expect = 1e-35
 Identities = 203/244 (83%)
 Strand = Plus / Plus

                                                                            
Query: 123      tcccagtgggtgagtttgactttgtgcagaggatcttccttcctttgtcacgtctacgct 182
                |||||||||| ||||| | |||||||||||| | | | ||||||||| | ||||| ||||
Sbjct: 34127268 tcccagtgggggagttcgtctttgtgcagagaacccttcttcctttggcgcgtctgcgct 34127327

                                                                            
Query: 183      tcagaacccttcttccagcagtagtccgcatccgccttcggaaaccatgcacacgggcaa 242
                |||| ||| ||||||| |||||||||| |||||| || || ||||||||   ||||||||
Sbjct: 34127328 tcaggacctttcttccggcagtagtcctcatccgtctgcgaaaaccatgtgtacgggcaa 34127387

                                                                            
Query: 243      gtgacttcctagatcttgacctcttagtcaggcagagggcagcctttccggccctaatct 302
                | ||||||||||||||    ||||| |||| ||| || ||||||||||| ||||||||||
Sbjct: 34127388 gcgacttcctagatctatttctcttggtcatgcacagagcagcctttccagccctaatct 34127447

                                                                            
Query: 303      gtagaccacgaggtcttcgtgttgttaatctgttgtaactgaactcaattcccaaagatg 362
                | |||   || | ||||| |||||| | ||||||||| ||||| ||||||||||||||||
Sbjct: 34127448 gcagaatccgggatcttcctgttgtaactctgttgtagctgaattcaattcccaaagatg 34127507

                    
Query: 363      aacc 366
                ||||
Sbjct: 34127508 aacc 34127511



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 117/140 (83%)
 Strand = Plus / Plus

                                                                            
Query: 464      gagctccggagaaacggggaggcggaggcccccatggggccagccttatgggggcggaga 523
                ||||||||||| ||||||| ||||| ||| ||||| |||   ||| |  | | |||||| 
Sbjct: 34128729 gagctccggaggaacggggtggcggcggcgcccatcggggatgccctgcgagagcggagg 34128788

                                                                            
Query: 524      ccgccgccgatagccaccgccgagatcctcccggagtggagcgagagggacgccattggg 583
                ||||||||||||||| |||| |||||||||||||||||||| ||||| | ||||||||| 
Sbjct: 34128789 ccgccgccgatagccgccgctgagatcctcccggagtggagtgagagagccgccattggc 34128848

                                    
Query: 584      gaggcgagggcaaacgccat 603
                ||| ||||||| | ||||||
Sbjct: 34128849 gagacgagggcgagcgccat 34128868



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                      
Query: 374      gaggaggcagaggtgaaggcgagcgacgccgagaccgc 411
                |||||||||||||||||||  |||||||||||||||||
Sbjct: 34128633 gaggaggcagaggtgaaggtcagcgacgccgagaccgc 34128670
to top
>dbj|AP003232.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0034E02
          Length = 165497

 Score =  159 bits (80), Expect = 1e-35
 Identities = 203/244 (83%)
 Strand = Plus / Plus

                                                                          
Query: 123    tcccagtgggtgagtttgactttgtgcagaggatcttccttcctttgtcacgtctacgct 182
              |||||||||| ||||| | |||||||||||| | | | ||||||||| | ||||| ||||
Sbjct: 123746 tcccagtgggggagttcgtctttgtgcagagaacccttcttcctttggcgcgtctgcgct 123805

                                                                          
Query: 183    tcagaacccttcttccagcagtagtccgcatccgccttcggaaaccatgcacacgggcaa 242
              |||| ||| ||||||| |||||||||| |||||| || || ||||||||   ||||||||
Sbjct: 123806 tcaggacctttcttccggcagtagtcctcatccgtctgcgaaaaccatgtgtacgggcaa 123865

                                                                          
Query: 243    gtgacttcctagatcttgacctcttagtcaggcagagggcagcctttccggccctaatct 302
              | ||||||||||||||    ||||| |||| ||| || ||||||||||| ||||||||||
Sbjct: 123866 gcgacttcctagatctatttctcttggtcatgcacagagcagcctttccagccctaatct 123925

                                                                          
Query: 303    gtagaccacgaggtcttcgtgttgttaatctgttgtaactgaactcaattcccaaagatg 362
              | |||   || | ||||| |||||| | ||||||||| ||||| ||||||||||||||||
Sbjct: 123926 gcagaatccgggatcttcctgttgtaactctgttgtagctgaattcaattcccaaagatg 123985

                  
Query: 363    aacc 366
              ||||
Sbjct: 123986 aacc 123989



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 117/140 (83%)
 Strand = Plus / Plus

                                                                          
Query: 464    gagctccggagaaacggggaggcggaggcccccatggggccagccttatgggggcggaga 523
              ||||||||||| ||||||| ||||| ||| ||||| |||   ||| |  | | |||||| 
Sbjct: 125207 gagctccggaggaacggggtggcggcggcgcccatcggggatgccctgcgagagcggagg 125266

                                                                          
Query: 524    ccgccgccgatagccaccgccgagatcctcccggagtggagcgagagggacgccattggg 583
              ||||||||||||||| |||| |||||||||||||||||||| ||||| | ||||||||| 
Sbjct: 125267 ccgccgccgatagccgccgctgagatcctcccggagtggagtgagagagccgccattggc 125326

                                  
Query: 584    gaggcgagggcaaacgccat 603
              ||| ||||||| | ||||||
Sbjct: 125327 gagacgagggcgagcgccat 125346



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                    
Query: 374    gaggaggcagaggtgaaggcgagcgacgccgagaccgc 411
              |||||||||||||||||||  |||||||||||||||||
Sbjct: 125111 gaggaggcagaggtgaaggtcagcgacgccgagaccgc 125148
to top
>emb|CR555306.1| Azoarcus sp. EbN1 complete genome
          Length = 4296230

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 384    aggtgaaggcgagcgacgccgaga 407
              ||||||||||||||||||||||||
Sbjct: 544642 aggtgaaggcgagcgacgccgaga 544619
to top
>gb|AC010092.4| Homo sapiens BAC clone RP11-306M1 from 2, complete sequence
          Length = 140226

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 478   cggggaggcggaggcccccatggg 501
             ||||||||||||||||||||||||
Sbjct: 99971 cggggaggcggaggcccccatggg 99948
to top
>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence
          Length = 3181762

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 531     cgatagccaccgccgagatcctc 553
               |||||||||||||||||||||||
Sbjct: 2869207 cgatagccaccgccgagatcctc 2869185
to top
>gb|U70855.2| Caenorhabditis elegans cosmid K08F11, complete sequence
          Length = 26520

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 374   gaggaggcagaggtgaaggcga 395
             ||||||||||||||||||||||
Sbjct: 25102 gaggaggcagaggtgaaggcga 25081
to top
>gb|AC112270.3| Mus musculus BAC clone RP24-117A22 from 5, complete sequence
          Length = 180594

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 184   cagaacccttcttccagcagta 205
             ||||||||||||||||||||||
Sbjct: 77341 cagaacccttcttccagcagta 77320
to top
>ref|NM_058707.3| Caenorhabditis elegans LiPid Depleted family member (lpd-6) (lpd-6)
            mRNA, complete cds
          Length = 1824

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 374  gaggaggcagaggtgaaggcga 395
            ||||||||||||||||||||||
Sbjct: 1147 gaggaggcagaggtgaaggcga 1168
to top
>gb|AC024864.1|AC024864 Caenorhabditis elegans clone Y74C9A, complete sequence
          Length = 47629

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 374   gaggaggcagaggtgaaggcga 395
             ||||||||||||||||||||||
Sbjct: 23274 gaggaggcagaggtgaaggcga 23253
to top
>gb|AF043700.1| Caenorhabditis elegans cosmid K09H9, complete sequence
          Length = 37881

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 374   gaggaggcagaggtgaaggcga 395
             ||||||||||||||||||||||
Sbjct: 23249 gaggaggcagaggtgaaggcga 23228
to top
>gb|AC024206.1| Caenorhabditis elegans cosmid Y74C9A, complete sequence
          Length = 47629

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 374   gaggaggcagaggtgaaggcga 395
             ||||||||||||||||||||||
Sbjct: 23274 gaggaggcagaggtgaaggcga 23253
to top
>gb|AC151721.2| Mus musculus BAC clone RP23-68E12 from 5, complete sequence
          Length = 218524

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 184    cagaacccttcttccagcagta 205
              ||||||||||||||||||||||
Sbjct: 186895 cagaacccttcttccagcagta 186874
to top
>gb|AC098829.3| Homo sapiens BAC clone RP11-665G4 from 4, complete sequence
          Length = 176778

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 248   ttcctagatcttgacctctta 268
             |||||||||||||||||||||
Sbjct: 61118 ttcctagatcttgacctctta 61138
to top
>emb|AL163528.8|HS109K15 Homo sapiens chromosome 9 BAC RP11-109K15, complete sequence
          Length = 184517

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 66     gtaaaacttacagctggaata 86
              |||||||||||||||||||||
Sbjct: 145116 gtaaaacttacagctggaata 145136
to top
>emb|AL442637.4|HS495L19 Homo sapiens chromosome 9 BAC RP11-495L19, complete sequence
          Length = 180915

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 66     gtaaaacttacagctggaata 86
              |||||||||||||||||||||
Sbjct: 135130 gtaaaacttacagctggaata 135110
to top
>gb|AC087899.40| Mus musculus strain C57BL/6J chromosome 19 clone rp23-170m6, complete
             sequence
          Length = 194291

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 269   gtcaggcagagggcagccttt 289
             |||||||||||||||||||||
Sbjct: 80421 gtcaggcagagggcagccttt 80401
to top
>gb|AC169037.4| Mus musculus BAC clone RP23-85E20 from chromosome 16, complete sequence
          Length = 184591

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 269    gtcaggcagagggcagccttt 289
              |||||||||||||||||||||
Sbjct: 118921 gtcaggcagagggcagccttt 118941
to top
>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 383     gaggtgaaggcgagcgacgccgagaccg 410
               |||||| ||||| |||||||||||||||
Sbjct: 1585085 gaggtgcaggcgcgcgacgccgagaccg 1585058
to top
>gb|AC124353.5| Mus musculus BAC clone RP24-481I14 from chromosome 12, complete
             sequence
          Length = 152881

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 374   gaggaggcagaggtgaaggc 393
             ||||||||||||||||||||
Sbjct: 72584 gaggaggcagaggtgaaggc 72565
to top
>gb|AY658369.1| Synthetic construct Peudomonas aeruginosa clone FLH031529.01F
           PA2149 gene, partial cds
          Length = 243

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 394 gagcgacgccgagaccgcagccga 417
           |||||||||||||||||| |||||
Sbjct: 147 gagcgacgccgagaccgccgccga 170
to top
>emb|AL929439.6| Mouse DNA sequence from clone RP23-207J10 on chromosome 11, complete
            sequence
          Length = 7130

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 338  taactgaactcaattcccaa 357
            ||||||||||||||||||||
Sbjct: 4819 taactgaactcaattcccaa 4838
to top
>emb|CR860965.1| Pongo pygmaeus mRNA; cDNA DKFZp469E1114 (from clone DKFZp469E1114)
          Length = 1500

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 271  caggcagagggcagcctttc 290
            ||||||||||||||||||||
Sbjct: 1051 caggcagagggcagcctttc 1070
to top
>gb|AE012265.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 173
            of 460 of the complete genome
          Length = 10029

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 382  agaggtgaaggcgagcgacg 401
            ||||||||||||||||||||
Sbjct: 8439 agaggtgaaggcgagcgacg 8458
to top
>gb|AC027271.7| Homo sapiens BAC clone RP11-365H22 from 4, complete sequence
          Length = 177985

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 4      gggaaaagatgtgcagcaat 23
              ||||||||||||||||||||
Sbjct: 129980 gggaaaagatgtgcagcaat 129961
to top
>gb|AF277846.2|AF277846 Pinus taeda clone 51k4f microsatellite PtTX3002 sequence
          Length = 386

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 374 gaggaggcagaggtgaaggc 393
           ||||||||||||||||||||
Sbjct: 309 gaggaggcagaggtgaaggc 328
to top
>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome
          Length = 5148708

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 382     agaggtgaaggcgagcgacg 401
               ||||||||||||||||||||
Sbjct: 3123852 agaggtgaaggcgagcgacg 3123833
to top
>ref|NM_075536.1| Caenorhabditis elegans B0250.8 (B0250.8) mRNA, complete cds
          Length = 885

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 374 gaggaggcagaggtgaaggc 393
           ||||||||||||||||||||
Sbjct: 214 gaggaggcagaggtgaaggc 233
to top
>ref|XM_395593.2| PREDICTED: Apis mellifera similar to CG3707-PA, isoform A
           (LOC412129), mRNA
          Length = 3492

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 55  gtgcaaaaagagtaaaactt 74
           ||||||||||||||||||||
Sbjct: 224 gtgcaaaaagagtaaaactt 243
to top
>gb|DP000024.1| Eulemur macaco macaco target 1 genomic scaffold
          Length = 1570569

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 98     acattgcgctgtaatcaata 117
              ||||||||||||||||||||
Sbjct: 944054 acattgcgctgtaatcaata 944035
to top
>gb|AC068491.4| Homo sapiens BAC clone RP11-803D5 from 2, complete sequence
          Length = 176551

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 272    aggcagagggcagcctttcc 291
              ||||||||||||||||||||
Sbjct: 172478 aggcagagggcagcctttcc 172459
to top
>gb|AC073896.41| Homo sapiens 12 BAC RP11-977G19 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 174487

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 271   caggcagagggcagcctttc 290
             ||||||||||||||||||||
Sbjct: 46733 caggcagagggcagcctttc 46714
to top
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 540     ccgccgagatcctcccggag 559
               ||||||||||||||||||||
Sbjct: 7685874 ccgccgagatcctcccggag 7685893
to top
>gb|AE004642.1| Pseudomonas aeruginosa PAO1, section 203 of 529 of the complete
            genome
          Length = 17863

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 394  gagcgacgccgagaccgcagccga 417
            |||||||||||||||||| |||||
Sbjct: 3536 gagcgacgccgagaccgccgccga 3559
to top
>gb|AC093616.5| Homo sapiens BAC clone RP13-511M20 from 2, complete sequence
          Length = 192494

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 272   aggcagagggcagcctttcc 291
             ||||||||||||||||||||
Sbjct: 32829 aggcagagggcagcctttcc 32810
to top
>gb|AC145419.3| Dasypus novemcinctus clone VMRC5-468K1, complete sequence
          Length = 151116

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 374   gaggaggcagaggtgaaggc 393
             ||||||||||||||||||||
Sbjct: 74856 gaggaggcagaggtgaaggc 74837
to top
>emb|CR354403.16| Zebrafish DNA sequence from clone CH211-196E8 in linkage group 9,
             complete sequence
          Length = 167419

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 69    aaacttacagctggaataca 88
             ||||||||||||||||||||
Sbjct: 45101 aaacttacagctggaataca 45120
to top
>emb|Z81453.1|CEB0250 Caenorhabditis elegans Cosmid B0250, complete sequence
          Length = 39216

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 374   gaggaggcagaggtgaaggc 393
             ||||||||||||||||||||
Sbjct: 15400 gaggaggcagaggtgaaggc 15381
to top
>gb|AC172859.1| Brassica rapa subsp. pekinensis clone KBrB023K01, complete sequence
          Length = 102061

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 133  tgagtttgactttgtgcaga 152
            ||||||||||||||||||||
Sbjct: 7777 tgagtttgactttgtgcaga 7758


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,488,783
Number of Sequences: 3902068
Number of extensions: 5488783
Number of successful extensions: 78912
Number of sequences better than 10.0: 39
Number of HSP's better than 10.0 without gapping: 39
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 78640
Number of HSP's gapped (non-prelim): 263
length of query: 606
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 583
effective length of database: 17,143,297,704
effective search space: 9994542561432
effective search space used: 9994542561432
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top