>gb|AC124579.3| Mus musculus BAC clone RP23-86P2 from chromosome 13, complete sequence
          Length = 167801

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 12    tacatttggtttaagagaaagc 33
             ||||||||||||||||||||||
Sbjct: 63939 tacatttggtttaagagaaagc 63918

>emb|AL162291.14| Human DNA sequence from clone RP11-402F1 on chromosome 20 Contains
            ESTs, STSs and GSSs, complete sequence
          Length = 98399

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 71   atcccaccccagaggcaaggaa 92
            ||||||||||||||||||||||
Sbjct: 3952 atcccaccccagaggcaaggaa 3931

>emb|AL607087.10| Mouse DNA sequence from clone RP23-18M1 on chromosome 4, complete
              sequence
          Length = 183786

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 364    gttgatctctgcttggcttctgaact 389
              |||| |||||||||||||||||||||
Sbjct: 139707 gttgctctctgcttggcttctgaact 139682

>gb|AY811039.1| Schistosoma japonicum SJCHGC06478 protein mRNA, partial cds
          Length = 708

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 258 agctgctggaggttggcaag 277
           ||||||||||||||||||||
Sbjct: 443 agctgctggaggttggcaag 462

>gb|AC113454.8| Mus musculus chromosome 3, clone RP24-176I19, complete sequence
          Length = 171480

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 15    atttggtttaagagaaagct 34
             ||||||||||||||||||||
Sbjct: 11184 atttggtttaagagaaagct 11203

>emb|AL732395.9| Human DNA sequence from clone RP11-77F5 on chromosome 10 Contains the
             3' end of the gene for uncharacterized hematopoietic
             stem/progenitor cells (MDS026), complete sequence
          Length = 54050

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 187   tcgtctgcagcctctccagg 206
             ||||||||||||||||||||
Sbjct: 30616 tcgtctgcagcctctccagg 30635

>emb|AL449264.18| Human DNA sequence from clone RP11-485H8 on chromosome 1 Contains the
             5' end of the CASQ2 gene for calsequestrin 2 (cardiac
             muscle), the NHLH2 gene for nescient helix loop helix 2, a
             heterogeneous nuclear ribonucleoprotein A1 (HNRPA1)
             pseudogene and two CpG islands, complete sequence
          Length = 164655

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 72    tcccaccccagaggcaagga 91
             ||||||||||||||||||||
Sbjct: 94445 tcccaccccagaggcaagga 94464

>emb|AL139413.11| Human DNA sequence from clone RP5-1033K19 on chromosome 1 Contains a
             transcription elongation factor B (SIII) polypeptide 1
             (15kDa, elongin C) (TCEB1) pseudogene, a pseudogene
             similar to part of BET1 homolog (S. cerevisiae) (BET1),
             the RPE65 gene for 65kDa retinal pigment
             epithelium-specific protein and the 3' end of the gene for
              cell cycle control protein SDP35 (SDP35), complete
             sequence
          Length = 103139

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 20    gtttaagagaaagctaaaaa 39
             ||||||||||||||||||||
Sbjct: 61584 gtttaagagaaagctaaaaa 61603

>emb|AL050349.27|HSDJ553F4 Human DNA sequence from clone RP4-553F4 on chromosome 20q11.21-13.13
              Contains the PXMP4 gene for peroxisomal membrane protein 4
              (24kDa), a novel gene, the ZNF341 gene for zinc finger
              protein 341, the C20orf178 gene encoding a protein similar
              to the Drosophila CG8055 protein, the RPL31P2 gene for
              ribosomal protein L31 pseudogene 2, the 3' end of a novel
              gene and two CpG islands, complete sequence
          Length = 155470

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 16     tttggtttaagagaaagcta 35
              ||||||||||||||||||||
Sbjct: 121572 tttggtttaagagaaagcta 121591

>gb|AC123178.4| Rattus norvegicus 7 BAC CH230-20I17 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 221236

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 9     caatacatttggtttaagag 28
             ||||||||||||||||||||
Sbjct: 72352 caatacatttggtttaagag 72333

>gb|AC092701.2| Homo sapiens chromosome 15, clone RP11-758M2, complete sequence
          Length = 171403

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 388   ctatctatggctttttcttccctc 411
             |||||||||||||||| |||||||
Sbjct: 37010 ctatctatggctttttattccctc 37033

>gb|AC092691.3| Homo sapiens 3q BAC RP11-768G7 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 170215

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 31    agctaaaaaacagagtatct 50
             ||||||||||||||||||||
Sbjct: 31946 agctaaaaaacagagtatct 31927

>dbj|AP006336.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT07E09, TM0293,
              complete sequence
          Length = 113091

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 157    ttccaagtttccttcacaat 176
              ||||||||||||||||||||
Sbjct: 108474 ttccaagtttccttcacaat 108455

>gb|AC015779.8| Homo sapiens chromosome , clone RP11-2I13, complete sequence
          Length = 90727

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 371   tctgcttggcttctgaacta 390
             ||||||||||||||||||||
Sbjct: 72299 tctgcttggcttctgaacta 72280

>gb|AC008619.7| Homo sapiens chromosome 5 clone CTB-147C13, complete sequence
          Length = 91048

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 369   tctctgcttggcttctgaac 388
             ||||||||||||||||||||
Sbjct: 17393 tctctgcttggcttctgaac 17374

>gb|AC013603.17| Homo sapiens, clone RP11-10D7, complete sequence
          Length = 177839

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 371    tctgcttggcttctgaacta 390
              ||||||||||||||||||||
Sbjct: 154170 tctgcttggcttctgaacta 154189

>emb|CR387291.1| Gallus gallus finished cDNA, clone ChEST830a14
          Length = 926

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 337 ccaattcaagaagtatcagc 356
           ||||||||||||||||||||
Sbjct: 844 ccaattcaagaagtatcagc 863

>dbj|AP007265.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT11L01, TM1658,
             complete sequence
          Length = 99089

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 157   ttccaagtttccttcacaat 176
             ||||||||||||||||||||
Sbjct: 35978 ttccaagtttccttcacaat 35997


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,856,604
Number of Sequences: 3902068
Number of extensions: 3856604
Number of successful extensions: 76712
Number of sequences better than 10.0: 18
Number of HSP's better than 10.0 without gapping: 18
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 76682
Number of HSP's gapped (non-prelim): 30
length of query: 417
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 395
effective length of database: 17,147,199,772
effective search space: 6773143909940
effective search space used: 6773143909940
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)