ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbaal7p04 |
|---|---|
| Clone Library Name | barley_pub |
>ref|NM_184140.2| Oryza sativa (japonica cultivar-group), mRNA Length = 988 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 317 gcgatctcctcgtcgacgtagaaccacaggaagaaggggtccttggtgctcggctccct 375 ||||| ||||| || || |||||||||| ||||| |||||||| |||||||||||||| Sbjct: 755 gcgatttcctcatcaacatagaaccacacaaagaaagggtcctttgtgctcggctccct 697
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 317 gcgatctcctcgtcgacgtagaaccacaggaagaaggggtccttggtgctcggctccct 375 ||||| ||||| || || |||||||||| ||||| |||||||| |||||||||||||| Sbjct: 1159431 gcgatttcctcatcaacatagaaccacacaaagaaagggtcctttgtgctcggctccct 1159489 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 28233337 tcccatcccatcccatcccatccc 28233314 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 1106527 tcccatcccatcccatcccatccc 1106550
>dbj|AP002868.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0698A04 Length = 141079 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 317 gcgatctcctcgtcgacgtagaaccacaggaagaaggggtccttggtgctcggctccct 375 ||||| ||||| || || |||||||||| ||||| |||||||| |||||||||||||| Sbjct: 128745 gcgatttcctcatcaacatagaaccacacaaagaaagggtcctttgtgctcggctccct 128803 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 75841 tcccatcccatcccatcccatccc 75864
>dbj|AP002487.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0684C01 Length = 78600 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 317 gcgatctcctcgtcgacgtagaaccacaggaagaaggggtccttggtgctcggctccct 375 ||||| ||||| || || |||||||||| ||||| |||||||| |||||||||||||| Sbjct: 13734 gcgatttcctcatcaacatagaaccacacaaagaaagggtcctttgtgctcggctccct 13792
>dbj|AK070131.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023046G14, full insert sequence Length = 988 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 317 gcgatctcctcgtcgacgtagaaccacaggaagaaggggtccttggtgctcggctccct 375 ||||| ||||| || || |||||||||| ||||| |||||||| |||||||||||||| Sbjct: 755 gcgatttcctcatcaacatagaaccacacaaagaaagggtcctttgtgctcggctccct 697
>gb|AC167959.2| Mus musculus chromosome 1, clone wi1-870H21, complete sequence Length = 40520 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 |||||||||||||||||||||||| Sbjct: 31752 tcccatcccatcccaacccatccc 31775 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 |||||||||||||||||||||||| Sbjct: 31647 tcccatcccatcccaacccatccc 31670 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 |||||||||||||||||||||||| Sbjct: 31622 tcccatcccatcccaacccatccc 31645 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 |||||||||||||||||||||||| Sbjct: 31587 tcccatcccatcccaacccatccc 31610 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 31807 tcccatcccatcccatcccatccc 31830 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 31802 tcccatcccatcccatcccatccc 31825 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 31797 tcccatcccatcccatcccatccc 31820 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 31792 tcccatcccatcccatcccatccc 31815 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 31787 tcccatcccatcccatcccatccc 31810 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 31782 tcccatcccatcccatcccatccc 31805 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 31777 tcccatcccatcccatcccatccc 31800 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 31772 tcccatcccatcccatcccatccc 31795 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 31742 tcccatcccatcccatcccatccc 31765 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 31737 tcccatcccatcccatcccatccc 31760 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 31732 tcccatcccatcccatcccatccc 31755 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 31727 tcccatcccatcccatcccatccc 31750 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 31722 tcccatcccatcccatcccatccc 31745 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 31717 tcccatcccatcccatcccatccc 31740 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 31712 tcccatcccatcccatcccatccc 31735 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 31707 tcccatcccatcccatcccatccc 31730 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 31702 tcccatcccatcccatcccatccc 31725 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 31697 tcccatcccatcccatcccatccc 31720 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 31692 tcccatcccatcccatcccatccc 31715 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 31687 tcccatcccatcccatcccatccc 31710 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||| |||||||||||||||||| Sbjct: 31667 tcccaacccatcccaacccatccc 31690 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||| |||||||||||||||||| Sbjct: 31657 tcccaacccatcccaacccatccc 31680 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 31612 tcccatcccatcccatcccatccc 31635 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 31607 tcccatcccatcccatcccatccc 31630
>emb|AL031123.14|HS80N2 Human DNA sequence from clone RP1-80N2 on chromosome 6p24.1-25.3 Contains the gene for MD-1,RP105-associated, part of a putative novel gene and three putative CpG islands, complete sequence Length = 193731 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 |||||||||||||||||||||||| Sbjct: 87369 tcccatcccatcccaacccatccc 87346 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 87349 tcccatcccatcccatcccatccc 87326 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 87344 tcccatcccatcccatcccatccc 87321
>gb|AC162375.2| Mus musculus BAC clone RP24-466F1 from chromosome 9, complete sequence Length = 164119 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 |||||||||||||||||||||||| Sbjct: 104078 tcccatcccatcccaacccatccc 104055 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 104113 tcccatcccatcccatcccatccc 104090 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 104108 tcccatcccatcccatcccatccc 104085 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 104103 tcccatcccatcccatcccatccc 104080 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 104098 tcccatcccatcccatcccatccc 104075 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 104093 tcccatcccatcccatcccatccc 104070 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 104088 tcccatcccatcccatcccatccc 104065
>ref|XM_714691.1| Candida albicans SC5314 hypothetical protein (CaO19_14098), mRNA Length = 315 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 66 cccatcccatcccaacccatccc 88 ||||||||||||||||||||||| Sbjct: 89 cccatcccatcccaacccatccc 67 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 66 cccatcccatcccaacccatccc 88 ||||||||||||||||||||||| Sbjct: 74 cccatcccatcccaacccatccc 52 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 66 cccatcccatcccaacccatccc 88 ||||||||||||||||||||||| Sbjct: 59 cccatcccatcccaacccatccc 37 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 66 cccatcccatcccaacccatccc 88 ||||||||||||||||||||||| Sbjct: 44 cccatcccatcccaacccatccc 22
>ref|XM_714808.1| Candida albicans SC5314 hypothetical protein (CaO19_6806), mRNA Length = 315 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 66 cccatcccatcccaacccatccc 88 ||||||||||||||||||||||| Sbjct: 89 cccatcccatcccaacccatccc 67 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 66 cccatcccatcccaacccatccc 88 ||||||||||||||||||||||| Sbjct: 74 cccatcccatcccaacccatccc 52 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 66 cccatcccatcccaacccatccc 88 ||||||||||||||||||||||| Sbjct: 59 cccatcccatcccaacccatccc 37 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 66 cccatcccatcccaacccatccc 88 ||||||||||||||||||||||| Sbjct: 44 cccatcccatcccaacccatccc 22
>gb|AE009093.1| Agrobacterium tumefaciens str. C58 circular chromosome, section 119 of 256 of the complete sequence Length = 10029 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 289 ggtgccgccgcccttgccctgcg 311 ||||||||||||||||||||||| Sbjct: 3189 ggtgccgccgcccttgccctgcg 3167
>gb|AE007869.1| Agrobacterium tumefaciens str. C58, complete genome Length = 2841581 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 289 ggtgccgccgcccttgccctgcg 311 ||||||||||||||||||||||| Sbjct: 1304274 ggtgccgccgcccttgccctgcg 1304252
>gb|AF197897.1|AF197897 Takifugu rubripes Nemo-like kinase (NLK) and FN5 protein (FN5) genes, complete cds; and neurofibromatosis type 1 neurofibromin (NF1) gene, partial cds Length = 16370 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 66 cccatcccatcccaacccatccc 88 ||||||||||||||||||||||| Sbjct: 15147 cccatcccatcccaacccatccc 15169 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 66 cccatcccatcccaacccatccc 88 ||||||||||||||||||||||| Sbjct: 15042 cccatcccatcccaacccatccc 15064 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 66 cccatcccatcccaacccatccc 88 ||||||||||||||||||||||| Sbjct: 15012 cccatcccatcccaacccatccc 15034 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 6638 tcccatcccatcccatcccatccc 6615
>gb|AF064564.2|AF064564 Fugu rubripes neurofibromatosis type 1 (NF1), A-kinase anchor protein (AKAP84), BAW protein (BAW), and WSB1 protein (WSB1) genes, complete cds Length = 49254 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 66 cccatcccatcccaacccatccc 88 ||||||||||||||||||||||| Sbjct: 3046 cccatcccatcccaacccatccc 3068 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 66 cccatcccatcccaacccatccc 88 ||||||||||||||||||||||| Sbjct: 2941 cccatcccatcccaacccatccc 2963 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 66 cccatcccatcccaacccatccc 88 ||||||||||||||||||||||| Sbjct: 2911 cccatcccatcccaacccatccc 2933
>gb|AC092494.2| Drosophila melanogaster clone BACR23I18, complete sequence Length = 172029 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatcccta 90 ||||||||||||||| |||||||||| Sbjct: 119331 tcccatcccatcccatcccatcccta 119306
>gb|AC011251.6| Drosophila melanogaster clone BACR09F10, complete sequence Length = 173988 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatcccta 90 ||||||||||||||| |||||||||| Sbjct: 159443 tcccatcccatcccatcccatcccta 159418
>emb|X68393.1|DMBT12 D.melanogaster gene for Beta-tubulin, exons 1 and 2 Length = 4620 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Plus Query: 63 actcccatcccatcccaacccatccc 88 ||||||||||||||||| |||||||| Sbjct: 3563 actcccatcccatcccatcccatccc 3588
>gb|DQ417225.1| Aspergillus niger strain CBS 513.88 putative endo-rhamnogalacturonase F (rhgF) gene, complete cds Length = 2218 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 64 ctcccatcccatcccaacccat 85 |||||||||||||||||||||| Sbjct: 2069 ctcccatcccatcccaacccat 2048
>gb|AE003568.4| Drosophila melanogaster chromosome X, section 71 of 74 of the complete sequence Length = 315815 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatcccta 90 ||||||||||||||| |||||||||| Sbjct: 259423 tcccatcccatcccatcccatcccta 259398
>gb|AC114653.11| Mus musculus chromosome 5, clone RP24-158G19, complete sequence Length = 164313 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 63 actcccatcccatcccaacccatcc 87 ||||||||||||||||| ||||||| Sbjct: 114169 actcccatcccatcccatcccatcc 114193
>gb|AC113113.18| Mus musculus chromosome 16, clone RP23-334P10, complete sequence Length = 216380 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 64 ctcccatcccatcccaacccatccc 88 |||||||||||||||| |||||||| Sbjct: 41534 ctcccatcccatcccatcccatccc 41510 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 41528 tcccatcccatcccatcccatccc 41505 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 41523 tcccatcccatcccatcccatccc 41500
>gb|AC151667.1| Pan troglodytes chromosome X clone RP43-007H19 map human ortholog q28, complete sequence Length = 200796 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccct 89 ||||||||||||||| ||||||||| Sbjct: 90146 tcccatcccatcccatcccatccct 90170 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 90219 tcccatcccatcccatcccatccc 90242 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 90214 tcccatcccatcccatcccatccc 90237 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 90209 tcccatcccatcccatcccatccc 90232
>gb|AC114908.9| Mus musculus chromosome 3, clone RP24-173L8, complete sequence Length = 145363 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccct 89 ||||||||||||||| ||||||||| Sbjct: 90861 tcccatcccatcccatcccatccct 90837 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 90995 tcccatcccatcccatcccatccc 90972 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 90990 tcccatcccatcccatcccatccc 90967 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 90985 tcccatcccatcccatcccatccc 90962 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 90980 tcccatcccatcccatcccatccc 90957 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 90975 tcccatcccatcccatcccatccc 90952 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 90970 tcccatcccatcccatcccatccc 90947 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 90881 tcccatcccatcccatcccatccc 90858 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 90876 tcccatcccatcccatcccatccc 90853 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 90871 tcccatcccatcccatcccatccc 90848 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 90866 tcccatcccatcccatcccatccc 90843
>gb|AC120875.12| Mus musculus chromosome 1, clone RP23-317M5, complete sequence Length = 195159 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccct 89 ||||||||||||||| ||||||||| Sbjct: 174108 tcccatcccatcccatcccatccct 174132
>gb|AY456696.1| Arthrobacter aurescens strain TC1 plasmid pAA1 atrazine catabolic region, partial sequence Length = 161264 Score = 42.1 bits (21), Expect = 1.4 Identities = 27/29 (93%) Strand = Plus / Plus Query: 292 gccgccgcccttgccctgcgcgacggcga 320 |||||| |||| ||||||||||||||||| Sbjct: 145423 gccgccaccctcgccctgcgcgacggcga 145451
>gb|AC133090.4| Mus musculus BAC clone RP24-194H23 from chromosome 15, complete sequence Length = 148555 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccct 89 ||||||||||||||| ||||||||| Sbjct: 107789 tcccatcccatcccatcccatccct 107765 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 107839 tcccatcccatcccatcccatccc 107816 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 107834 tcccatcccatcccatcccatccc 107811 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 107829 tcccatcccatcccatcccatccc 107806 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 107824 tcccatcccatcccatcccatccc 107801 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 107819 tcccatcccatcccatcccatccc 107796 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 107814 tcccatcccatcccatcccatccc 107791 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 107809 tcccatcccatcccatcccatccc 107786 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 107804 tcccatcccatcccatcccatccc 107781 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 107799 tcccatcccatcccatcccatccc 107776 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 107794 tcccatcccatcccatcccatccc 107771
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 381 tgtcgccgccgccgaagggga 401 ||||||||||||||||||||| Sbjct: 7656798 tgtcgccgccgccgaagggga 7656778 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 20935359 tcccatcccatcccatcccatccc 20935336 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 5602641 tcccatcccatcccatcccatccc 5602664
>ref|XM_757301.1| Ustilago maydis 521 hypothetical protein (UM06247.1) partial mRNA Length = 1434 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccct 89 ||||||||||||||| ||||||||| Sbjct: 175 tcccatcccatcccatcccatccct 199
>gb|AC087728.3| Papio anubis clone RP41-340H23, complete sequence Length = 198888 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccct 89 ||||||||||||||| ||||||||| Sbjct: 71035 tcccatcccatcccatcccatccct 71059 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 64 ctcccatcccatcccaacccatccc 88 |||||||||||||||| |||||||| Sbjct: 71019 ctcccatcccatcccatcccatccc 71043 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 71030 tcccatcccatcccatcccatccc 71053 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 71025 tcccatcccatcccatcccatccc 71048
>gb|AC009030.10| Homo sapiens chromosome 16 clone RP11-13G6, complete sequence Length = 189379 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 68 catcccatcccaacccatccc 88 ||||||||||||||||||||| Sbjct: 133408 catcccatcccaacccatccc 133388 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 136825 tcccatcccatcccatcccatccc 136848 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 136820 tcccatcccatcccatcccatccc 136843 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 136815 tcccatcccatcccatcccatccc 136838 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 136810 tcccatcccatcccatcccatccc 136833 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 133391 tcccatcccatcccatcccatccc 133368 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 133386 tcccatcccatcccatcccatccc 133363 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 133381 tcccatcccatcccatcccatccc 133358 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 133376 tcccatcccatcccatcccatccc 133353 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 133371 tcccatcccatcccatcccatccc 133348 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 133366 tcccatcccatcccatcccatccc 133343 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 133361 tcccatcccatcccatcccatccc 133338 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 133356 tcccatcccatcccatcccatccc 133333 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 |||||| ||||||||||||||||| Sbjct: 133336 tcccattccatcccaacccatccc 133313
>emb|AL512628.12| Human DNA sequence from clone RP11-6P10 on chromosome 10 Contains the gene for 155kD polymerase (RNA) III (DNA directed) (RPC155), the RPS24 gene for ribosomal protein S24 and a CpG island, complete sequence Length = 95562 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccct 89 ||||||||||||||| ||||||||| Sbjct: 69660 tcccatcccatcccatcccatccct 69636
>gb|AY994717.1| Costus subsessilis voucher C.D. Specht 98-217 (NY) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence Length = 476 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 67 ccatcccatcccaacccatcc 87 ||||||||||||||||||||| Sbjct: 14 ccatcccatcccaacccatcc 34
>emb|AL662853.16| Mouse DNA sequence from clone RP23-293J16 on chromosome 11 Contains the Kremen gene for kringle containing transmembrane protein, the 3' end of a novel gene and a CpG island, complete sequence Length = 198703 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 64 ctcccatcccatcccaacccatccc 88 |||||||||||||||| |||||||| Sbjct: 124630 ctcccatcccatcccatcccatccc 124654 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 64 ctcccatcccatcccaacccatccc 88 |||||||||||||||| |||||||| Sbjct: 124583 ctcccatcccatcccatcccatccc 124607 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 64 ctcccatcccatcccaacccatccc 88 |||||||||||||||| |||||||| Sbjct: 124541 ctcccatcccatcccatcccatccc 124565 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 64 ctcccatcccatcccaacccatccc 88 |||||||||||||||| |||||||| Sbjct: 124494 ctcccatcccatcccatcccatccc 124518 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 64 ctcccatcccatcccaacccatccc 88 |||||||||||||||| |||||||| Sbjct: 124447 ctcccatcccatcccatcccatccc 124471 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 64 ctcccatcccatcccaacccatccc 88 |||||||||||||||| |||||||| Sbjct: 124405 ctcccatcccatcccatcccatccc 124429 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 64 ctcccatcccatcccaacccatccc 88 |||||||||||||||| |||||||| Sbjct: 124338 ctcccatcccatcccatcccatccc 124362 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 64 ctcccatcccatcccaacccatccc 88 |||||||||||||||| |||||||| Sbjct: 124269 ctcccatcccatcccatcccatccc 124293 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124666 tcccatcccatcccatcccatccc 124689 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124661 tcccatcccatcccatcccatccc 124684 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124656 tcccatcccatcccatcccatccc 124679 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124651 tcccatcccatcccatcccatccc 124674 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124646 tcccatcccatcccatcccatccc 124669 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124641 tcccatcccatcccatcccatccc 124664 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124636 tcccatcccatcccatcccatccc 124659 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124599 tcccatcccatcccatcccatccc 124622 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124594 tcccatcccatcccatcccatccc 124617 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124589 tcccatcccatcccatcccatccc 124612 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124552 tcccatcccatcccatcccatccc 124575 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124547 tcccatcccatcccatcccatccc 124570 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124515 tcccatcccatcccatcccatccc 124538 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124510 tcccatcccatcccatcccatccc 124533 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124505 tcccatcccatcccatcccatccc 124528 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124500 tcccatcccatcccatcccatccc 124523 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124463 tcccatcccatcccatcccatccc 124486 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124458 tcccatcccatcccatcccatccc 124481 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124453 tcccatcccatcccatcccatccc 124476 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124416 tcccatcccatcccatcccatccc 124439 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124411 tcccatcccatcccatcccatccc 124434 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124379 tcccatcccatcccatcccatccc 124402 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124374 tcccatcccatcccatcccatccc 124397 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124369 tcccatcccatcccatcccatccc 124392 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124364 tcccatcccatcccatcccatccc 124387 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124359 tcccatcccatcccatcccatccc 124382 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124354 tcccatcccatcccatcccatccc 124377 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124349 tcccatcccatcccatcccatccc 124372 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124344 tcccatcccatcccatcccatccc 124367 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124290 tcccatcccatcccatcccatccc 124313 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124285 tcccatcccatcccatcccatccc 124308 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124280 tcccatcccatcccatcccatccc 124303 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124275 tcccatcccatcccatcccatccc 124298 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 64 ctcccatcccatcccaacccatcc 87 |||||||||||||||| ||||||| Sbjct: 124242 ctcccatcccatcccatcccatcc 124265
>gb|AC153008.4| Mus musculus BAC clone RP23-457I7 from chromosome 15, complete sequence Length = 171878 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccct 89 ||||||||||||||| ||||||||| Sbjct: 165192 tcccatcccatcccatcccatccct 165216 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 165187 tcccatcccatcccatcccatccc 165210 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 165182 tcccatcccatcccatcccatccc 165205 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 165177 tcccatcccatcccatcccatccc 165200 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 165172 tcccatcccatcccatcccatccc 165195 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 165167 tcccatcccatcccatcccatccc 165190 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 165162 tcccatcccatcccatcccatccc 165185 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 165157 tcccatcccatcccatcccatccc 165180 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 165152 tcccatcccatcccatcccatccc 165175 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 165147 tcccatcccatcccatcccatccc 165170 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 165142 tcccatcccatcccatcccatccc 165165
>gb|AC129008.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBb0096L14, from chromosome 3, complete sequence Length = 131142 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 381 tgtcgccgccgccgaagggga 401 ||||||||||||||||||||| Sbjct: 58492 tgtcgccgccgccgaagggga 58512
>gb|AC090338.6| Homo sapiens chromosome 18, clone RP11-704C2, complete sequence Length = 200525 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccct 89 ||||||||||||||| ||||||||| Sbjct: 151939 tcccatcccatcccatcccatccct 151915 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 151964 tcccatcccatcccatcccatccc 151941 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 151959 tcccatcccatcccatcccatccc 151936 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 151954 tcccatcccatcccatcccatccc 151931 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 151949 tcccatcccatcccatcccatccc 151926 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 151944 tcccatcccatcccatcccatccc 151921
>gb|AC015617.8| Homo sapiens, clone RP11-45H23, complete sequence Length = 160541 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccct 89 ||||||||||||||| ||||||||| Sbjct: 93476 tcccatcccatcccatcccatccct 93500 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 93471 tcccatcccatcccatcccatccc 93494 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 93466 tcccatcccatcccatcccatccc 93489 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 93461 tcccatcccatcccatcccatccc 93484 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 93456 tcccatcccatcccatcccatccc 93479 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 93451 tcccatcccatcccatcccatccc 93474
>gb|AC113171.3| Homo sapiens chromosome 3 clone RP11-696A14, complete sequence Length = 183599 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 64 ctcccatcccatcccaacccatccc 88 |||||||||||||||| |||||||| Sbjct: 143790 ctcccatcccatcccatcccatccc 143814 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 143826 tcccatcccatcccatcccatccc 143849 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 143821 tcccatcccatcccatcccatccc 143844 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 143816 tcccatcccatcccatcccatccc 143839 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 143811 tcccatcccatcccatcccatccc 143834 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 143806 tcccatcccatcccatcccatccc 143829 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 143801 tcccatcccatcccatcccatccc 143824 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 143796 tcccatcccatcccatcccatccc 143819
>gb|AC160137.2| Mus musculus BAC clone RP23-136A1 from chromosome 9, complete sequence Length = 241917 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccct 89 ||||||||||||||| ||||||||| Sbjct: 10816 tcccatcccatcccatcccatccct 10792 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 10851 tcccatcccatcccatcccatccc 10828 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 10846 tcccatcccatcccatcccatccc 10823 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 10841 tcccatcccatcccatcccatccc 10818 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 10836 tcccatcccatcccatcccatccc 10813 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 10831 tcccatcccatcccatcccatccc 10808 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 10826 tcccatcccatcccatcccatccc 10803 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 10821 tcccatcccatcccatcccatccc 10798
>gb|AF328738.1|AF328738 Agelaius phoeniceus cosmid Rwcos3, partial sequence Length = 45375 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccct 89 ||||||||||||||| ||||||||| Sbjct: 9390 tcccatcccatcccatcccatccct 9414 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 9385 tcccatcccatcccatcccatccc 9408 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 9380 tcccatcccatcccatcccatccc 9403 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 9375 tcccatcccatcccatcccatccc 9398 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 9370 tcccatcccatcccatcccatccc 9393 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 9365 tcccatcccatcccatcccatccc 9388 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 9360 tcccatcccatcccatcccatccc 9383 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 9355 tcccatcccatcccatcccatccc 9378 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 9350 tcccatcccatcccatcccatccc 9373 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 9345 tcccatcccatcccatcccatccc 9368
>gb|AC010339.8|AC010339 Homo sapiens chromosome 5 clone CTD-2009A17, complete sequence Length = 122480 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccct 89 ||||||||||||||| ||||||||| Sbjct: 115057 tcccatcccatcccatcccatccct 115033
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 64 ctcccatcccatcccaacccatccc 88 |||||||||||||||| |||||||| Sbjct: 10501602 ctcccatcccatcccatcccatccc 10501626 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 13376592 tcccatcccatcccatcccatccc 13376615 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 10501613 tcccatcccatcccatcccatccc 10501636 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 10501608 tcccatcccatcccatcccatccc 10501631 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 378762 tcccatcccatcccatcccatccc 378739
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 381 tgtcgccgccgccgaagggga 401 ||||||||||||||||||||| Sbjct: 7654633 tgtcgccgccgccgaagggga 7654613 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 20928388 tcccatcccatcccatcccatccc 20928365 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 5601856 tcccatcccatcccatcccatccc 5601879
>gb|AC008663.6|AC008663 Homo sapiens chromosome 5 clone CTB-33O18, complete sequence Length = 142859 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccct 89 ||||||||||||||| ||||||||| Sbjct: 26806 tcccatcccatcccatcccatccct 26782
>gb|AC112969.12| Mus musculus chromosome 8, clone RP24-331K7, complete sequence Length = 164201 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccct 89 ||||||||||||||| ||||||||| Sbjct: 125864 tcccatcccatcccatcccatccct 125888 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 125859 tcccatcccatcccatcccatccc 125882 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 125854 tcccatcccatcccatcccatccc 125877 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 125849 tcccatcccatcccatcccatccc 125872 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 125844 tcccatcccatcccatcccatccc 125867 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 125839 tcccatcccatcccatcccatccc 125862 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 125834 tcccatcccatcccatcccatccc 125857 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 125829 tcccatcccatcccatcccatccc 125852 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 125824 tcccatcccatcccatcccatccc 125847
>gb|AC012365.6| Homo sapiens BAC clone RP11-459C22 from 2, complete sequence Length = 187848 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccct 89 ||||||||||||||| ||||||||| Sbjct: 95046 tcccatcccatcccatcccatccct 95070 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 96083 tcccatcccatcccatcccatccc 96106 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 96078 tcccatcccatcccatcccatccc 96101 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 96073 tcccatcccatcccatcccatccc 96096 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 95778 tcccatcccatcccatcccatccc 95801 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 95603 tcccatcccatcccatcccatccc 95626 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 95598 tcccatcccatcccatcccatccc 95621 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 95593 tcccatcccatcccatcccatccc 95616 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 95278 tcccatcccatcccatcccatccc 95301 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 95273 tcccatcccatcccatcccatccc 95296 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 95268 tcccatcccatcccatcccatccc 95291 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 95263 tcccatcccatcccatcccatccc 95286 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 95041 tcccatcccatcccatcccatccc 95064 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 95036 tcccatcccatcccatcccatccc 95059
>gb|U82671.5| Homo sapiens chromosome X multiple clones map q28, complete sequence Length = 324604 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccct 89 ||||||||||||||| ||||||||| Sbjct: 200404 tcccatcccatcccatcccatccct 200428 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 200472 tcccatcccatcccatcccatccc 200495 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 200467 tcccatcccatcccatcccatccc 200490 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 200399 tcccatcccatcccatcccatccc 200422 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 200394 tcccatcccatcccatcccatccc 200417 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 200389 tcccatcccatcccatcccatccc 200412
>gb|AC087781.17| Mus musculus strain C57BL/6J chromosome 1 clone rp23-370c6, complete sequence Length = 173335 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 64 ctcccatcccatcccaacccatccc 88 |||||||||||||||| |||||||| Sbjct: 47172 ctcccatcccatcccatcccatccc 47196
>gb|AF170972.1|AF170972 Agelaius phoeniceus cosmid 10, complete sequence Length = 38786 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccct 89 ||||||||||||||| ||||||||| Sbjct: 8553 tcccatcccatcccatcccatccct 8529 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 8623 tcccatcccatcccatcccatccc 8600 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 8618 tcccatcccatcccatcccatccc 8595 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 8613 tcccatcccatcccatcccatccc 8590 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 8608 tcccatcccatcccatcccatccc 8585 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 8603 tcccatcccatcccatcccatccc 8580 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 8598 tcccatcccatcccatcccatccc 8575 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 8593 tcccatcccatcccatcccatccc 8570 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 8588 tcccatcccatcccatcccatccc 8565 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 8583 tcccatcccatcccatcccatccc 8560 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 8578 tcccatcccatcccatcccatccc 8555 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 8573 tcccatcccatcccatcccatccc 8550 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 8568 tcccatcccatcccatcccatccc 8545 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 8563 tcccatcccatcccatcccatccc 8540 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 8558 tcccatcccatcccatcccatccc 8535
>gb|AC034099.16| Mus Musculus Strain C57BL6/J Chromosome 7 BAC, RP23-145I16, complete sequence Length = 229553 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 64 ctcccatcccatcccaacccatccc 88 |||||||||||||||| |||||||| Sbjct: 151699 ctcccatcccatcccatcccatccc 151675
>gb|AC130449.2| Homo sapiens chromosome 16 clone CTA-233A7, complete sequence Length = 175104 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 68 catcccatcccaacccatccc 88 ||||||||||||||||||||| Sbjct: 82283 catcccatcccaacccatccc 82303 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 |||||| ||||||||||||||||| Sbjct: 82340 tcccattccatcccaacccatccc 82363 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 82320 tcccatcccatcccatcccatccc 82343 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 82315 tcccatcccatcccatcccatccc 82338 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 82310 tcccatcccatcccatcccatccc 82333 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 82305 tcccatcccatcccatcccatccc 82328 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 82300 tcccatcccatcccatcccatccc 82323 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 78881 tcccatcccatcccatcccatccc 78858 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 78876 tcccatcccatcccatcccatccc 78853 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 78871 tcccatcccatcccatcccatccc 78848 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 78866 tcccatcccatcccatcccatccc 78843 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 78861 tcccatcccatcccatcccatccc 78838 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 78856 tcccatcccatcccatcccatccc 78833 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 78851 tcccatcccatcccatcccatccc 78828 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 78846 tcccatcccatcccatcccatccc 78823 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 78841 tcccatcccatcccatcccatccc 78818
>dbj|AP005163.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBa0053M06 Length = 175416 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 64 ctcccatcccatcccaacccatccc 88 |||||||||||||||| |||||||| Sbjct: 124193 ctcccatcccatcccatcccatccc 124217 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124204 tcccatcccatcccatcccatccc 124227 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124199 tcccatcccatcccatcccatccc 124222
>dbj|AK119222.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-047-E03, full insert sequence Length = 2098 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 381 tgtcgccgccgccgaagggga 401 ||||||||||||||||||||| Sbjct: 1642 tgtcgccgccgccgaagggga 1662
>dbj|AK112059.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-047-A11, full insert sequence Length = 2025 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 381 tgtcgccgccgccgaagggga 401 ||||||||||||||||||||| Sbjct: 1642 tgtcgccgccgccgaagggga 1662
>dbj|AK111566.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013074J05, full insert sequence Length = 1556 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 381 tgtcgccgccgccgaagggga 401 ||||||||||||||||||||| Sbjct: 1068 tgtcgccgccgccgaagggga 1088
>dbj|AP004130.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1014_B05 Length = 121853 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 64 ctcccatcccatcccaacccatccc 88 |||||||||||||||| |||||||| Sbjct: 21070 ctcccatcccatcccatcccatccc 21094 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 21081 tcccatcccatcccatcccatccc 21104 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 21076 tcccatcccatcccatcccatccc 21099
>emb|AL163246.2|HS21C046 Homo sapiens chromosome 21 segment HS21C046 Length = 340000 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccct 89 ||||||||||||||| ||||||||| Sbjct: 117119 tcccatcccatcccatcccatccct 117095 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 117169 tcccatcccatcccatcccatccc 117146 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 117129 tcccatcccatcccatcccatccc 117106 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 117124 tcccatcccatcccatcccatccc 117101
>emb|CT573036.11| Mouse DNA sequence from clone RP24-376I11 on chromosome 9, complete sequence Length = 136639 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccct 89 ||||||||||||||| ||||||||| Sbjct: 101177 tcccatcccatcccatcccatccct 101153 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 101197 tcccatcccatcccatcccatccc 101174 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 101192 tcccatcccatcccatcccatccc 101169 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 101187 tcccatcccatcccatcccatccc 101164 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 101182 tcccatcccatcccatcccatccc 101159
>gb|AC006441.13|AC006441 Homo sapiens chromosome 17, clone hRPC.56_K_13, complete sequence Length = 162996 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 64 ctcccatcccatcccaacccatccc 88 |||||||||||||||| |||||||| Sbjct: 146326 ctcccatcccatcccatcccatccc 146302
>emb|AL355074.5|CNS05TC8 Human chromosome 14 DNA sequence BAC R-750I4 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 183672 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 64 ctcccatcccatcccaacccatccc 88 ||||||||||| ||||||||||||| Sbjct: 90675 ctcccatcccaccccaacccatccc 90651
>dbj|AP000486.6| Homo sapiens genomic DNA, chromosome 11q, clone:CMB9-23I22, complete sequence Length = 152472 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccct 89 ||||||||||||||| ||||||||| Sbjct: 151478 tcccatcccatcccatcccatccct 151454
>emb|AL845534.7| Mouse DNA sequence from clone RP23-223C17 on chromosome 2, complete sequence Length = 191379 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccct 89 ||||||||||||||| ||||||||| Sbjct: 55613 tcccatcccatcccatcccatccct 55589 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 55648 tcccatcccatcccatcccatccc 55625 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 55643 tcccatcccatcccatcccatccc 55620 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 55638 tcccatcccatcccatcccatccc 55615 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 55633 tcccatcccatcccatcccatccc 55610 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 55628 tcccatcccatcccatcccatccc 55605 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 55623 tcccatcccatcccatcccatccc 55600 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 55618 tcccatcccatcccatcccatccc 55595
>emb|AL512308.19| Human DNA sequence from clone RP11-164H16 on chromosome 6, complete sequence Length = 107455 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccct 89 ||||||||||||||| ||||||||| Sbjct: 32883 tcccatcccatcccatcccatccct 32907 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 32878 tcccatcccatcccatcccatccc 32901 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 32873 tcccatcccatcccatcccatccc 32896 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 32868 tcccatcccatcccatcccatccc 32891 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 32863 tcccatcccatcccatcccatccc 32886 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 32858 tcccatcccatcccatcccatccc 32881 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 32853 tcccatcccatcccatcccatccc 32876
>gb|AC157953.2| Gallus gallus BAC clone CH261-93C23 from chromosome unknown, complete sequence Length = 231813 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 64 ctcccatcccatcccaacccatccc 88 |||||||||||||||| |||||||| Sbjct: 160518 ctcccatcccatcccatcccatccc 160494 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 160512 tcccatcccatcccatcccatccc 160489 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 160507 tcccatcccatcccatcccatccc 160484 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 160502 tcccatcccatcccatcccatccc 160479 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 160497 tcccatcccatcccatcccatccc 160474 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 160492 tcccatcccatcccatcccatccc 160469 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 160487 tcccatcccatcccatcccatccc 160464
>emb|AL772137.8| Mouse DNA sequence from clone RP23-229A22 on chromosome 4, complete sequence Length = 165975 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccct 89 ||||||||||||||| ||||||||| Sbjct: 45943 tcccatcccatcccatcccatccct 45967 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 45938 tcccatcccatcccatcccatccc 45961 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 45933 tcccatcccatcccatcccatccc 45956 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 45928 tcccatcccatcccatcccatccc 45951
>emb|AL731864.25| Mouse DNA sequence from clone RP23-342F20 on chromosome 7, complete sequence Length = 148047 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 64 ctcccatcccatcccaacccatccc 88 |||||||||||||||| |||||||| Sbjct: 79601 ctcccatcccatcccatcccatccc 79625
>emb|AJ006995.1|HSF18108 Homo sapiens chromosome 21 PAC LLNLP704F18108Q13, complete sequence Length = 152383 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccct 89 ||||||||||||||| ||||||||| Sbjct: 114159 tcccatcccatcccatcccatccct 114135 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 114209 tcccatcccatcccatcccatccc 114186 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 114169 tcccatcccatcccatcccatccc 114146 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 114164 tcccatcccatcccatcccatccc 114141
>gb|AC122127.31| Mus musculus chromosome 1, clone RP24-401K1, complete sequence Length = 193324 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccct 89 ||||||||||||||| ||||||||| Sbjct: 33296 tcccatcccatcccatcccatccct 33320
>dbj|AP003680.2| Homo sapiens genomic DNA, chromosome 11q clone:RP11-739B23, complete sequences Length = 49000 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccct 89 ||||||||||||||| ||||||||| Sbjct: 1259 tcccatcccatcccatcccatccct 1235
>gb|AY830604.1| Urosticte benjamani adenylate kinase (AK1) gene, intron 5 and partial cds Length = 525 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 109 tcccatcccatcccatcccatccc 132 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 104 tcccatcccatcccatcccatccc 127 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 99 tcccatcccatcccatcccatccc 122 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 94 tcccatcccatcccatcccatccc 117
>gb|AY830535.1| Aglaeactis cupripennis adenylate kinase (AK1) gene, intron 5 and partial cds Length = 543 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 103 tcccatcccatcccatcccatccc 126 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 98 tcccatcccatcccatcccatccc 121 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 93 tcccatcccatcccatcccatccc 116 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 88 tcccatcccatcccatcccatccc 111 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83 tcccatcccatcccatcccatccc 106
>gb|AY830534.1| Aglaeactis castelnaudii adenylate kinase (AK1) gene, intron 5 and partial cds Length = 561 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 121 tcccatcccatcccatcccatccc 144 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 116 tcccatcccatcccatcccatccc 139 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 111 tcccatcccatcccatcccatccc 134 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 106 tcccatcccatcccatcccatccc 129 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 101 tcccatcccatcccatcccatccc 124 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 96 tcccatcccatcccatcccatccc 119 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 91 tcccatcccatcccatcccatccc 114 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 86 tcccatcccatcccatcccatccc 109 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 81 tcccatcccatcccatcccatccc 104
>gb|AY693425.1| Drosophila pseudoobscura isolate BP_159_160_C distal Arrowhead inversion breakpoint region Length = 20941 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 16342 tcccatcccatcccatcccatccc 16319
>gb|AC091470.16| Mus musculus chromosome 3, clone RP23-237K2, complete sequence Length = 141824 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 17475 tcccatcccatcccatcccatccc 17452 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 17470 tcccatcccatcccatcccatccc 17447 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 17465 tcccatcccatcccatcccatccc 17442 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 17460 tcccatcccatcccatcccatccc 17437 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 17455 tcccatcccatcccatcccatccc 17432
>gb|AC137855.14| Mus musculus chromosome 16, clone RP24-444E8, complete sequence Length = 196783 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 27692 tcccatcccatcccaccccatccc 27715 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 27682 tcccatcccatcccatcccatccc 27705 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 27677 tcccatcccatcccatcccatccc 27700 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 27642 tcccatcccatcccaccccatccc 27665 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 27588 tcccatcccatcccatcccatccc 27611 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 27353 tcccatcccatcccaccccatccc 27376 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 27299 tcccatcccatcccatcccatccc 27322
>gb|AC164597.11| Mus musculus chromosome 15, clone RP23-108H23, complete sequence Length = 190235 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 |||||||||||| ||||||||||| Sbjct: 121209 tcccatcccatctcaacccatccc 121232
>gb|AC107774.8| Mus musculus chromosome 5, clone RP23-99A9, complete sequence Length = 227044 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 82078 tcccatcccatcccatcccatccc 82055 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 82073 tcccatcccatcccatcccatccc 82050 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 82068 tcccatcccatcccatcccatccc 82045 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 82063 tcccatcccatcccatcccatccc 82040 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 82058 tcccatcccatcccatcccatccc 82035 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 82053 tcccatcccatcccatcccatccc 82030 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 82048 tcccatcccatcccatcccatccc 82025 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 82043 tcccatcccatcccatcccatccc 82020 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 82038 tcccatcccatcccatcccatccc 82015 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 82033 tcccatcccatcccatcccatccc 82010
>gb|AC104713.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1362_G11, complete sequence Length = 115808 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 376 gctcatgtcgccgccgccga 395 |||||||||||||||||||| Sbjct: 3622 gctcatgtcgccgccgccga 3641
>gb|AC119291.5| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0052K01, complete sequence Length = 144395 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 376 gctcatgtcgccgccgccga 395 |||||||||||||||||||| Sbjct: 136100 gctcatgtcgccgccgccga 136119
>gb|AC163675.4| Mus musculus BAC clone RP23-9G21 from chromosome 6, complete sequence Length = 243690 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 129074 tcccatcccatcccatcccatccc 129051 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 129069 tcccatcccatcccatcccatccc 129046 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 129064 tcccatcccatcccatcccatccc 129041
>gb|AC160982.5| Mus musculus BAC clone RP23-351J19 from chromosome 12, complete sequence Length = 231693 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 125094 tcccatcccatcccatcccatccc 125117 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 125089 tcccatcccatcccatcccatccc 125112 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 125084 tcccatcccatcccatcccatccc 125107 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 125079 tcccatcccatcccatcccatccc 125102 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 125074 tcccatcccatcccatcccatccc 125097 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 125069 tcccatcccatcccatcccatccc 125092 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 125064 tcccatcccatcccatcccatccc 125087 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 125059 tcccatcccatcccatcccatccc 125082 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 122799 tcccatcccatcccatcccatccc 122822 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 122794 tcccatcccatcccatcccatccc 122817 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 122789 tcccatcccatcccatcccatccc 122812 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 122784 tcccatcccatcccatcccatccc 122807 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 122779 tcccatcccatcccatcccatccc 122802 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 122774 tcccatcccatcccatcccatccc 122797 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 122769 tcccatcccatcccatcccatccc 122792 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 122764 tcccatcccatcccatcccatccc 122787 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 122759 tcccatcccatcccatcccatccc 122782 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 122754 tcccatcccatcccatcccatccc 122777 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 122749 tcccatcccatcccatcccatccc 122772
>ref|XM_475799.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1596 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 376 gctcatgtcgccgccgccga 395 |||||||||||||||||||| Sbjct: 814 gctcatgtcgccgccgccga 795
>gb|DQ214231.1| Taeniopygia guttata clone 0058P0053G01 mRNA sequence Length = 1190 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 64 ctcccatcccatcccaacccatcc 87 |||||||||||||||| ||||||| Sbjct: 759 ctcccatcccatcccatcccatcc 736
>gb|DQ214230.1| Taeniopygia guttata clone 0058P0032G03 mRNA sequence Length = 1190 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 64 ctcccatcccatcccaacccatcc 87 |||||||||||||||| ||||||| Sbjct: 759 ctcccatcccatcccatcccatcc 736
>gb|AC166776.6| Mus musculus chromosome 5, clone RP23-24K16, complete sequence Length = 216652 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 25660 tcccatcccatcccatcccatccc 25637 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 25655 tcccatcccatcccatcccatccc 25632 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 25650 tcccatcccatcccatcccatccc 25627 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 25645 tcccatcccatcccatcccatccc 25622 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 25640 tcccatcccatcccatcccatccc 25617
>ref|NM_192083.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1455 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 80 tcccatcccatcccatcccatccc 57
>ref|NM_002199.2| Homo sapiens interferon regulatory factor 2 (IRF2), mRNA Length = 2223 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 1756 tcccatcccatcccatcccatccc 1779 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 1751 tcccatcccatcccatcccatccc 1774 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 1746 tcccatcccatcccatcccatccc 1769 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 1741 tcccatcccatcccatcccatccc 1764
>gb|AC111130.17| Mus musculus chromosome 5, clone RP23-339G19, complete sequence Length = 212923 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 119024 tcccatcccatcccatcccatccc 119001 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 119019 tcccatcccatcccatcccatccc 118996 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 119014 tcccatcccatcccatcccatccc 118991
>gb|AY360386.1| Oryza sativa (japonica cultivar-group) chromosome 8 BAC OSJNBa0017M13, complete sequence Length = 161902 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 101067 tcccatcccatcccatcccatccc 101090
>gb|AC159991.9| Mus musculus chromosome 1, clone RP23-413H17, complete sequence Length = 180715 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 166735 tcccatcccatcccatcccatccc 166758 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 166730 tcccatcccatcccatcccatccc 166753 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 166725 tcccatcccatcccatcccatccc 166748 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 166720 tcccatcccatcccatcccatccc 166743 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 166715 tcccatcccatcccatcccatccc 166738 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 166710 tcccatcccatcccatcccatccc 166733 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 166705 tcccatcccatcccatcccatccc 166728
>gb|AC158579.7| Mus musculus chromosome 7, clone RP24-180F12, complete sequence Length = 179049 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 87615 tcccatcccatcccatcccatccc 87638 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 87610 tcccatcccatcccatcccatccc 87633 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 87605 tcccatcccatcccatcccatccc 87628 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 87600 tcccatcccatcccatcccatccc 87623 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 87595 tcccatcccatcccatcccatccc 87618 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 87590 tcccatcccatcccatcccatccc 87613
>gb|CP000068.1| Trypanosoma brucei chromosome 5, complete sequence Length = 1608198 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 600557 tcccatcccatcccatcccatccc 600534
>gb|AC104617.9| Trypanosoma brucei chromosome 5 clone RPCI93-1P6, complete sequence Length = 152664 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 76715 tcccatcccatcccatcccatccc 76738
>gb|AC153152.4| Mus musculus BAC clone RP23-78F1 from chromosome 12, complete sequence Length = 184523 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 61052 tcccatcccatcccatcccatccc 61029 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 61047 tcccatcccatcccatcccatccc 61024 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 61042 tcccatcccatcccatcccatccc 61019 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 61037 tcccatcccatcccatcccatccc 61014 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 61032 tcccatcccatcccatcccatccc 61009
>gb|AC164430.3| Mus musculus BAC clone RP23-441D9 from chromosome 9, complete sequence Length = 205185 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcccatcccatcccaaccca 84 |||||||||||||||||||| Sbjct: 198201 tcccatcccatcccaaccca 198220
>gb|AC009256.9| Drosophila melanogaster clone BACR03G18, complete sequence Length = 179931 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 132473 tcccatcccatcccatcccatccc 132450
>gb|AC009847.9| Drosophila melanogaster clone BACR03L10, complete sequence Length = 180498 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 159244 tcccatcccatcccatcccatccc 159267 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 159239 tcccatcccatcccatcccatccc 159262
>gb|AC011252.5| Drosophila melanogaster clone BACR23H21, complete sequence Length = 157965 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 82922 tcccatcccatcccatcccatccc 82899 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 82917 tcccatcccatcccatcccatccc 82894
>gb|AC009357.8| Drosophila melanogaster clone BACR18I07, complete sequence Length = 179374 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 9954 tcccatcccatcccatcccatccc 9931 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 9949 tcccatcccatcccatcccatccc 9926
>gb|AC138290.9| Mus musculus chromosome 10, clone RP23-245C15, complete sequence Length = 151470 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 21144 tcccatcccatcccatcccatccc 21121
>gb|AC124227.21| Mus musculus chromosome 1, clone RP23-118M13, complete sequence Length = 220762 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 196564 tcccatcccatcccatcccatccc 196587 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 196559 tcccatcccatcccatcccatccc 196582
>gb|AC091473.2| Mus musculus chromosome X clones RP21-114F21, RP21-430D6 complete sequence Length = 221860 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 64 ctcccatcccatcccaacccatcc 87 |||||||||||||||| ||||||| Sbjct: 157730 ctcccatcccatcccatcccatcc 157707
>gb|AC010707.17| Drosophila melanogaster clone BACR06P10, complete sequence Length = 176969 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 17875 tcccatcccatcccatcccatccc 17852
>gb|AC147962.1| Oryza sativa chromosome 3 BAC OSJNBa0083K01 genomic sequence, complete sequence Length = 167239 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 149919 tcccatcccatcccatcccatccc 149942
>gb|BC015803.2| Homo sapiens interferon regulatory factor 2, mRNA (cDNA clone MGC:9260 IMAGE:3920890), complete cds Length = 2088 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 1580 tcccatcccatcccatcccatccc 1603 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 1575 tcccatcccatcccatcccatccc 1598 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 1570 tcccatcccatcccatcccatccc 1593
>gb|AC139023.14| Mus musculus chromosome 1, clone RP23-430G15, complete sequence Length = 207067 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 97424 tcccatcccatcccatcccatccc 97401 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 97419 tcccatcccatcccatcccatccc 97396 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 97414 tcccatcccatcccatcccatccc 97391 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 97409 tcccatcccatcccatcccatccc 97386 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 97404 tcccatcccatcccatcccatccc 97381 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 97399 tcccatcccatcccatcccatccc 97376
>gb|AC148878.2| Chlamydomonas reinhardtii clone cr-29B2, complete sequence Length = 64153 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 291 tgccgccgcccttgccctgc 310 |||||||||||||||||||| Sbjct: 55460 tgccgccgcccttgccctgc 55441
>ref|NM_011799.2| Mus musculus cell division cycle 6 homolog (S. cerevisiae) (Cdc6), transcript variant 1, mRNA Length = 4608 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 3463 tcccatcccatcccatcccatccc 3440
>gb|CP000082.1| Psychrobacter arcticus 273-4, complete genome Length = 2650701 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 206 atctaaattatgttgaaacc 225 |||||||||||||||||||| Sbjct: 773522 atctaaattatgttgaaacc 773503
>ref|NM_001025779.1| Mus musculus cell division cycle 6 homolog (S. cerevisiae) (Cdc6), transcript variant 2, mRNA Length = 4532 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 3387 tcccatcccatcccatcccatccc 3364
>gb|AC132314.3| Mus musculus BAC clone RP24-233C4 from chromosome 18, complete sequence Length = 156356 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 100019 tcccatcccatcccatcccatccc 99996
>gb|AC090032.2| Canis familiaris clone RP81-386E20, complete sequence Length = 197836 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 194052 tcccatcccatcccaccccatccc 194029
>gb|AC158947.4| Mus musculus chromosome 7, clone RP23-230A4, complete sequence Length = 191195 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124158 tcccatcccatcccatcccatccc 124135 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124153 tcccatcccatcccatcccatccc 124130 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124148 tcccatcccatcccatcccatccc 124125 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124143 tcccatcccatcccatcccatccc 124120 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124138 tcccatcccatcccatcccatccc 124115 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 124133 tcccatcccatcccatcccatccc 124110
>gb|AC117567.12| Mus musculus chromosome 16, clone RP24-380O24, complete sequence Length = 195972 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 156356 tcccatcccatcccatcccatccc 156379 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 156351 tcccatcccatcccatcccatccc 156374 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 156346 tcccatcccatcccatcccatccc 156369 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 156341 tcccatcccatcccatcccatccc 156364 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 156336 tcccatcccatcccatcccatccc 156359
>gb|AC104542.10| Mus musculus chromosome 1, clone RP23-165D11, complete sequence Length = 211537 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 62105 tcccatcccatcccatcccatccc 62082 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 62100 tcccatcccatcccatcccatccc 62077 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 62095 tcccatcccatcccatcccatccc 62072 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 62090 tcccatcccatcccatcccatccc 62067 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 62085 tcccatcccatcccatcccatccc 62062 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 62080 tcccatcccatcccatcccatccc 62057
>gb|AC118610.9| Mus musculus chromosome 6, clone RP23-178I17, complete sequence Length = 255673 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 113386 tcccatcccatcccatcccatccc 113363 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 113381 tcccatcccatcccatcccatccc 113358 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 113376 tcccatcccatcccatcccatccc 113353 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 113371 tcccatcccatcccatcccatccc 113348 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 113366 tcccatcccatcccatcccatccc 113343 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 113361 tcccatcccatcccatcccatccc 113338
>gb|AC168270.1| Mus musculus BAC clone RP23-173C15 from chromosome 3, complete sequence Length = 216449 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 131347 tcccatcccatcccatcccatccc 131370
>gb|AC121546.13| Mus musculus chromosome 6, clone RP24-537N12, complete sequence Length = 207556 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 67209 tcccatcccatcccatcccatccc 67232 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 67204 tcccatcccatcccatcccatccc 67227
>gb|AC167719.2| Mus musculus BAC clone RP24-285I8 from chromosome 10, complete sequence Length = 180573 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 123924 tcccatcccatcccatcccatccc 123901
>gb|S35965.1| Mus musculus S alpha immunoglobulin switch region gene, complete sequence Length = 1401 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 551 tcccatcccatcccatcccatccc 528 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 546 tcccatcccatcccatcccatccc 523 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 541 tcccatcccatcccatcccatccc 518 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 536 tcccatcccatcccatcccatccc 513
>gb|AC146613.3| Mus musculus BAC clone RP23-36P1 from chromosome 18, complete sequence Length = 197939 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 22954 tcccatcccatcccatcccatccc 22931 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 22949 tcccatcccatcccatcccatccc 22926 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 22944 tcccatcccatcccatcccatccc 22921 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 22939 tcccatcccatcccatcccatccc 22916 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 22934 tcccatcccatcccatcccatccc 22911 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 22929 tcccatcccatcccatcccatccc 22906 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 22924 tcccatcccatcccatcccatccc 22901 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 22919 tcccatcccatcccatcccatccc 22896 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 22914 tcccatcccatcccatcccatccc 22891
>gb|AC140353.2| Mus musculus BAC clone RP24-67E1 from chromosome 5, complete sequence Length = 161652 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 45014 tcccatcccatcccatcccatccc 45037 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 45009 tcccatcccatcccatcccatccc 45032 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 45004 tcccatcccatcccatcccatccc 45027 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 44999 tcccatcccatcccatcccatccc 45022 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 44994 tcccatcccatcccatcccatccc 45017 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 44989 tcccatcccatcccatcccatccc 45012
>gb|AC115766.9| Mus musculus chromosome 1, clone RP23-82I24, complete sequence Length = 225600 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 218588 tcccatcccatcccatcccatccc 218611 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 218583 tcccatcccatcccatcccatccc 218606 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 218578 tcccatcccatcccatcccatccc 218601 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 218573 tcccatcccatcccatcccatccc 218596 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 218568 tcccatcccatcccatcccatccc 218591
>gb|AY528719.1| Homo sapiens estrogen-related receptor gamma (ESRRG) gene, complete cds Length = 590284 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 99952 tcccatcccatcccatcccatccc 99975 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 99947 tcccatcccatcccatcccatccc 99970 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 99942 tcccatcccatcccatcccatccc 99965 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 99937 tcccatcccatcccatcccatccc 99960 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 99932 tcccatcccatcccatcccatccc 99955 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 99927 tcccatcccatcccatcccatccc 99950 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 99922 tcccatcccatcccatcccatccc 99945 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 99917 tcccatcccatcccatcccatccc 99940 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 99912 tcccatcccatcccatcccatccc 99935 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 99907 tcccatcccatcccatcccatccc 99930
>gb|AC005158.3| Homo sapiens BAC clone GS1-250N6 from 7, complete sequence Length = 266344 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 150355 tcccatcccatcccatcccatccc 150378 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 150350 tcccatcccatcccatcccatccc 150373 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 150345 tcccatcccatcccatcccatccc 150368 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 150340 tcccatcccatcccatcccatccc 150363 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 150335 tcccatcccatcccatcccatccc 150358 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 150330 tcccatcccatcccatcccatccc 150353 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 150325 tcccatcccatcccatcccatccc 150348 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 150320 tcccatcccatcccatcccatccc 150343 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 150315 tcccatcccatcccatcccatccc 150338
>gb|AC139341.3| Atelerix albiventris clone LB4-464N6, complete sequence Length = 195266 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 184273 tcccatcccatcccatcccatccc 184296
>emb|CT030198.1| Platypus DNA sequence from clone XX-300J13, complete sequence Length = 149672 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 64 ctcccatcccatcccaacccatcc 87 |||||||||||||| ||||||||| Sbjct: 98449 ctcccatcccatcctaacccatcc 98426
>emb|CT009489.6| Mouse DNA sequence from clone RP23-97F8 on chromosome 14, complete sequence Length = 150382 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 45382 tcccatcccatcccatcccatccc 45405 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 45377 tcccatcccatcccatcccatccc 45400 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 45372 tcccatcccatcccatcccatccc 45395 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 45367 tcccatcccatcccatcccatccc 45390
>emb|X62548.1|MMSREGU M.musculus germline DNA for upstream region of immunoglobulin S alpha region Length = 1145 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 294 tcccatcccatcccatcccatccc 271 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 289 tcccatcccatcccatcccatccc 266 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 284 tcccatcccatcccatcccatccc 261 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 279 tcccatcccatcccatcccatccc 256
>gb|AC123798.5| Mus musculus BAC clone RP24-334O8 from chromosome 3, complete sequence Length = 168467 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 86141 tcccatcccatcccatcccatccc 86164 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 86136 tcccatcccatcccatcccatccc 86159 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 86131 tcccatcccatcccatcccatccc 86154 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 86126 tcccatcccatcccatcccatccc 86149 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 86121 tcccatcccatcccatcccatccc 86144 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 86116 tcccatcccatcccatcccatccc 86139 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 86111 tcccatcccatcccatcccatccc 86134 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 86081 tcccatcccatcccatcccatccc 86104
>gb|AC123051.4| Mus musculus BAC clone RP24-366E4 from chromosome 6, complete sequence Length = 143909 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 81158 tcccatcccatcccatcccatccc 81135 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 81153 tcccatcccatcccatcccatccc 81130
>gb|AC132585.3| Mus musculus BAC clone RP24-355K7 from chromosome 6, complete sequence Length = 133621 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 103323 tcccatcccatcccatcccatccc 103346 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 103318 tcccatcccatcccatcccatccc 103341 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 103313 tcccatcccatcccatcccatccc 103336 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 103308 tcccatcccatcccatcccatccc 103331 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 103303 tcccatcccatcccatcccatccc 103326 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 103298 tcccatcccatcccatcccatccc 103321 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 103293 tcccatcccatcccatcccatccc 103316 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 103288 tcccatcccatcccatcccatccc 103311 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 103283 tcccatcccatcccatcccatccc 103306 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 103278 tcccatcccatcccatcccatccc 103301
>gb|AC129295.4| Mus musculus BAC clone RP24-560M23 from chromosome 1, complete sequence Length = 121538 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 99659 tcccatcccatcccatcccatccc 99682
>gb|AC130221.4| Mus musculus BAC clone RP23-168E11 from chromosome 5, complete sequence Length = 200384 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 126518 tcccatcccatcccatcccatccc 126541 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 126513 tcccatcccatcccatcccatccc 126536 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 126508 tcccatcccatcccatcccatccc 126531 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 126503 tcccatcccatcccatcccatccc 126526 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 126498 tcccatcccatcccatcccatccc 126521 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 126493 tcccatcccatcccatcccatccc 126516 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 126488 tcccatcccatcccatcccatccc 126511
>gb|AC133190.2| Mus musculus BAC clone RP23-375H9 from chromosome 10, complete sequence Length = 151273 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 40879 tcccatcccatcccatcccatccc 40856
>gb|AC111188.8| Homo sapiens chromosome 11, clone RP11-179A10, complete sequence Length = 146308 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 26989 tcccatcccatcccatcccatccc 27012
>gb|AC122019.4| Mus musculus BAC clone RP24-362J12 from chromosome 6, complete sequence Length = 114337 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 79328 tcccatcccatcccatcccatccc 79351 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 79323 tcccatcccatcccatcccatccc 79346 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 79318 tcccatcccatcccatcccatccc 79341 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 79313 tcccatcccatcccatcccatccc 79336 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 79308 tcccatcccatcccatcccatccc 79331 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 79303 tcccatcccatcccatcccatccc 79326 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 79298 tcccatcccatcccatcccatccc 79321 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 79293 tcccatcccatcccatcccatccc 79316 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 79288 tcccatcccatcccatcccatccc 79311 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 79283 tcccatcccatcccatcccatccc 79306
>gb|AC129213.4| Mus musculus BAC clone RP24-391M2 from chromosome 6, complete sequence Length = 154613 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 19039 tcccatcccatcccatcccatccc 19016 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 19034 tcccatcccatcccatcccatccc 19011 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 19029 tcccatcccatcccatcccatccc 19006 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 18999 tcccatcccatcccatcccatccc 18976 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 18994 tcccatcccatcccatcccatccc 18971
>gb|AC124408.4| Mus musculus BAC clone RP24-262E22 from chromosome 14, complete sequence Length = 159082 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 145015 tcccatcccatcccatcccatccc 145038 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 145010 tcccatcccatcccatcccatccc 145033 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 145005 tcccatcccatcccatcccatccc 145028 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 145000 tcccatcccatcccatcccatccc 145023
>gb|AC121839.3| Mus musculus BAC clone RP24-76E2 from chromosome 13, complete sequence Length = 182835 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 73742 tcccatcccatcccatcccatccc 73719 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 73737 tcccatcccatcccatcccatccc 73714 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 73732 tcccatcccatcccatcccatccc 73709 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 73727 tcccatcccatcccatcccatccc 73704 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 73722 tcccatcccatcccatcccatccc 73699 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 73717 tcccatcccatcccatcccatccc 73694 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 73712 tcccatcccatcccatcccatccc 73689
>emb|CR956377.9| Pig DNA sequence from clone PigE-220E19 on chromosome 7, complete sequence Length = 222390 Score = 40.1 bits (20), Expect = 5.5 Identities = 32/36 (88%) Strand = Plus / Minus Query: 63 actcccatcccatcccaacccatccctatacatgca 98 ||||||| ||||||||||||| ||||| | |||||| Sbjct: 56304 actcccagcccatcccaacccctccctgtccatgca 56269
>emb|CR956388.7| Pig DNA sequence from clone PigI-736G5 on chromosome 7, complete sequence Length = 151383 Score = 40.1 bits (20), Expect = 5.5 Identities = 32/36 (88%) Strand = Plus / Minus Query: 63 actcccatcccatcccaacccatccctatacatgca 98 ||||||| ||||||||||||| ||||| | |||||| Sbjct: 85878 actcccagcccatcccaacccctccctgtccatgca 85843
>gb|AC131736.2| Mus musculus BAC clone RP23-104E2 from 18, complete sequence Length = 180201 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 154805 tcccatcccatcccatcccatccc 154782 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 154800 tcccatcccatcccatcccatccc 154777 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 154795 tcccatcccatcccatcccatccc 154772 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 154790 tcccatcccatcccatcccatccc 154767 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 154785 tcccatcccatcccatcccatccc 154762 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 154780 tcccatcccatcccatcccatccc 154757 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 154775 tcccatcccatcccatcccatccc 154752 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 154770 tcccatcccatcccatcccatccc 154747 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 154765 tcccatcccatcccatcccatccc 154742
>emb|CR855371.13| Chicken DNA sequence from clone WAG-45A21, complete sequence Length = 104062 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 65067 tcccatcccatcccatcccatccc 65044 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 65062 tcccatcccatcccatcccatccc 65039
>emb|BX640401.2| Chicken DNA sequence from clone WAG-106I4, complete sequence Length = 104753 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 13928 tcccatcccatcccatcccatccc 13951 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 13923 tcccatcccatcccatcccatccc 13946 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 13918 tcccatcccatcccatcccatccc 13941 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 13913 tcccatcccatcccatcccatccc 13936 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 13908 tcccatcccatcccatcccatccc 13931
>gb|AC083946.5| Mus musculus strain C57BL6/J chromosome 6 clone RP23-132J21, complete sequence Length = 200910 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 108604 tcccatcccatcccatcccatccc 108581 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 108599 tcccatcccatcccatcccatccc 108576 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 108594 tcccatcccatcccatcccatccc 108571 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 108564 tcccatcccatcccatcccatccc 108541 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 108559 tcccatcccatcccatcccatccc 108536 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 16212 tcccatcccatcccatcccatccc 16235 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 16207 tcccatcccatcccatcccatccc 16230 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 16202 tcccatcccatcccatcccatccc 16225 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 16197 tcccatcccatcccatcccatccc 16220 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 16192 tcccatcccatcccatcccatccc 16215 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 16187 tcccatcccatcccatcccatccc 16210 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 16182 tcccatcccatcccatcccatccc 16205 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 16177 tcccatcccatcccatcccatccc 16200 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 16172 tcccatcccatcccatcccatccc 16195 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 16167 tcccatcccatcccatcccatccc 16190
>gb|AC124189.3| Mus musculus BAC clone RP23-254C8 from 5, complete sequence Length = 150507 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 143362 tcccatcccatcccatcccatccc 143385 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 143357 tcccatcccatcccatcccatccc 143380 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 143352 tcccatcccatcccatcccatccc 143375 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 143347 tcccatcccatcccatcccatccc 143370 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 143342 tcccatcccatcccatcccatccc 143365 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 143337 tcccatcccatcccatcccatccc 143360
>gb|BC052434.1| Mus musculus cell division cycle 6 homolog (S. cerevisiae), mRNA (cDNA clone MGC:63392 IMAGE:6837113), complete cds Length = 4442 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 3387 tcccatcccatcccatcccatccc 3364
>gb|AY379550.1| Mus musculus housekeeping 5-aminolevulinic acid synthase (Alas1) gene, promoter region and 5'UTR Length = 18184 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcccatcccatcccaaccca 84 |||||||||||||||||||| Sbjct: 374 tcccatcccatcccaaccca 355
>gb|AC113272.11| Mus musculus chromosome 1, clone RP23-379C24, complete sequence Length = 170622 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 131030 tcccatcccatcccatcccatccc 131053 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 131025 tcccatcccatcccatcccatccc 131048 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 131020 tcccatcccatcccatcccatccc 131043 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 131015 tcccatcccatcccatcccatccc 131038 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 131010 tcccatcccatcccatcccatccc 131033 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 131005 tcccatcccatcccatcccatccc 131028 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 131000 tcccatcccatcccatcccatccc 131023 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 130995 tcccatcccatcccatcccatccc 131018
>gb|AC107765.9| Mus musculus chromosome 17, clone RP23-166P7, complete sequence Length = 229687 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 65233 tcccatcccatcccatcccatccc 65256 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 65228 tcccatcccatcccatcccatccc 65251
>gb|AC019028.13| Mus musculus chromosome 5, clone RP23-88A22, complete sequence Length = 264425 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 94891 tcccatcccatcccaccccatccc 94914 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 94847 tcccatcccatcccaccccatccc 94870 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 94837 tcccatcccatcccatcccatccc 94860 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 94773 tcccatcccatcccaccccatccc 94796 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 94763 tcccatcccatcccatcccatccc 94786 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 94758 tcccatcccatcccatcccatccc 94781
>gb|AC138101.8| Mus musculus chromosome 5, clone RP23-149H20, complete sequence Length = 211521 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 174353 tcccatcccatcccaccccatccc 174376 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 174309 tcccatcccatcccaccccatccc 174332 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 174299 tcccatcccatcccatcccatccc 174322 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 174235 tcccatcccatcccaccccatccc 174258 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 174225 tcccatcccatcccatcccatccc 174248 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 174220 tcccatcccatcccatcccatccc 174243
>gb|AC090445.3| Canis familiaris clone RP81-55A4, complete sequence Length = 163762 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 21970 tcccatcccatcccatcccatccc 21947 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 21965 tcccatcccatcccatcccatccc 21942 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 21960 tcccatcccatcccatcccatccc 21937 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 21955 tcccatcccatcccatcccatccc 21932 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 21950 tcccatcccatcccatcccatccc 21927 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 21945 tcccatcccatcccatcccatccc 21922 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 21940 tcccatcccatcccatcccatccc 21917
>emb|Z97635.10|HS438L4 Human DNA sequence from clone RP3-438L4 on chromosome 1p36.2-36.3 Contains part of the CAMTA1 gene for calmodulin binding transcription activator 1, complete sequence Length = 87100 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 12317 tcccatcccatcccatcccatccc 12340 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 12312 tcccatcccatcccatcccatccc 12335 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 12307 tcccatcccatcccatcccatccc 12330 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 12302 tcccatcccatcccatcccatccc 12325 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 12297 tcccatcccatcccatcccatccc 12320 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 12292 tcccatcccatcccatcccatccc 12315
>emb|Z95889.1|HS211A9 Human DNA sequence from clone CTA-211A9 on chromosome 22q12.1, complete sequence Length = 117939 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 29493 tcccatcccatcccatcccatccc 29516 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 29488 tcccatcccatcccatcccatccc 29511 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 29483 tcccatcccatcccatcccatccc 29506
>emb|AL669831.13| Human DNA sequence from clone RP11-206L10 on chromosome 1 Contains thirteen novel genes, a novel pseudogene, a novel gene similar to the F-box only protein 25 gene(FBXO25), a novel pseudogene similar to the beta-tubulin family and a CpG island, complete sequence Length = 179567 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 92582 tcccatcccatcccatcccatccc 92559 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 92577 tcccatcccatcccatcccatccc 92554 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 92572 tcccatcccatcccatcccatccc 92549
>emb|AL590143.4| Human DNA sequence from clone RP11-132M7 on chromosome 6 Contains two novel genes and a pseudogene similar to part of cytochrome c oxidase subunit VIIa polypeptide 1 (muscle) (COX7A1) (COX7A COX7AM), complete sequence Length = 73070 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 39699 tcccatcccatcccatcccatccc 39676 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 39694 tcccatcccatcccatcccatccc 39671 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 39689 tcccatcccatcccatcccatccc 39666
>emb|AL445143.2| Human DNA sequence from clone RP11-172E9 on chromosome 13 Contains a novel gene, complete sequence Length = 148571 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 54715 tcccatcccatcccatcccatccc 54692 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 54710 tcccatcccatcccatcccatccc 54687 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 54705 tcccatcccatcccatcccatccc 54682 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 54700 tcccatcccatcccatcccatccc 54677 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 54695 tcccatcccatcccatcccatccc 54672 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 54690 tcccatcccatcccatcccatccc 54667 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 54685 tcccatcccatcccatcccatccc 54662
>emb|AL390037.16| Human DNA sequence from clone RP5-851M4 on chromosome 20 Contains ESTs, STSs and GSSs, complete sequence Length = 79531 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 2683 tcccatcccatcccatcccatccc 2660 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 2678 tcccatcccatcccatcccatccc 2655 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 2673 tcccatcccatcccatcccatccc 2650 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 2668 tcccatcccatcccatcccatccc 2645
>emb|AL359915.14| Human DNA sequence from clone RP11-418J17 on chromosome 1 Contains the 3' end of a novel gene, a ribosomal protein L6 (RPL6) pseudogene and the 5' end of a novel gene, complete sequence Length = 159158 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 139814 tcccatcccatcccatcccatccc 139837 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 139809 tcccatcccatcccatcccatccc 139832
>emb|AL365361.12| Human DNA sequence from clone RP11-284N8 on chromosome 1 Contains the KCNA2 gene for a potassium voltage-gated channel from the shaker-related subfamily member 2, the KCNA3 gene for a potassium voltage-gated channel from the shaker-related subfamily member 3 and two CpG islands, complete sequence Length = 193182 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 23612 tcccatcccatcccatcccatccc 23635 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 23607 tcccatcccatcccatcccatccc 23630
>emb|AL157934.17| Human DNA sequence from clone RP11-449M9 on chromosome Xq13.1-13.3 Contains the 3' end of the SLC16A2 gene for solute carrier family 16 member 2 and two CpG islands, complete sequence Length = 106497 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 70564 tcccatcccatcccatcccatccc 70541
>emb|AL049541.24|HSJ991B18 Human DNA sequence from clone RP5-991B18 on chromosome 20q13.11-13.3 Contains a putative novel gene, ESTs, STSs and GSSs, complete sequence Length = 129874 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 19774 tcccatcccatcccatcccatccc 19751
>gb|AC163009.2| Mus musculus chromosome 1, clone RP23-268A12, complete sequence Length = 147135 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 47790 tcccatcccatcccatcccatccc 47813 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 47785 tcccatcccatcccatcccatccc 47808 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 47780 tcccatcccatcccatcccatccc 47803 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 47775 tcccatcccatcccatcccatccc 47798 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 47770 tcccatcccatcccatcccatccc 47793 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 47765 tcccatcccatcccatcccatccc 47788 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 47760 tcccatcccatcccatcccatccc 47783 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 47755 tcccatcccatcccatcccatccc 47778
>emb|AJ893305.1| Uncultured ectomycorrhiza (Thelephoraceae) 5.8S rRNA gene, 28S rRNA gene (partial), ITS1 and ITS2, isolate L280_T14 Length = 959 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 331 gacgtagaaccacaggaaga 350 |||||||||||||||||||| Sbjct: 134 gacgtagaaccacaggaaga 115
>ref|XM_965102.1| PREDICTED: Tribolium castaneum similar to CG8814-PA (LOC658740), mRNA Length = 2361 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 234 agaaggcgggacgccgccct 253 |||||||||||||||||||| Sbjct: 1678 agaaggcgggacgccgccct 1659
>gb|AC096310.9| Rattus norvegicus 1 BAC CH230-121B19 (Children's Hospital Oakland Research Institute) complete sequence Length = 218258 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 79228 tcccatcccatcccatcccatccc 79251 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 79223 tcccatcccatcccatcccatccc 79246 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 79218 tcccatcccatcccatcccatccc 79241 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 79213 tcccatcccatcccatcccatccc 79236 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 79208 tcccatcccatcccatcccatccc 79231 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 79203 tcccatcccatcccatcccatccc 79226 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 79198 tcccatcccatcccatcccatccc 79221
>emb|X67291.1|NCGLA1 N.crassa gla-1 gene for glucan 1,4-alpha-glucosidase Length = 3718 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 574 tcccatcccatcccatcccatccc 597 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 569 tcccatcccatcccatcccatccc 592
>emb|X15949.1|HSIRF2 Human mRNA for interferon regulatory factor-2 (IRF-2) Length = 2144 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 1677 tcccatcccatcccatcccatccc 1700 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 1672 tcccatcccatcccatcccatccc 1695 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 1667 tcccatcccatcccatcccatccc 1690 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 1662 tcccatcccatcccatcccatccc 1685
>gb|AC163719.4| Mus musculus BAC clone RP23-421M6 from chromosome 9, complete sequence Length = 177404 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 114720 tcccatcccatcccatcccatccc 114697 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 114715 tcccatcccatcccatcccatccc 114692 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 114710 tcccatcccatcccatcccatccc 114687 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 114705 tcccatcccatcccatcccatccc 114682 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 114700 tcccatcccatcccatcccatccc 114677 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 114695 tcccatcccatcccatcccatccc 114672 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 114690 tcccatcccatcccatcccatccc 114667
>gb|AC161351.3| Mus musculus chromosome 15, clone RP24-142I15, complete sequence Length = 161308 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 56944 tcccatcccatcccatcccatccc 56921 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 56939 tcccatcccatcccatcccatccc 56916 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 56934 tcccatcccatcccatcccatccc 56911 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 56929 tcccatcccatcccatcccatccc 56906 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 56924 tcccatcccatcccatcccatccc 56901 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 56919 tcccatcccatcccatcccatccc 56896 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 56914 tcccatcccatcccatcccatccc 56891 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 56909 tcccatcccatcccatcccatccc 56886 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 56904 tcccatcccatcccatcccatccc 56881
>emb|AL670003.1|NCB9G16 Neurospora crassa DNA linkage group II BAC clone B9G16 Length = 69187 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 13437 tcccatcccatcccatcccatccc 13414 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 13432 tcccatcccatcccatcccatccc 13409
>gb|AY172184.1| Loxodonta africana microsatellite LaT26 sequence Length = 671 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 452 tcccatcccatcccatcccatccc 429 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 447 tcccatcccatcccatcccatccc 424 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 442 tcccatcccatcccatcccatccc 419
>emb|AL606480.11| Mouse DNA sequence from clone RP23-112C19 on chromosome 11 Contains the 3' end of the Col1a1 gene for procollagen type I alpha 1, the Sgca gene for alpha sarcoglycan (dystrophin-associated glycoprotein), the Hils1 gene for histone H1-like protein in spermatids 1, the Ppp1r9b gene for protein phosphatase 1 regulatory subunit 9B, a novel gene (A930041A10Rik, B930032I08Rik, C530046K03Rik), the Pdk2 gene for pyruvate dehydrogenase kinase isoenzyme 2, a novel gene, the Itga3 gene for integrin alpha 3, the Dlx3 gene for distal-less homeobox 3 and three CpG islands, complete sequence Length = 186276 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 141503 tcccatcccatcccatcccatccc 141480 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 141498 tcccatcccatcccatcccatccc 141475 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 141493 tcccatcccatcccatcccatccc 141470 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 141488 tcccatcccatcccatcccatccc 141465 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 141483 tcccatcccatcccatcccatccc 141460
>emb|AL606621.3|OSJN00054 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0072K14, complete sequence Length = 139855 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 88622 tcccatcccatcccatcccatccc 88645
>emb|AL606606.3|OSJN00046 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0005B05, complete sequence Length = 149134 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 77183 tcccatcccatcccatcccatccc 77206
>emb|AL355932.1|NCB5O22 Neurospora crassa DNA linkage group II BAC clone B5O22 Length = 58349 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 10416 tcccatcccatcccatcccatccc 10439 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 10411 tcccatcccatcccatcccatccc 10434
>emb|AJ238108.1|ACH238108 Acremonium chrysogenum cah gene, exons 1-3 Length = 1621 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 67 ccatcccatcccaacccatc 86 |||||||||||||||||||| Sbjct: 87 ccatcccatcccaacccatc 106
>gb|AC158749.5| Mus musculus chromosome 7, clone RP23-285C18, complete sequence Length = 237364 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 177410 tcccatcccatcccatcccatccc 177387 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 177405 tcccatcccatcccatcccatccc 177382 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 177400 tcccatcccatcccatcccatccc 177377 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 177395 tcccatcccatcccatcccatccc 177372 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 177390 tcccatcccatcccatcccatccc 177367 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 177385 tcccatcccatcccatcccatccc 177362
>emb|AL592215.12| Mouse DNA sequence from clone RP23-172P19 on chromosome 11 Contains two novel genes (4930452L02Rik and B430319H21Rik), the 3' end of the gene for a novel protein (1700019I23Rik), the gene for a novel protein (4933407G07Rik), the Pmp22 gene for peripheral myelin protein and a CpG island, complete sequence Length = 219468 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 164805 tcccatcccatcccatcccatccc 164782 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 164800 tcccatcccatcccatcccatccc 164777
>gb|AC132214.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0040M05, from chromosome 3, complete sequence Length = 153126 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 146173 tcccatcccatcccatcccatccc 146196
>emb|AL929414.5| Mouse DNA sequence from clone RP23-222A19 on chromosome 11, complete sequence Length = 153928 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 12850 tcccatcccatcccatcccatccc 12827 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 12845 tcccatcccatcccatcccatccc 12822 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 12840 tcccatcccatcccatcccatccc 12817 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 12835 tcccatcccatcccatcccatccc 12812 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 12830 tcccatcccatcccatcccatccc 12807 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 12825 tcccatcccatcccatcccatccc 12802 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 12820 tcccatcccatcccatcccatccc 12797
>emb|AL626804.10| Zebrafish DNA sequence from clone RP71-1H10 in linkage group 1 Contains a novel gene similar to human CTNNA2 (catenin (cadherin-associated protein), alpha 2) and three CpG islands, complete sequence Length = 149717 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 101221 tcccatcccatcccatcccatccc 101198 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 101191 tcccatcccatcccatcccatccc 101168 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 101186 tcccatcccatcccatcccatccc 101163
>emb|AL596209.13| Mouse DNA sequence from clone RP23-278F12 on chromosome 11 Contains the 3' end of the Ulk2 gene for Unc-51 like kinase 2 (C. elegans), the Prpsap2 gene for phosphoribosyl pyrophosphate synthetase-associated protein 2, the gene for a novel sodium/glucose cotransporter protein, the gene for a novel protein (2310040C09Rik), the Grap gene for GRB2-related adaptor protein and a CpG island, complete sequence Length = 186359 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 89611 tcccatcccatcccatcccatccc 89588 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 89606 tcccatcccatcccatcccatccc 89583 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 89601 tcccatcccatcccatcccatccc 89578 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 89596 tcccatcccatcccatcccatccc 89573 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 89591 tcccatcccatcccatcccatccc 89568 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 89586 tcccatcccatcccatcccatccc 89563 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 89576 tcccatcccatcccaccccatccc 89553
>gb|AC120128.17| Mus musculus chromosome 5, clone RP23-181F22, complete sequence Length = 213246 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 68664 tcccatcccatcccatcccatccc 68687 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 68659 tcccatcccatcccatcccatccc 68682 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 68654 tcccatcccatcccatcccatccc 68677
>gb|AC163901.2| Mus musculus BAC clone RP23-269N21 from chromosome 17, complete sequence Length = 202092 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 37403 tcccatcccatcccatcccatccc 37380 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 37398 tcccatcccatcccatcccatccc 37375 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 37393 tcccatcccatcccatcccatccc 37370 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 37388 tcccatcccatcccatcccatccc 37365
>dbj|D11468.1|MUSIALPHA Mus musculus gene for immunoglobulin alpha heavy chain, switch region and constant region, complete cds Length = 7255 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 4573 tcccatcccatcccatcccatccc 4550 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 4568 tcccatcccatcccatcccatccc 4545 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 1703 tcccatcccatcccatcccatccc 1680 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 1698 tcccatcccatcccatcccatccc 1675 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 1693 tcccatcccatcccatcccatccc 1670 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 1688 tcccatcccatcccatcccatccc 1665
>emb|BX908803.7| Zebrafish DNA sequence from clone CH211-13C14 in linkage group 3, complete sequence Length = 186802 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 4 tccttatacgtctagcattt 23 |||||||||||||||||||| Sbjct: 53083 tccttatacgtctagcattt 53064
>gb|AC161106.13| Medicago truncatula clone mth2-168f23, complete sequence Length = 94766 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 45087 tcccatcccatcccatcccatccc 45064
>gb|AC023850.10| Homo sapiens chromosome 11, clone RP11-48J22, complete sequence Length = 165031 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 156725 tcccatcccatcccatcccatccc 156748
>gb|AC106899.5| Homo sapiens BAC clone RP11-734N2 from 2, complete sequence Length = 132562 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 56561 tcccatcccatcccatcccatccc 56584
>gb|AC051654.9| Homo sapiens chromosome 8, clone RP11-35O14, complete sequence Length = 176393 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 126372 tcccatcccatcccatcccatccc 126349 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 126367 tcccatcccatcccatcccatccc 126344 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 126357 tcccatcccatcccaccccatccc 126334 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 126337 tcccatcccatcccatcccatccc 126314 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 126332 tcccatcccatcccatcccatccc 126309 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 126327 tcccatcccatcccatcccatccc 126304 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 126317 tcccatcccatcccaccccatccc 126294
>gb|AC092133.2| Homo sapiens chromosome 16 clone RP11-20D16, complete sequence Length = 156351 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 202 atctatctaaattatgttgaaacc 225 ||||||||||||||| |||||||| Sbjct: 17369 atctatctaaattattttgaaacc 17392
>gb|AC091521.19| Mus musculus chromosome 1 clone rp23-145f9, complete sequence Length = 198784 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 127874 tcccatcccatcccatcccatccc 127897 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 127869 tcccatcccatcccatcccatccc 127892 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 127864 tcccatcccatcccatcccatccc 127887 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 127859 tcccatcccatcccatcccatccc 127882
>gb|AC103967.4| Homo sapiens chromosome 15, clone CTD-3221M10, complete sequence Length = 201545 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 59178 tcccatcccatcccatcccatccc 59201 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 59173 tcccatcccatcccatcccatccc 59196 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 59168 tcccatcccatcccatcccatccc 59191
>gb|AC009630.14| Homo sapiens chromosome 8, clone RP11-360L9, complete sequence Length = 219622 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 59236 tcccatcccatcccaccccatccc 59259
>gb|AC099343.3| Homo sapiens BAC clone RP11-326I11 from 4, complete sequence Length = 196216 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 2477 tcccatcccatcccatcccatccc 2454 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 2472 tcccatcccatcccatcccatccc 2449 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 2467 tcccatcccatcccatcccatccc 2444 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 2462 tcccatcccatcccatcccatccc 2439
>gb|AC108131.2| Homo sapiens chromosome 16 clone RP11-337N9, complete sequence Length = 151941 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 202 atctatctaaattatgttgaaacc 225 ||||||||||||||| |||||||| Sbjct: 74262 atctatctaaattattttgaaacc 74285
>gb|AC096634.2| Homo sapiens chromosome 1 clone RP11-66M7, complete sequence Length = 163926 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 21715 tcccatcccatcccatcccatccc 21692 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 21710 tcccatcccatcccatcccatccc 21687 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 21705 tcccatcccatcccatcccatccc 21682 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 21700 tcccatcccatcccatcccatccc 21677 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 21695 tcccatcccatcccatcccatccc 21672 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 21690 tcccatcccatcccatcccatccc 21667 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 21685 tcccatcccatcccatcccatccc 21662 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 21680 tcccatcccatcccatcccatccc 21657 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 21675 tcccatcccatcccatcccatccc 21652 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 21670 tcccatcccatcccatcccatccc 21647
>gb|AC012454.8| Homo sapiens BAC clone RP11-439L14 from 2, complete sequence Length = 185512 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 59559 tcccatcccatcccatcccatccc 59582
>gb|AF380138.1|AF380138 Monkeypox virus strain Zaire-96-I-16, complete genome Length = 196858 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 31768 tcccatcccatcccatcccatccc 31791
>gb|AC022681.8| Homo sapiens chromosome 8, clone RP11-731D24, complete sequence Length = 219658 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 52975 tcccatcccatcccatcccatccc 52998 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 52970 tcccatcccatcccatcccatccc 52993 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 52965 tcccatcccatcccatcccatccc 52988
>gb|AC013526.7| Homo sapiens, clone RP11-114I24, complete sequence Length = 156895 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 143986 tcccatcccatcccatcccatccc 144009 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 143981 tcccatcccatcccatcccatccc 144004 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 143930 tcccatcccatcccatcccatccc 143953 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 143925 tcccatcccatcccatcccatccc 143948
>gb|AC169375.4| Sorghum bicolor clone SB_BBc0020O07, complete sequence Length = 117931 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 87 cctatacatgcatgatcctc 106 |||||||||||||||||||| Sbjct: 60126 cctatacatgcatgatcctc 60107
>gb|AC099027.1| Drosophila melanogaster, chromosome 2R, region 53C-53D, BAC clone BACR06I15, complete sequence Length = 185425 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 131828 tcccatcccatcccatcccatccc 131851
>gb|AC011614.8| Drosophila melanogaster, chromosome X, region 16F-17A, BAC clone BACR48L05, complete sequence Length = 177138 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 5929 tcccatcccatcccatcccatccc 5952
>gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, complete genome Length = 3561584 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 296 ccgcccttgccctgcgcgacggcg 319 ||||||||||||||||||| |||| Sbjct: 3371685 ccgcccttgccctgcgcgagggcg 3371662
>dbj|AK162669.1| Mus musculus adult male bone cDNA, RIKEN full-length enriched library, clone:9830165N12 product:cell division cycle 6 homolog (S. cerevisiae), full insert sequence Length = 4803 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 3660 tcccatcccatcccatcccatccc 3637
>gb|AC159710.9| Mus musculus 10 BAC RP24-325N16 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 204302 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 153781 tcccatcccatcccatcccatccc 153804 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 153776 tcccatcccatcccatcccatccc 153799 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 153771 tcccatcccatcccatcccatccc 153794 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 153766 tcccatcccatcccatcccatccc 153789 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 153761 tcccatcccatcccatcccatccc 153784 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 153756 tcccatcccatcccatcccatccc 153779 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 153751 tcccatcccatcccatcccatccc 153774
>gb|DP000003.1| Atelerix albiventris target 1 genomic scaffold Length = 2136267 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 1319681 tcccatcccatcccatcccatccc 1319704
>gb|AC151535.2| Mus musculus BAC clone RP23-213M8 from chromosome 7, complete sequence Length = 216527 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 121464 tcccatcccatcccatcccatccc 121441
>gb|AC153363.4| Mus musculus BAC clone RP23-5I6 from chromosome 9, complete sequence Length = 185444 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83810 tcccatcccatcccatcccatccc 83833 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83805 tcccatcccatcccatcccatccc 83828 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83800 tcccatcccatcccatcccatccc 83823 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83795 tcccatcccatcccatcccatccc 83818 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83790 tcccatcccatcccatcccatccc 83813 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83785 tcccatcccatcccatcccatccc 83808 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83780 tcccatcccatcccatcccatccc 83803 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83775 tcccatcccatcccatcccatccc 83798 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83770 tcccatcccatcccatcccatccc 83793 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83765 tcccatcccatcccatcccatccc 83788 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83760 tcccatcccatcccatcccatccc 83783 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83755 tcccatcccatcccatcccatccc 83778 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83750 tcccatcccatcccatcccatccc 83773 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83745 tcccatcccatcccatcccatccc 83768 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83740 tcccatcccatcccatcccatccc 83763 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83735 tcccatcccatcccatcccatccc 83758 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83730 tcccatcccatcccatcccatccc 83753 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83725 tcccatcccatcccatcccatccc 83748 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83720 tcccatcccatcccatcccatccc 83743 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83715 tcccatcccatcccatcccatccc 83738 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83710 tcccatcccatcccatcccatccc 83733 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83705 tcccatcccatcccatcccatccc 83728 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83700 tcccatcccatcccatcccatccc 83723 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83695 tcccatcccatcccatcccatccc 83718 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83690 tcccatcccatcccatcccatccc 83713 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83685 tcccatcccatcccatcccatccc 83708 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83680 tcccatcccatcccatcccatccc 83703 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83675 tcccatcccatcccatcccatccc 83698 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83670 tcccatcccatcccatcccatccc 83693 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83665 tcccatcccatcccatcccatccc 83688 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83660 tcccatcccatcccatcccatccc 83683 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83655 tcccatcccatcccatcccatccc 83678 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83650 tcccatcccatcccatcccatccc 83673 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83645 tcccatcccatcccatcccatccc 83668 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83640 tcccatcccatcccatcccatccc 83663 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83635 tcccatcccatcccatcccatccc 83658 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83630 tcccatcccatcccatcccatccc 83653 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83625 tcccatcccatcccatcccatccc 83648 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83620 tcccatcccatcccatcccatccc 83643 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83615 tcccatcccatcccatcccatccc 83638 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83610 tcccatcccatcccatcccatccc 83633 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83605 tcccatcccatcccatcccatccc 83628 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83600 tcccatcccatcccatcccatccc 83623 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83595 tcccatcccatcccatcccatccc 83618 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83590 tcccatcccatcccatcccatccc 83613 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83585 tcccatcccatcccatcccatccc 83608 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83580 tcccatcccatcccatcccatccc 83603 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83575 tcccatcccatcccatcccatccc 83598 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83570 tcccatcccatcccatcccatccc 83593 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83565 tcccatcccatcccatcccatccc 83588 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83560 tcccatcccatcccatcccatccc 83583 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83555 tcccatcccatcccatcccatccc 83578 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83550 tcccatcccatcccatcccatccc 83573 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83545 tcccatcccatcccatcccatccc 83568 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83540 tcccatcccatcccatcccatccc 83563 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83535 tcccatcccatcccatcccatccc 83558 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83530 tcccatcccatcccatcccatccc 83553 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83525 tcccatcccatcccatcccatccc 83548 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83520 tcccatcccatcccatcccatccc 83543 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83515 tcccatcccatcccatcccatccc 83538 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83510 tcccatcccatcccatcccatccc 83533 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83505 tcccatcccatcccatcccatccc 83528 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83500 tcccatcccatcccatcccatccc 83523 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83495 tcccatcccatcccatcccatccc 83518 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83490 tcccatcccatcccatcccatccc 83513 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83485 tcccatcccatcccatcccatccc 83508 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83480 tcccatcccatcccatcccatccc 83503 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83475 tcccatcccatcccatcccatccc 83498 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83470 tcccatcccatcccatcccatccc 83493 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83465 tcccatcccatcccatcccatccc 83488 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83460 tcccatcccatcccatcccatccc 83483 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83455 tcccatcccatcccatcccatccc 83478 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83450 tcccatcccatcccatcccatccc 83473 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83445 tcccatcccatcccatcccatccc 83468 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83440 tcccatcccatcccatcccatccc 83463 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83435 tcccatcccatcccatcccatccc 83458 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83430 tcccatcccatcccatcccatccc 83453 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83425 tcccatcccatcccatcccatccc 83448 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83420 tcccatcccatcccatcccatccc 83443 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83415 tcccatcccatcccatcccatccc 83438 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83410 tcccatcccatcccatcccatccc 83433 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83405 tcccatcccatcccatcccatccc 83428 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83400 tcccatcccatcccatcccatccc 83423 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83395 tcccatcccatcccatcccatccc 83418 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83390 tcccatcccatcccatcccatccc 83413 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83385 tcccatcccatcccatcccatccc 83408 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83380 tcccatcccatcccatcccatccc 83403 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83375 tcccatcccatcccatcccatccc 83398 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83330 tcccatcccatcccatcccatccc 83353 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83325 tcccatcccatcccatcccatccc 83348 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 83320 tcccatcccatcccatcccatccc 83343
>gb|AC110187.11| Mus musculus chromosome 7, clone RP24-541E23, complete sequence Length = 181046 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 76575 tcccatcccatcccatcccatccc 76598 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 76570 tcccatcccatcccatcccatccc 76593 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 76565 tcccatcccatcccatcccatccc 76588 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 76560 tcccatcccatcccatcccatccc 76583 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 76555 tcccatcccatcccatcccatccc 76578 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 76550 tcccatcccatcccatcccatccc 76573
>gb|AC009351.7| Drosophila melanogaster, chromosome 2L, region 26A-26A, BAC clone BACR23K01, complete sequence Length = 173723 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 75495 tcccatcccatcccatcccatccc 75472
>gb|AC008490.6| Homo sapiens chromosome 5 clone CTC-426I14, complete sequence Length = 113213 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 107572 tcccatcccatcccatcccatccc 107549 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 107567 tcccatcccatcccatcccatccc 107544 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 107562 tcccatcccatcccatcccatccc 107539 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 107557 tcccatcccatcccatcccatccc 107534 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 107552 tcccatcccatcccatcccatccc 107529
>gb|AC159297.3| Mus musculus BAC clone RP23-258F9 from chromosome 12, complete sequence Length = 193434 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 148393 tcccatcccatcccatcccatccc 148370 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 148388 tcccatcccatcccatcccatccc 148365 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 148383 tcccatcccatcccatcccatccc 148360 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 148378 tcccatcccatcccatcccatccc 148355 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 148373 tcccatcccatcccatcccatccc 148350 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 148368 tcccatcccatcccatcccatccc 148345 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 148363 tcccatcccatcccatcccatccc 148340
>gb|AC159880.2| Mus musculus BAC clone RP24-490L14 from chromosome 9, complete sequence Length = 142451 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 55631 tcccatcccatcccatcccatccc 55608 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 55621 tcccatcccatcccaccccatccc 55598 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 55601 tcccatcccatcccatcccatccc 55578 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 55596 tcccatcccatcccatcccatccc 55573
>gb|AC133897.15| Mus musculus chromosome 5, clone RP24-357G2, complete sequence Length = 177013 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 7239 tcccatcccatcccatcccatccc 7262 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 7234 tcccatcccatcccatcccatccc 7257 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 7229 tcccatcccatcccatcccatccc 7252 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 7224 tcccatcccatcccatcccatccc 7247 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 7219 tcccatcccatcccatcccatccc 7242
>gb|AF400074.1|AF400074 Homo sapiens surfactant, pulmonary-associated protein B (SFTPB) gene, complete cds Length = 11807 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 1605 tcccatcccatcccatcccatccc 1582
>gb|AC007351.40|AC007351 Homo sapiens 12 BAC RP11-492N15 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 195501 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 101902 tcccatcccatcccatcccatccc 101879 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 101897 tcccatcccatcccatcccatccc 101874 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 101892 tcccatcccatcccatcccatccc 101869 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 101887 tcccatcccatcccatcccatccc 101864 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 101882 tcccatcccatcccatcccatccc 101859 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 101877 tcccatcccatcccatcccatccc 101854 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 101872 tcccatcccatcccatcccatccc 101849
>gb|AC008513.7|AC008513 Homo sapiens chromosome 5 clone CTC-455C23, complete sequence Length = 224058 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 7988 tcccatcccatcccatcccatccc 8011 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 7983 tcccatcccatcccatcccatccc 8006 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 7978 tcccatcccatcccatcccatccc 8001 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 7973 tcccatcccatcccatcccatccc 7996 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 7968 tcccatcccatcccatcccatccc 7991 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 7963 tcccatcccatcccatcccatccc 7986 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 7958 tcccatcccatcccatcccatccc 7981
>gb|AC022379.2|AC022379 Homo sapiens chromosome 3 clone 996C6 map 3p, complete sequence Length = 222542 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 28979 tcccatcccatcccatcccatccc 29002 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 28974 tcccatcccatcccatcccatccc 28997 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 28969 tcccatcccatcccatcccatccc 28992
>gb|AC007054.24|AC007054 Drosophila melanogaster, chromosome 2R, region 41E-41E, BAC clone BACR45O18, complete sequence Length = 176510 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 152291 tcccatcccatcccatcccatccc 152268 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 152286 tcccatcccatcccatcccatccc 152263
>gb|AC017092.4|AC017092 Homo sapiens BAC clone RP11-510D22 from 5, complete sequence Length = 180072 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 129838 tcccatcccatcccatcccatccc 129815 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 129833 tcccatcccatcccatcccatccc 129810 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 129828 tcccatcccatcccatcccatccc 129805 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 129823 tcccatcccatcccatcccatccc 129800 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 129818 tcccatcccatcccatcccatccc 129795 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 129813 tcccatcccatcccatcccatccc 129790
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 19435060 tcccatcccatcccatcccatccc 19435083 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 6914312 tcccatcccatcccatcccatccc 6914335
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 9608380 tcccatcccatcccatcccatccc 9608357 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 67 ccatcccatcccaacccatcccta 90 ||||||||||| |||||||||||| Sbjct: 1240748 ccatcccatcctaacccatcccta 1240725 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 899084 tcccatcccatcccatcccatccc 899107
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 27363535 tcccatcccatcccatcccatccc 27363512
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 376 gctcatgtcgccgccgccga 395 |||||||||||||||||||| Sbjct: 26622625 gctcatgtcgccgccgccga 26622644
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 10319622 tcccatcccatcccatcccatccc 10319645 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 10319617 tcccatcccatcccatcccatccc 10319640
>gb|AC022345.2|AC022345 Drosophila melanogaster, chromosome X, region 12F-13A, BAC clone BACR10J19, complete sequence Length = 182416 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 104157 tcccatcccatcccatcccatccc 104180
>gb|AC022348.2|AC022348 Drosophila melanogaster, chromosome X, region 17E-18A, BAC clone BACR32F24, complete sequence Length = 162307 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 43568 tcccatcccatcccatcccatccc 43545
>gb|AC104135.5| Homo sapiens BAC clone RP11-588I4 from 2, complete sequence Length = 71936 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 45206 tcccatcccatcccatcccatccc 45229 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 45201 tcccatcccatcccatcccatccc 45224 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 45196 tcccatcccatcccatcccatccc 45219 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 45191 tcccatcccatcccatcccatccc 45214 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 45186 tcccatcccatcccatcccatccc 45209
>gb|AC146165.2| Pan troglodytes BAC clone RP43-36N14 from chromosome 7, complete sequence Length = 159324 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 93682 tcccatcccatcccatcccatccc 93705 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 93677 tcccatcccatcccatcccatccc 93700 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 93672 tcccatcccatcccatcccatccc 93695 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 93667 tcccatcccatcccatcccatccc 93690 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 93662 tcccatcccatcccatcccatccc 93685 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 93657 tcccatcccatcccatcccatccc 93680 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 93652 tcccatcccatcccatcccatccc 93675 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 93647 tcccatcccatcccatcccatccc 93670
>gb|AC154741.3| Mus musculus BAC clone RP24-392C9 from chromosome 9, complete sequence Length = 178684 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 107593 tcccatcccatcccatcccatccc 107616 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 107588 tcccatcccatcccatcccatccc 107611 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 107583 tcccatcccatcccatcccatccc 107606 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 107578 tcccatcccatcccatcccatccc 107601 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 107573 tcccatcccatcccatcccatccc 107596 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 107568 tcccatcccatcccatcccatccc 107591
>gb|AC157660.2| Mus musculus BAC clone RP23-263I16 from chromosome 1, complete sequence Length = 192026 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 393 tcccatcccatcccatcccatccc 370
>gb|AC012555.27| Homo sapiens 12 RP11-650K20 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 95597 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 26887 tcccatcccatcccatcccatccc 26864 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcccatcccatcccaaccca 84 |||||||||||||||||||| Sbjct: 26877 tcccatcccatcccaaccca 26858
>gb|AC018685.12| Homo sapiens BAC clone RP11-455M16 from 2, complete sequence Length = 173381 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 118218 tcccatcccatcccatcccatccc 118195
>gb|AC138393.2| Homo sapiens chromosome 1 clone RP11-504P24, complete sequence Length = 184644 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 117722 tcccatcccatcccatcccatccc 117699 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 117717 tcccatcccatcccatcccatccc 117694 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 117712 tcccatcccatcccatcccatccc 117689 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 117707 tcccatcccatcccatcccatccc 117684 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 117702 tcccatcccatcccatcccatccc 117679 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 117697 tcccatcccatcccatcccatccc 117674 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 117692 tcccatcccatcccatcccatccc 117669 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 117687 tcccatcccatcccatcccatccc 117664
>gb|AC011293.5|AC011293 Homo sapiens BAC clone RP11-75F5 from Y, complete sequence Length = 159722 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 24687 tcccatcccatcccatcccatccc 24664 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 24682 tcccatcccatcccatcccatccc 24659 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 24677 tcccatcccatcccatcccatccc 24654 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 24672 tcccatcccatcccatcccatccc 24649 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 24667 tcccatcccatcccatcccatccc 24644
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 295 gccgcccttgccctgcgcga 314 |||||||||||||||||||| Sbjct: 6231492 gccgcccttgccctgcgcga 6231473
>gb|AC040896.9| Homo sapiens chromosome 18, clone RP11-734B5, complete sequence Length = 189308 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 85982 tcccatcccatcccatcccatccc 85959 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 85977 tcccatcccatcccatcccatccc 85954 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 85972 tcccatcccatcccatcccatccc 85949 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 85967 tcccatcccatcccatcccatccc 85944 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 85962 tcccatcccatcccatcccatccc 85939 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 85957 tcccatcccatcccatcccatccc 85934 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 85952 tcccatcccatcccatcccatccc 85929 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 85947 tcccatcccatcccatcccatccc 85924 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 85942 tcccatcccatcccatcccatccc 85919 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 85937 tcccatcccatcccatcccatccc 85914 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 85932 tcccatcccatcccatcccatccc 85909
>gb|AE004918.1| Pseudomonas aeruginosa PAO1, section 479 of 529 of the complete genome Length = 11170 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 292 gccgccgcccttgccctgcgcgac 315 ||||||||||| |||||||||||| Sbjct: 325 gccgccgccctggccctgcgcgac 302
>gb|AC095350.8| Homo sapiens 12 BAC RP11-662M24 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 129055 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 119439 tcccatcccatcccatcccatccc 119416
>ref|XM_574731.1| PREDICTED: Rattus norvegicus similar to B7-like protein GL50-B (LOC499415), mRNA Length = 1644 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 1573 tcccatcccatcccatcccatccc 1596 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 1568 tcccatcccatcccatcccatccc 1591
>gb|AC097468.3| Homo sapiens BAC clone RP11-33O4 from 2, complete sequence Length = 169741 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 89293 tcccatcccatcccatcccatccc 89270 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 89288 tcccatcccatcccatcccatccc 89265 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 89283 tcccatcccatcccatcccatccc 89260
>gb|AC010872.8| Homo sapiens BAC clone RP11-83B6 from 2, complete sequence Length = 189507 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 57383 tcccatcccatcccatcccatccc 57406 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 57378 tcccatcccatcccatcccatccc 57401
>gb|AC011444.5|AC011444 Homo sapiens chromosome 19 clone CTC-232P5, complete sequence Length = 133925 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 47875 tcccatcccatcccatcccatccc 47898 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 47870 tcccatcccatcccatcccatccc 47893 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 47865 tcccatcccatcccatcccatccc 47888 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 47813 tcccatcccatcccatcccatccc 47836 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 47808 tcccatcccatcccatcccatccc 47831 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 47740 tcccatcccatcccatcccatccc 47763 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 47709 tcccatcccatcccatcccatccc 47732 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 47704 tcccatcccatcccatcccatccc 47727 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 47699 tcccatcccatcccatcccatccc 47722 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 47694 tcccatcccatcccatcccatccc 47717
>gb|AC150469.3| Atelerix albiventris clone LB4-498C22, complete sequence Length = 56862 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 7256 tcccatcccatcccatcccatccc 7279
>dbj|AP003452.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0478H03 Length = 167560 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 65 tcccatcccatcccaacccatccc 88 ||||||||||||||| |||||||| Sbjct: 67844 tcccatcccatcccatcccatccc 67821 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,003,580 Number of Sequences: 3902068 Number of extensions: 3003580 Number of successful extensions: 61893 Number of sequences better than 10.0: 323 Number of HSP's better than 10.0 without gapping: 330 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 57927 Number of HSP's gapped (non-prelim): 3613 length of query: 412 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 390 effective length of database: 17,147,199,772 effective search space: 6687407911080 effective search space used: 6687407911080 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
