ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal34k17
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AK060785.1| Oryza sativa (japonica cultivar-group) cDNA clon... 180 4e-42
2gb|AC104713.3| Oryza sativa (japonica cultivar-group) chromosome... 178 2e-41
3dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 178 2e-41
4dbj|AK071306.1| Oryza sativa (japonica cultivar-group) cDNA clon... 172 1e-39
5dbj|AK071703.1| Oryza sativa (japonica cultivar-group) cDNA clon... 115 2e-22
6ref|XM_475819.1| Oryza sativa (japonica cultivar-group), predic... 111 3e-21
7emb|AL929510.17| Mouse DNA sequence from clone RP23-241O13 on ch... 44 0.63
8dbj|AP006357.1| Lotus japonicus genomic DNA, chromosome 4, clone... 44 0.63
9emb|AL158832.13| Human DNA sequence from clone RP11-59O6 on chro... 42 2.5
10emb|BX571662.1| Wolinella succinogenes, complete genome; segment... 42 2.5
11emb|AL596209.13| Mouse DNA sequence from clone RP23-278F12 on ch... 42 2.5
12gb|AC092700.2| Homo sapiens chromosome 8, clone RP11-661A3, comp... 42 2.5
13gb|AC091195.6| Homo sapiens chromosome 8, clone RP11-814D21, com... 42 2.5
14emb|BX247879.5| Zebrafish DNA sequence from clone CH211-195N15, ... 42 2.5
15gb|AY769950.1| Homo sapiens coagulation factor VIII, procoagulan... 40 9.8
16gb|AC009394.5| Drosophila melanogaster clone BACR03J17, complete... 40 9.8
17ref|NG_005114.1| Homo sapiens coagulation factor VIII region (F8... 40 9.8
18gb|AC122409.4| Mus musculus BAC clone RP24-140P18 from chromosom... 40 9.8
19gb|DQ395101.1| Tetrahymena thermophila clone Cbs 2R-2 chromosome... 40 9.8
20gb|AC125055.3| Mus musculus BAC clone RP23-397L11 from chromosom... 40 9.8
21gb|AC125144.3| Mus musculus BAC clone RP24-346C2 from chromosome... 40 9.8
22emb|BX842564.3| Human DNA sequence from clone CTD-2037E7 on chro... 40 9.8
23emb|AL162426.20| Human DNA sequence from clone RP11-56D16 on chr... 40 9.8
24emb|AL138767.15| Human DNA sequence from clone RP11-57C13 on chr... 40 9.8
25gb|AC112215.3| Homo sapiens chromosome 3 clone RP11-844E22, comp... 40 9.8
26gb|AC105934.3| Homo sapiens chromosome 3 clone RP11-620K19, comp... 40 9.8
27emb|BX571947.8| Zebrafish DNA sequence from clone DKEY-162F21 in... 40 9.8
28gb|AF440098.1| Patella vulgata orthodenticle (otx) mRNA, complet... 40 9.8
29dbj|AP008232.1| Sodalis glossinidius str. 'morsitans' DNA, compl... 40 9.8
30dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c... 40 9.8
31gb|AC092765.2| Homo sapiens chromosome 1 clone RP11-400N13, comp... 40 9.8
32dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 40 9.8
33gb|AC122735.18| Mus musculus chromosome 3, clone RP23-215I1, com... 40 9.8
34gb|AC068533.7| Homo sapiens PAC clone RP5-1132H15 from 7, comple... 40 9.8
35gb|AC125227.6| Mus musculus BAC clone RP23-42I13 from chromosome... 40 9.8
36dbj|BS000028.1| Pan troglodytes chromosome 22 clone:PTB-087F19, ... 40 9.8
37emb|CR533570.6| Zebrafish DNA sequence from clone DKEY-288J18 in... 40 9.8
38gb|AE003721.3| Drosophila melanogaster chromosome 3R, section 59... 40 9.8
39dbj|AP001667.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 9.8
40gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete... 40 9.8
41gb|AC006208.3| Homo sapiens 3 PAC RP4-793P23 (Roswell Park Cance... 40 9.8
42gb|AC167016.5| Mus musculus chromosome 3, clone RP23-76C12, comp... 40 9.8
43gb|L77117.1| Methanocaldococcus jannaschii DSM 2661, complete ge... 40 9.8
44emb|AL645722.2|HSA524G17 Homo sapiens chromosome X clone RP11-52... 40 9.8
45dbj|AP000962.2| Homo sapiens genomic DNA, chromosome 21q21.1-q21... 40 9.8 
>dbj|AK060785.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-D03, full
           insert sequence
          Length = 1090

 Score =  180 bits (91), Expect = 4e-42
 Identities = 127/139 (91%)
 Strand = Plus / Minus

                                                                       
Query: 541 tcttatgactcgatcgctgcgaccctcacgggcttcattactcttacaatgttcctcata 600
           |||||||| ||||| ||||||||||| || |||||||||||| |||||||||||||||||
Sbjct: 754 tcttatgattcgattgctgcgacccttactggcttcattacttttacaatgttcctcata 695

                                                                       
Query: 601 tgctcaaaccccatcactatcaggcctatgacataaagaaagcttagttgcaactttgca 660
           |||||||||||||||| |||||  |||||||||||||||||||||||||||| ||| |||
Sbjct: 694 tgctcaaaccccatcagtatcactcctatgacataaagaaagcttagttgcagcttggca 635

                              
Query: 661 agtaggttatacactgcta 679
           |||| |||||| |||||||
Sbjct: 634 agtaagttatagactgcta 616
to top
>gb|AC104713.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1362_G11,
             complete sequence
          Length = 115808

 Score =  178 bits (90), Expect = 2e-41
 Identities = 126/138 (91%)
 Strand = Plus / Plus

                                                                         
Query: 542   cttatgactcgatcgctgcgaccctcacgggcttcattactcttacaatgttcctcatat 601
             ||||||| ||||| ||||||||||| || |||||||||||| ||||||||||||||||||
Sbjct: 88032 cttatgattcgattgctgcgacccttactggcttcattacttttacaatgttcctcatat 88091

                                                                         
Query: 602   gctcaaaccccatcactatcaggcctatgacataaagaaagcttagttgcaactttgcaa 661
             ||||||||||||||| |||||  |||||||||||||||||||||||||||| ||| ||||
Sbjct: 88092 gctcaaaccccatcagtatcactcctatgacataaagaaagcttagttgcagcttggcaa 88151

                               
Query: 662   gtaggttatacactgcta 679
             ||| |||||| |||||||
Sbjct: 88152 gtaagttatagactgcta 88169
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  178 bits (90), Expect = 2e-41
 Identities = 126/138 (91%)
 Strand = Plus / Plus

                                                                            
Query: 542      cttatgactcgatcgctgcgaccctcacgggcttcattactcttacaatgttcctcatat 601
                ||||||| ||||| ||||||||||| || |||||||||||| ||||||||||||||||||
Sbjct: 26707035 cttatgattcgattgctgcgacccttactggcttcattacttttacaatgttcctcatat 26707094

                                                                            
Query: 602      gctcaaaccccatcactatcaggcctatgacataaagaaagcttagttgcaactttgcaa 661
                ||||||||||||||| |||||  |||||||||||||||||||||||||||| ||| ||||
Sbjct: 26707095 gctcaaaccccatcagtatcactcctatgacataaagaaagcttagttgcagcttggcaa 26707154

                                  
Query: 662      gtaggttatacactgcta 679
                ||| |||||| |||||||
Sbjct: 26707155 gtaagttatagactgcta 26707172
to top
>dbj|AK071306.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023088C20, full
            insert sequence
          Length = 1860

 Score =  172 bits (87), Expect = 1e-39
 Identities = 141/159 (88%)
 Strand = Plus / Minus

                                                                        
Query: 521  taatttacatgtcctctgtgtcttatgactcgatcgctgcgaccctcacgggcttcatta 580
            |||||||||||   | ||| |||||||| ||||| ||||||||||| || ||||||||||
Sbjct: 1544 taatttacatgagttttgtttcttatgattcgattgctgcgacccttactggcttcatta 1485

                                                                        
Query: 581  ctcttacaatgttcctcatatgctcaaaccccatcactatcaggcctatgacataaagaa 640
            || ||||||||||||||||||||||||||||||||| |||||   |||||||||||||||
Sbjct: 1484 cttttacaatgttcctcatatgctcaaaccccatcagtatcacttctatgacataaagaa 1425

                                                   
Query: 641  agcttagttgcaactttgcaagtaggttatacactgcta 679
            |||||||||||| ||| ||||||| |||||| |||||||
Sbjct: 1424 agcttagttgcagcttggcaagtaagttatagactgcta 1386
to top
>dbj|AK071703.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023112L03, full
            insert sequence
          Length = 1561

 Score =  115 bits (58), Expect = 2e-22
 Identities = 76/82 (92%)
 Strand = Plus / Minus

                                                                        
Query: 541  tcttatgactcgatcgctgcgaccctcacgggcttcattactcttacaatgttcctcata 600
            |||||||| ||||| ||||||||||| || |||||||||||| |||||||||||||||||
Sbjct: 1225 tcttatgattcgattgctgcgacccttactggcttcattacttttacaatgttcctcata 1166

                                  
Query: 601  tgctcaaaccccatcactatca 622
            |||||||||||||||| |||||
Sbjct: 1165 tgctcaaaccccatcagtatca 1144
to top
>ref|XM_475819.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1077

 Score =  111 bits (56), Expect = 3e-21
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 543  ttatgactcgatcgctgcgaccctcacgggcttcattactcttacaatgttcctcatatg 602
            |||||| ||||| ||||||||||| || |||||||||||| |||||||||||||||||||
Sbjct: 1077 ttatgattcgattgctgcgacccttactggcttcattacttttacaatgttcctcatatg 1018

                                
Query: 603  ctcaaaccccatcactatca 622
            |||||||||||||| |||||
Sbjct: 1017 ctcaaaccccatcagtatca 998
to top
>emb|AL929510.17| Mouse DNA sequence from clone RP23-241O13 on chromosome 2, complete
              sequence
          Length = 160386

 Score = 44.1 bits (22), Expect = 0.63
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 405    ctcaagggaggaggaaaaataggttc 430
              |||| |||||||||||||||||||||
Sbjct: 141609 ctcaggggaggaggaaaaataggttc 141584
to top
>dbj|AP006357.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT36C13, TM0100a,
             complete sequence
          Length = 79575

 Score = 44.1 bits (22), Expect = 0.63
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 603   ctcaaaccccatcactatcagg 624
             ||||||||||||||||||||||
Sbjct: 39703 ctcaaaccccatcactatcagg 39724
to top
>emb|AL158832.13| Human DNA sequence from clone RP11-59O6 on chromosome 9 Contains two
              novel genes, the 5' end of a novel gene (contains FLJ36253
              and FLJ00026) and a CpG island, complete sequence
          Length = 167531

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 581    ctcttacaatgttcctcatat 601
              |||||||||||||||||||||
Sbjct: 166510 ctcttacaatgttcctcatat 166490
to top
>emb|BX571662.1| Wolinella succinogenes, complete genome; segment 6/7
          Length = 349859

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 19    taaatctttaaatgagtttat 39
             |||||||||||||||||||||
Sbjct: 84697 taaatctttaaatgagtttat 84717
to top
>emb|AL596209.13| Mouse DNA sequence from clone RP23-278F12 on chromosome 11 Contains the
              3' end of the Ulk2 gene for Unc-51 like kinase 2 (C.
              elegans), the Prpsap2 gene for phosphoribosyl pyrophosphate
              synthetase-associated protein 2, the gene for a novel
              sodium/glucose cotransporter protein, the gene for a novel
              protein (2310040C09Rik), the Grap gene for GRB2-related
              adaptor protein and a CpG island, complete sequence
          Length = 186359

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 474    gtatatggaggagacatgaaa 494
              |||||||||||||||||||||
Sbjct: 176009 gtatatggaggagacatgaaa 176029
to top
>gb|AC092700.2| Homo sapiens chromosome 8, clone RP11-661A3, complete sequence
          Length = 201886

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 13     ttgtattaaatctttaaatga 33
              |||||||||||||||||||||
Sbjct: 100385 ttgtattaaatctttaaatga 100405
to top
>gb|AC091195.6| Homo sapiens chromosome 8, clone RP11-814D21, complete sequence
          Length = 175597

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 13     ttgtattaaatctttaaatga 33
              |||||||||||||||||||||
Sbjct: 161722 ttgtattaaatctttaaatga 161702
to top
>emb|BX247879.5| Zebrafish DNA sequence from clone CH211-195N15, complete sequence
          Length = 184509

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 34    gtttatttaagtacaaggaag 54
             |||||||||||||||||||||
Sbjct: 92156 gtttatttaagtacaaggaag 92176
to top
>gb|AY769950.1| Homo sapiens coagulation factor VIII, procoagulant component
             (hemophilia A) (F8) gene, complete cds
          Length = 192029

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    cattgtacagcaaaagagat 77
             ||||||||||||||||||||
Sbjct: 17754 cattgtacagcaaaagagat 17735
to top
>gb|AC009394.5| Drosophila melanogaster clone BACR03J17, complete sequence
          Length = 199043

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 681   agcagcgctgccagcttcgc 700
             ||||||||||||||||||||
Sbjct: 86655 agcagcgctgccagcttcgc 86674
to top
>ref|NG_005114.1| Homo sapiens coagulation factor VIII region (F8@) on chromosome X
          Length = 652898

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     cattgtacagcaaaagagat 77
              ||||||||||||||||||||
Sbjct: 172790 cattgtacagcaaaagagat 172809
to top
>gb|AC122409.4| Mus musculus BAC clone RP24-140P18 from chromosome 8, complete sequence
          Length = 178068

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 149    tcacaggatggtacagaaga 168
              ||||||||||||||||||||
Sbjct: 125560 tcacaggatggtacagaaga 125579
to top
>gb|DQ395101.1| Tetrahymena thermophila clone Cbs 2R-2 chromosome breakage
           sequence; micronuclear
          Length = 1871

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 18  ttaaatctttaaatgagtttattt 41
           |||||||||||||||| |||||||
Sbjct: 825 ttaaatctttaaatgaatttattt 802
to top
>gb|AC125055.3| Mus musculus BAC clone RP23-397L11 from chromosome 7, complete sequence
          Length = 209066

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 19    taaatctttaaatgagttta 38
             ||||||||||||||||||||
Sbjct: 33164 taaatctttaaatgagttta 33183
to top
>gb|AC125144.3| Mus musculus BAC clone RP24-346C2 from chromosome 6, complete sequence
          Length = 171156

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 42     aagtacaaggaagtaacattgtac 65
              ||||| ||||||||||||||||||
Sbjct: 129774 aagtaaaaggaagtaacattgtac 129797
to top
>emb|BX842564.3| Human DNA sequence from clone CTD-2037E7 on chromosome X Contains part
             of the F8 gene for coagulation factor VIII, procoagulant
             component (hemophilia A), complete sequence
          Length = 71989

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    cattgtacagcaaaagagat 77
             ||||||||||||||||||||
Sbjct: 59885 cattgtacagcaaaagagat 59904
to top
>emb|AL162426.20| Human DNA sequence from clone RP11-56D16 on chromosome 9 Contains the
             STXBP1 gene for syntaxin binding protein 1
             (UNC18,hUNC18,MUNC18-1), two novel genes, a novel gene
             (LOC138428), the gene for a novel protien (LOC286207), the
             gene for anovel protein (FLJ32780), the TOR2A gene for
             torsin family 2, member A (FLJ14771), the 3' end of the
             SH2D3C gene for SH2 domain containing 3C (CHAT,NSP3) and
             five CpG islands, complete sequence
          Length = 163338

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 316   ctgtgacagcttctgtccag 335
             ||||||||||||||||||||
Sbjct: 97334 ctgtgacagcttctgtccag 97315
to top
>emb|AL138767.15| Human DNA sequence from clone RP11-57C13 on chromosome 10 Contains the
             3' end of the MINPP gene for multiple inositol
             polyphosphate histidine phosphatase 1, three novel genes,
             a ribosomal protein S26 (RPS26) pseudogene, the 5' end of
             the PAPSS2 gene for 3'-phosphoadenosine 5'-phosphosulfate
             synthase 2 and a CpG island, complete sequence
          Length = 111645

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 11    gcttgtattaaatctttaaa 30
             ||||||||||||||||||||
Sbjct: 73682 gcttgtattaaatctttaaa 73663
to top
>gb|AC112215.3| Homo sapiens chromosome 3 clone RP11-844E22, complete sequence
          Length = 199310

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 177   tggcagcaccagccaccagc 196
             ||||||||||||||||||||
Sbjct: 44456 tggcagcaccagccaccagc 44437
to top
>gb|AC105934.3| Homo sapiens chromosome 3 clone RP11-620K19, complete sequence
          Length = 217029

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 177   tggcagcaccagccaccagc 196
             ||||||||||||||||||||
Sbjct: 36092 tggcagcaccagccaccagc 36073
to top
>emb|BX571947.8| Zebrafish DNA sequence from clone DKEY-162F21 in linkage group 10,
              complete sequence
          Length = 269153

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 38     atttaagtacaaggaagtaa 57
              ||||||||||||||||||||
Sbjct: 181219 atttaagtacaaggaagtaa 181238
to top
>gb|AF440098.1| Patella vulgata orthodenticle (otx) mRNA, complete cds
          Length = 2574

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 12   cttgtattaaatctttaaat 31
            ||||||||||||||||||||
Sbjct: 2194 cttgtattaaatctttaaat 2175
to top
>dbj|AP008232.1| Sodalis glossinidius str. 'morsitans' DNA, complete genome
          Length = 4171146

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 676     gctacagcagcgctgccagc 695
               ||||||||||||||||||||
Sbjct: 1339025 gctacagcagcgctgccagc 1339044
to top
>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome
          Length = 4940217

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 679     acagcagcgctgccagcttc 698
               ||||||||||||||||||||
Sbjct: 1796377 acagcagcgctgccagcttc 1796396
to top
>gb|AC092765.2| Homo sapiens chromosome 1 clone RP11-400N13, complete sequence
          Length = 188261

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 341    taatgcaggtatagctcctc 360
              ||||||||||||||||||||
Sbjct: 168016 taatgcaggtatagctcctc 168035
to top
>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 179     gcagcaccagccaccagcgc 198
               ||||||||||||||||||||
Sbjct: 4040430 gcagcaccagccaccagcgc 4040449
to top
>gb|AC122735.18| Mus musculus chromosome 3, clone RP23-215I1, complete sequence
          Length = 182999

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 24     ctttaaatgagtttatttaa 43
              ||||||||||||||||||||
Sbjct: 146465 ctttaaatgagtttatttaa 146446
to top
>gb|AC068533.7| Homo sapiens PAC clone RP5-1132H15 from 7, complete sequence
          Length = 140974

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 479   tggaggagacatgaaatatgatct 502
             |||||||||||||| |||||||||
Sbjct: 11575 tggaggagacatgacatatgatct 11598
to top
>gb|AC125227.6| Mus musculus BAC clone RP23-42I13 from chromosome 7, complete
            sequence
          Length = 211209

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 19   taaatctttaaatgagttta 38
            ||||||||||||||||||||
Sbjct: 7865 taaatctttaaatgagttta 7846
to top
>dbj|BS000028.1| Pan troglodytes chromosome 22 clone:PTB-087F19, map 22, complete
             sequences
          Length = 223409

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 355   ctcctctctttatttgtctc 374
             ||||||||||||||||||||
Sbjct: 75240 ctcctctctttatttgtctc 75259
to top
>emb|CR533570.6| Zebrafish DNA sequence from clone DKEY-288J18 in linkage group 18,
              complete sequence
          Length = 167352

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 19     taaatctttaaatgagttta 38
              ||||||||||||||||||||
Sbjct: 129020 taaatctttaaatgagttta 129001
to top
>gb|AE003721.3| Drosophila melanogaster chromosome 3R, section 59 of 118 of the complete
              sequence
          Length = 224889

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 681    agcagcgctgccagcttcgc 700
              ||||||||||||||||||||
Sbjct: 107149 agcagcgctgccagcttcgc 107168
to top
>dbj|AP001667.1| Homo sapiens genomic DNA, chromosome 21q, section 11/105
          Length = 340000

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 355    ctcctctctttatttgtctc 374
              ||||||||||||||||||||
Sbjct: 171438 ctcctctctttatttgtctc 171457
to top
>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome
          Length = 4941439

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 679     acagcagcgctgccagcttc 698
               ||||||||||||||||||||
Sbjct: 1817462 acagcagcgctgccagcttc 1817481
to top
>gb|AC006208.3| Homo sapiens 3 PAC RP4-793P23 (Roswell Park Cancer Institute Human PAC
              Library) complete sequence
          Length = 123943

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 177    tggcagcaccagccaccagc 196
              ||||||||||||||||||||
Sbjct: 102979 tggcagcaccagccaccagc 102960
to top
>gb|AC167016.5| Mus musculus chromosome 3, clone RP23-76C12, complete sequence
          Length = 225524

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 24    ctttaaatgagtttatttaa 43
             ||||||||||||||||||||
Sbjct: 15823 ctttaaatgagtttatttaa 15804
to top
>gb|L77117.1| Methanocaldococcus jannaschii DSM 2661, complete genome
          Length = 1664970

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 20     aaatctttaaatgagtttat 39
              ||||||||||||||||||||
Sbjct: 636659 aaatctttaaatgagtttat 636640
to top
>emb|AL645722.2|HSA524G17 Homo sapiens chromosome X clone RP11-524G17 map Xq28, complete sequence
          Length = 189940

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    cattgtacagcaaaagagat 77
             ||||||||||||||||||||
Sbjct: 34072 cattgtacagcaaaagagat 34053
to top
>dbj|AP000962.2| Homo sapiens genomic DNA, chromosome 21q21.1-q21.2, clone:B821P16,
              LL56-APP region, complete sequence
          Length = 185300

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 355    ctcctctctttatttgtctc 374
              ||||||||||||||||||||
Sbjct: 102982 ctcctctctttatttgtctc 103001


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,200,413
Number of Sequences: 3902068
Number of extensions: 6200413
Number of successful extensions: 121022
Number of sequences better than 10.0: 45
Number of HSP's better than 10.0 without gapping: 45
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 120762
Number of HSP's gapped (non-prelim): 259
length of query: 716
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 693
effective length of database: 17,143,297,704
effective search space: 11880305308872
effective search space used: 11880305308872
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top