ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal35c16
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY105872.1| Zea mays PCO079046 mRNA sequence 86 2e-13
2dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 82 3e-12
3gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 82 3e-12
4emb|AL713927.3|CNS07YP4 Oryza sativa chromosome 12, . BAC OSJNBa... 82 3e-12
5gb|BT017471.1| Zea mays clone EL01N0408D01.c mRNA sequence 48 0.035
6gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, comple... 46 0.14
7emb|BX005072.20| Human DNA sequence from clone XXyac-59F3 on chr... 44 0.55
8emb|AL450334.15| Human DNA sequence from clone RP11-556L1 on chr... 44 0.55
9gb|AC013284.9| Homo sapiens chromosome 10 clone RP11-13E1, compl... 44 0.55
10gb|AC026739.7| Homo sapiens chromosome 5 clone CTD-2580L4, compl... 44 0.55
11ref|NM_101374.2| Arabidopsis thaliana unknown protein AT1G15040 ... 42 2.2
12gb|AE014843.1| Plasmodium falciparum 3D7 chromosome 11 section 8... 42 2.2
13emb|AL590995.14| Human DNA sequence from clone RP11-475B22 on ch... 42 2.2
14emb|AL590673.6| Human DNA sequence from clone RP11-202K9 on chro... 42 2.2
15gb|AF332456.1| Arabidopsis thaliana clone C00162 (e) unknown pro... 42 2.2
16emb|BX817147.1|CNS0AD8C Arabidopsis thaliana Full-length cDNA Co... 42 2.2
17dbj|AB205497.1| Uncultured bacterium gene for putative aminotran... 42 2.2
18gb|AC106819.3| Homo sapiens chromosome 16 clone RP11-696P19, com... 42 2.2
19gb|AC012189.3|T15D22 Arabidopsis thaliana chromosome 1 BAC T15D2... 42 2.2
20ref|NM_214275.1| Sus scrofa formiminotransferase-cyclodeaminase ... 42 2.2
21gb|L16507.1|PIGFORM Sus scrofa formiminotransferase-cyclodeamina... 42 2.2
22gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 40 8.5
23gb|AC121851.4| Mus musculus chromosome 8 clone RP24-92F5, comple... 40 8.5
24gb|DQ213674.1| Taeniopygia guttata clone 0058P0016A03 Traf and T... 40 8.5
25gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence 40 8.5
26gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, co... 40 8.5
27gb|BC044759.2| Mus musculus progesterone receptor membrane compo... 40 8.5
28ref|XM_987808.1| PREDICTED: Mus musculus progesterone receptor m... 40 8.5
29ref|XM_130859.8| PREDICTED: Mus musculus progesterone receptor m... 40 8.5
30ref|XM_911696.2| PREDICTED: Mus musculus progesterone receptor m... 40 8.5
31gb|AC102769.11| Mus musculus chromosome 17, clone RP23-89A3, com... 40 8.5
32gb|AC124434.3| Mus musculus BAC clone RP24-250K22 from chromosom... 40 8.5
33gb|AC146133.3| Pan troglodytes BAC clone RP43-38C10 from 7, comp... 40 8.5
34gb|AC006044.2| Homo sapiens BAC clone RP11-539B24 from 7, comple... 40 8.5
35gb|AC100511.12| Mus musculus chromosome 3, clone RP23-144N19, co... 40 8.5
36gb|AC117573.9| Mus musculus chromosome 3, clone RP23-30D1, compl... 40 8.5
37emb|AL356953.17| Human DNA sequence from clone RP11-572A16 on ch... 40 8.5
38gb|AC116459.8| Mus musculus, clone RP23-35F4, complete sequence 40 8.5
39gb|AF542968.1| Triticum aestivum myo-inositol 1-phosphate syntha... 40 8.5
40emb|AL022149.2|HS122K23 Human DNA sequence from clone RP1-122K23... 40 8.5
41gb|BT009043.1| Triticum aestivum clone wdk5c.pk006.i16:fis, full... 40 8.5
42emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromos... 40 8.5
43gb|AC127387.3| Homo sapiens BAC clone RP11-28J3 from UL, complet... 40 8.5
44dbj|AK140064.1| Mus musculus adult male corpora quadrigemina cDN... 40 8.5
45dbj|AK165560.1| Mus musculus brain CRL-1443 BC3H1 cDNA, RIKEN fu... 40 8.5
46gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, comp... 40 8.5
47dbj|AK014543.1| Mus musculus 0 day neonate skin cDNA, RIKEN full... 40 8.5
48gb|AC007600.6| Homo sapiens chromosome 16 clone RP11-264A16, com... 40 8.5
49gb|AC147274.3| Pan troglodytes BAC clone RP43-113D16 from chromo... 40 8.5
50dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome 40 8.5
51emb|BX842238.2| Mouse DNA sequence from clone RP24-159M2 on chro... 40 8.5
52gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, co... 40 8.5
53gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete... 40 8.5
54gb|AF056325.1|AF056325 Hordeum vulgare myo-inositol 1-phosphate ... 40 8.5
55emb|CT025641.10| Mouse DNA sequence from clone RP24-322A17 on ch... 40 8.5

>gb|AY105872.1| Zea mays PCO079046 mRNA sequence
          Length = 1346

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 79/91 (86%)
 Strand = Plus / Minus

                                                                       
Query: 516 ccaccggcgtcgcgttcatgtagaacatgtagaggaccatctggatcatcccgaaggtga 575
           |||||||||||  |||||||||||||| |||||| |||||||||| ||  |||||| |||
Sbjct: 902 ccaccggcgtcttgttcatgtagaacacgtagagcaccatctggaccacgccgaagatga 843

                                          
Query: 576 agccaaggatgtttgggagcgcgacgtattt 606
           | || |||| |||||| ||||||||||||||
Sbjct: 842 accccaggacgtttggaagcgcgacgtattt 812



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 65/73 (89%)
 Strand = Plus / Plus

                                                                            
Query: 516      ccaccggcgtcgcgttcatgtagaacatgtagaggaccatctggatcatcccgaaggtga 575
                ||||||||||||||||||||||||||| ||||||  ||||||||| ||  ||||| ||||
Sbjct: 17343809 ccaccggcgtcgcgttcatgtagaacacgtagagccccatctggaccacaccgaatgtga 17343868

                             
Query: 576      agccaaggatgtt 588
                |||| ||||||||
Sbjct: 17343869 agcccaggatgtt 17343881



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 65/73 (89%)
 Strand = Plus / Plus

                                                                            
Query: 516      ccaccggcgtcgcgttcatgtagaacatgtagaggaccatctggatcatcccgaaggtga 575
                ||||||||||||||||||||||||||| ||||||  ||||||||| ||  ||||| ||||
Sbjct: 17298180 ccaccggcgtcgcgttcatgtagaacacgtagagccccatctggaccacaccgaatgtga 17298239

                             
Query: 576      agccaaggatgtt 588
                |||| ||||||||
Sbjct: 17298240 agcccaggatgtt 17298252



to top

>emb|AL713927.3|CNS07YP4 Oryza sativa chromosome 12, . BAC OSJNBa0021B03 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 154826

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 65/73 (89%)
 Strand = Plus / Minus

                                                                         
Query: 516   ccaccggcgtcgcgttcatgtagaacatgtagaggaccatctggatcatcccgaaggtga 575
             ||||||||||||||||||||||||||| ||||||  ||||||||| ||  ||||| ||||
Sbjct: 59560 ccaccggcgtcgcgttcatgtagaacacgtagagccccatctggaccacaccgaatgtga 59501

                          
Query: 576   agccaaggatgtt 588
             |||| ||||||||
Sbjct: 59500 agcccaggatgtt 59488



to top

>gb|BT017471.1| Zea mays clone EL01N0408D01.c mRNA sequence
          Length = 1159

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 53/60 (88%), Gaps = 2/60 (3%)
 Strand = Plus / Minus

                                                                       
Query: 566 ccgaaggtgaagccaaggatgtttgggagcgcgacgtattttgtcccttgatgagcaggc 625
           |||||||||||||| || | |||||| || |||||||| ||||| |||||||||||||||
Sbjct: 487 ccgaaggtgaagccgagcacgtttggcagggcgacgta-tttgt-ccttgatgagcaggc 430



to top

>gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, complete genome
          Length = 3561584

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                              
Query: 435     ccttgccgacgttgatcacgacgacgtggtc 465
               ||||| || ||||||||||||||||||||||
Sbjct: 3505081 ccttgtcggcgttgatcacgacgacgtggtc 3505111



to top

>emb|BX005072.20| Human DNA sequence from clone XXyac-59F3 on chromosome 10 Contains the
             5' end of a novel gene, a novel gene (MGC35285) and a CpG
             island, complete sequence
          Length = 97407

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 477   ccttccatgcctctttcccctccttg 502
             |||||||| |||||||||||||||||
Sbjct: 44275 ccttccatacctctttcccctccttg 44250



to top

>emb|AL450334.15| Human DNA sequence from clone RP11-556L1 on chromosome 10 Contains gene
             DKFZP566K0524, the gene for a novel protein similar to
             tyrosine phosphatase (MGC35285), the 3' end of a KIAA0187
             pseudogene, the 3' end of a novel gene, the gene for a
             novel protein similar to ARF GTPase-activating protein
             (MRIP2) and a CpG island, complete sequence
          Length = 171930

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 477   ccttccatgcctctttcccctccttg 502
             |||||||| |||||||||||||||||
Sbjct: 63794 ccttccatacctctttcccctccttg 63769



to top

>gb|AC013284.9| Homo sapiens chromosome 10 clone RP11-13E1, complete sequence
          Length = 154259

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 477   ccttccatgcctctttcccctccttg 502
             |||||||| |||||||||||||||||
Sbjct: 97949 ccttccatacctctttcccctccttg 97974



to top

>gb|AC026739.7| Homo sapiens chromosome 5 clone CTD-2580L4, complete sequence
          Length = 186308

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 477   ccttccatgcctctttcccctccttg 502
             |||||||| |||||||||||||||||
Sbjct: 61153 ccttccatacctctttcccctccttg 61128



to top

>ref|NM_101374.2| Arabidopsis thaliana unknown protein AT1G15040 transcript variant
            AT1G15040.2 mRNA, complete cds
          Length = 1753

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 150  gtttgttttacatacatacag 170
            |||||||||||||||||||||
Sbjct: 992  gtttgttttacatacatacag 1012



to top

>gb|AE014843.1| Plasmodium falciparum 3D7 chromosome 11 section 8 of 8 of the complete
             sequence
          Length = 271546

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 201   aatattatttttcttggaaaa 221
             |||||||||||||||||||||
Sbjct: 37263 aatattatttttcttggaaaa 37243



to top

>emb|AL590995.14| Human DNA sequence from clone RP11-475B22 on chromosome 6, complete
           sequence
          Length = 113362

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 148 tagtttgttttacatacatacagta 172
           |||||||||||||||| ||||||||
Sbjct: 402 tagtttgttttacataaatacagta 378



to top

>emb|AL590673.6| Human DNA sequence from clone RP11-202K9 on chromosome 6, complete
              sequence
          Length = 123236

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 148    tagtttgttttacatacatacagta 172
              |||||||||||||||| ||||||||
Sbjct: 121638 tagtttgttttacataaatacagta 121614



to top

>gb|AF332456.1| Arabidopsis thaliana clone C00162 (e) unknown protein (At1g15045)
           mRNA, complete cds
          Length = 1002

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 150 gtttgttttacatacatacag 170
           |||||||||||||||||||||
Sbjct: 933 gtttgttttacatacatacag 953



to top

>emb|BX817147.1|CNS0AD8C Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH89ZF09 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1446

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 150  gtttgttttacatacatacag 170
            |||||||||||||||||||||
Sbjct: 988  gtttgttttacatacatacag 1008



to top

>dbj|AB205497.1| Uncultured bacterium gene for putative aminotransferase, partial
           cds, clone:sd2
          Length = 303

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 513 ccaccaccggcgtcgcgttca 533
           |||||||||||||||||||||
Sbjct: 56  ccaccaccggcgtcgcgttca 36



to top

>gb|AC106819.3| Homo sapiens chromosome 16 clone RP11-696P19, complete sequence
          Length = 122793

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 120   gaatcatacggaatcatcatc 140
             |||||||||||||||||||||
Sbjct: 61198 gaatcatacggaatcatcatc 61218



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 120  gaatcatacggaatcatcatc 140
            |||||||||||||||||||||
Sbjct: 1912 gaatcatacggaatcatcatc 1892



 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 120   gaatcatacggaatcatcat 139
             ||||||||||||||||||||
Sbjct: 59837 gaatcatacggaatcatcat 59856



to top

>gb|AC012189.3|T15D22 Arabidopsis thaliana chromosome 1 BAC T15D22 sequence, complete
             sequence
          Length = 23652

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 150   gtttgttttacatacatacag 170
             |||||||||||||||||||||
Sbjct: 19365 gtttgttttacatacatacag 19345



to top

>ref|NM_214275.1| Sus scrofa formiminotransferase-cyclodeaminase (FTCD), mRNA
          Length = 1843

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 336  agcccgcccccggggccgccg 356
            |||||||||||||||||||||
Sbjct: 1099 agcccgcccccggggccgccg 1079



to top

>gb|L16507.1|PIGFORM Sus scrofa formiminotransferase-cyclodeaminase mRNA, complete cds
          Length = 1843

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 336  agcccgcccccggggccgccg 356
            |||||||||||||||||||||
Sbjct: 1099 agcccgcccccggggccgccg 1079



to top

>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 394    ctcggtgaccgggcgcacctcggc 417
              |||| |||||||||||||||||||
Sbjct: 976390 ctcgatgaccgggcgcacctcggc 976367



to top

>gb|AC121851.4| Mus musculus chromosome 8 clone RP24-92F5, complete sequence
          Length = 184603

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 44     ttgcgaacattgatgggctg 63
              ||||||||||||||||||||
Sbjct: 127907 ttgcgaacattgatgggctg 127926



to top

>gb|DQ213674.1| Taeniopygia guttata clone 0058P0016A03 Traf and Tnf receptor
           associated protein-like mRNA, complete sequence
          Length = 1381

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 48  gaacattgatgggctggatc 67
           ||||||||||||||||||||
Sbjct: 275 gaacattgatgggctggatc 294



to top

>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence
          Length = 3587082

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 520     cggcgtcgcgttcatgtaga 539
               ||||||||||||||||||||
Sbjct: 2170327 cggcgtcgcgttcatgtaga 2170308



to top

>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence
          Length = 3181762

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 520     cggcgtcgcgttcatgtaga 539
               ||||||||||||||||||||
Sbjct: 2300040 cggcgtcgcgttcatgtaga 2300059



to top

>gb|BC044759.2| Mus musculus progesterone receptor membrane component 2, mRNA (cDNA
            clone IMAGE:5061936), partial cds
          Length = 2951

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 207  atttttcttggaaaagaaaa 226
            ||||||||||||||||||||
Sbjct: 1580 atttttcttggaaaagaaaa 1561



to top

>ref|XM_987808.1| PREDICTED: Mus musculus progesterone receptor membrane component 2
            (Pgrmc2), mRNA
          Length = 3017

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 207  atttttcttggaaaagaaaa 226
            ||||||||||||||||||||
Sbjct: 1649 atttttcttggaaaagaaaa 1630



to top

>ref|XM_130859.8| PREDICTED: Mus musculus progesterone receptor membrane component 2,
            transcript variant 1 (Pgrmc2), mRNA
          Length = 3017

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 207  atttttcttggaaaagaaaa 226
            ||||||||||||||||||||
Sbjct: 1649 atttttcttggaaaagaaaa 1630



to top

>ref|XM_911696.2| PREDICTED: Mus musculus progesterone receptor membrane component 2,
            transcript variant 3 (Pgrmc2), mRNA
          Length = 3017

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 207  atttttcttggaaaagaaaa 226
            ||||||||||||||||||||
Sbjct: 1649 atttttcttggaaaagaaaa 1630



to top

>gb|AC102769.11| Mus musculus chromosome 17, clone RP23-89A3, complete sequence
          Length = 162417

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 67     cgtggtctataaacacacagaata 90
              |||||| |||||||||||||||||
Sbjct: 105757 cgtggtatataaacacacagaata 105734



to top

>gb|AC124434.3| Mus musculus BAC clone RP24-250K22 from chromosome 8, complete sequence
          Length = 167741

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 44    ttgcgaacattgatgggctg 63
             ||||||||||||||||||||
Sbjct: 55387 ttgcgaacattgatgggctg 55406



to top

>gb|AC146133.3| Pan troglodytes BAC clone RP43-38C10 from 7, complete sequence
          Length = 168763

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 120    gaatcatacggaatcatcat 139
              ||||||||||||||||||||
Sbjct: 143265 gaatcatacggaatcatcat 143284



to top

>gb|AC006044.2| Homo sapiens BAC clone RP11-539B24 from 7, complete sequence
          Length = 141509

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 258   ctcatgcatgagccatgcat 277
             ||||||||||||||||||||
Sbjct: 65253 ctcatgcatgagccatgcat 65234



to top

>gb|AC100511.12| Mus musculus chromosome 3, clone RP23-144N19, complete sequence
          Length = 200790

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 207   atttttcttggaaaagaaaa 226
             ||||||||||||||||||||
Sbjct: 40220 atttttcttggaaaagaaaa 40239



to top

>gb|AC117573.9| Mus musculus chromosome 3, clone RP23-30D1, complete sequence
          Length = 239439

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 151    tttgttttacatacatacag 170
              ||||||||||||||||||||
Sbjct: 216401 tttgttttacatacatacag 216382



to top

>emb|AL356953.17| Human DNA sequence from clone RP11-572A16 on chromosome 1 Contains the
             3' end of a pseudogene similar to Mus musculus protein
             tyrosine phosphatase receptor type V Ptprv, the LGR6 gene
             for leucine-rich repeat-containing G protein-coupled
             receptor 6, the gene for a ubiquitin conjugating enzyme,
             the 5' end of the PPP1R12B gene for protein phosphatase 1
             regulatory (inhibitor) subunit 12B and four CpG islands,
             complete sequence
          Length = 177344

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 338   cccgcccccggggccgccgc 357
             ||||||||||||||||||||
Sbjct: 31515 cccgcccccggggccgccgc 31534



to top

>gb|AC116459.8| Mus musculus, clone RP23-35F4, complete sequence
          Length = 215030

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 151   tttgttttacatacatacag 170
             ||||||||||||||||||||
Sbjct: 25848 tttgttttacatacatacag 25829



to top

>gb|AF542968.1| Triticum aestivum myo-inositol 1-phosphate synthase-like mRNA,
           partial sequence
          Length = 819

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 446 ttgatcacgacgacgtggtc 465
           ||||||||||||||||||||
Sbjct: 377 ttgatcacgacgacgtggtc 358



to top

>emb|AL022149.2|HS122K23 Human DNA sequence from clone RP1-122K23 on chromosome Xq21.21-22.1,
             complete sequence
          Length = 122777

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 200   gaatattatttttcttggaa 219
             ||||||||||||||||||||
Sbjct: 58941 gaatattatttttcttggaa 58922



to top

>gb|BT009043.1| Triticum aestivum clone wdk5c.pk006.i16:fis, full insert mRNA
           sequence
          Length = 790

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 446 ttgatcacgacgacgtggtc 465
           ||||||||||||||||||||
Sbjct: 54  ttgatcacgacgacgtggtc 35



to top

>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence
          Length = 3173005

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 520    cggcgtcgcgttcatgtaga 539
              ||||||||||||||||||||
Sbjct: 461518 cggcgtcgcgttcatgtaga 461537



to top

>gb|AC127387.3| Homo sapiens BAC clone RP11-28J3 from UL, complete sequence
          Length = 47702

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 120   gaatcatacggaatcatcat 139
             ||||||||||||||||||||
Sbjct: 18340 gaatcatacggaatcatcat 18321



to top

>dbj|AK140064.1| Mus musculus adult male corpora quadrigemina cDNA, RIKEN full-length
            enriched library, clone:B230117D02 product:progesterone
            receptor membrane component 2, full insert sequence
          Length = 2972

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 207  atttttcttggaaaagaaaa 226
            ||||||||||||||||||||
Sbjct: 1619 atttttcttggaaaagaaaa 1600



to top

>dbj|AK165560.1| Mus musculus brain CRL-1443 BC3H1 cDNA, RIKEN full-length enriched
           library, clone:G430007N18 product:progesterone receptor
           membrane component 2, full insert sequence
          Length = 1019

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 207 atttttcttggaaaagaaaa 226
           ||||||||||||||||||||
Sbjct: 822 atttttcttggaaaagaaaa 803



to top

>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence
          Length = 2325379

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 520     cggcgtcgcgttcatgtaga 539
               ||||||||||||||||||||
Sbjct: 1527026 cggcgtcgcgttcatgtaga 1527007



to top

>dbj|AK014543.1| Mus musculus 0 day neonate skin cDNA, RIKEN full-length enriched
            library, clone:4631434O19 product:MEMBRANE ASSOCIATED
            PROGESTERONE RECEPTOR COMPONENT 2 (PROGESTERONE MEMBRANE
            BINDING PROTEIN) (STEROID RECEPTOR PROTEIN DG6) homolog
            [Homo sapiens], full insert sequence
          Length = 2558

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 207  atttttcttggaaaagaaaa 226
            ||||||||||||||||||||
Sbjct: 1538 atttttcttggaaaagaaaa 1519



to top

>gb|AC007600.6| Homo sapiens chromosome 16 clone RP11-264A16, complete sequence
          Length = 183088

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 209   ttttcttggaaaagaaaaac 228
             ||||||||||||||||||||
Sbjct: 27202 ttttcttggaaaagaaaaac 27183



to top

>gb|AC147274.3| Pan troglodytes BAC clone RP43-113D16 from chromosome 7, complete
              sequence
          Length = 168606

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 202    atattatttttcttggaaaagaaa 225
              |||||||||||||| |||||||||
Sbjct: 164789 atattatttttctttgaaaagaaa 164812



to top

>dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome
          Length = 4659019

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 330     gggcaaagcccgcccccggggccg 353
               ||||||||||||||||||| ||||
Sbjct: 2551700 gggcaaagcccgcccccggcgccg 2551677



to top

>emb|BX842238.2| Mouse DNA sequence from clone RP24-159M2 on chromosome 2, complete
             sequence
          Length = 86221

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 482   catgcctctttcccctcctt 501
             ||||||||||||||||||||
Sbjct: 77280 catgcctctttcccctcctt 77261



to top

>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence
          Length = 2914771

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 520     cggcgtcgcgttcatgtaga 539
               ||||||||||||||||||||
Sbjct: 2522300 cggcgtcgcgttcatgtaga 2522281



to top

>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence
          Length = 2648638

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 423     agctcttgtcggccttgccg 442
               ||||||||||||||||||||
Sbjct: 2085171 agctcttgtcggccttgccg 2085152



to top

>gb|AF056325.1|AF056325 Hordeum vulgare myo-inositol 1-phosphate synthase mRNA, complete cds
          Length = 2152

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 446  ttgatcacgacgacgtggtc 465
            ||||||||||||||||||||
Sbjct: 1302 ttgatcacgacgacgtggtc 1283



to top

>emb|CT025641.10| Mouse DNA sequence from clone RP24-322A17 on chromosome 17, complete
             sequence
          Length = 122522

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 67    cgtggtctataaacacacagaata 90
             |||||| |||||||||||||||||
Sbjct: 23715 cgtggtatataaacacacagaata 23692


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,756,960
Number of Sequences: 3902068
Number of extensions: 5756960
Number of successful extensions: 115708
Number of sequences better than 10.0: 55
Number of HSP's better than 10.0 without gapping: 55
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 115037
Number of HSP's gapped (non-prelim): 670
length of query: 625
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 602
effective length of database: 17,143,297,704
effective search space: 10320265217808
effective search space used: 10320265217808
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top