>gb|AY074784.1| Triticum aestivum dehydroascorbate reductase (DHAR) mRNA, complete
           cds
          Length = 956

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 164 aggctcgctcgcattattccaa 185
           ||||||||||||||||||||||
Sbjct: 806 aggctcgctcgcattattccaa 785

>gb|AC109221.32| Mus musculus chromosome 7, clone RP23-207N2, complete sequence
          Length = 195657

 Score = 42.1 bits (21), Expect = 0.92
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 98    agccaggcagggggcagacag 118
             |||||||||||||||||||||
Sbjct: 71257 agccaggcagggggcagacag 71277

>ref|XM_714685.1| Candida albicans SC5314 hypothetical protein (CaO19_14092), mRNA
          Length = 1569

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 225  tactactgccatcactactggcac 248
            ||||||||||| ||||||||||||
Sbjct: 1363 tactactgccagcactactggcac 1340

>ref|XM_714802.1| Candida albicans SC5314 hypothetical protein (CaO19_6800), mRNA
          Length = 1569

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 225  tactactgccatcactactggcac 248
            ||||||||||| ||||||||||||
Sbjct: 1363 tactactgccagcactactggcac 1340

>gb|AC144402.2| Atelerix albiventris clone LBNL4-89B6, complete sequence
          Length = 161430

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 145    caggcagagcacacagcaga 164
              ||||||||||||||||||||
Sbjct: 111810 caggcagagcacacagcaga 111829

>emb|BX088727.14| Zebrafish DNA sequence from clone DKEY-218A22 in linkage group 2,
             complete sequence
          Length = 185178

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 171   ctcgcattattccaaaccca 190
             ||||||||||||||||||||
Sbjct: 28852 ctcgcattattccaaaccca 28833

>emb|Z84494.1|HSLUCA7 Human DNA sequence from clone XXcos-7 on chromosome 3, complete
             sequence
          Length = 16950

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 98    agccaggcagggggcagaca 117
             ||||||||||||||||||||
Sbjct: 12882 agccaggcagggggcagaca 12863


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,100,195
Number of Sequences: 3902068
Number of extensions: 1100195
Number of successful extensions: 18637
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 18627
Number of HSP's gapped (non-prelim): 10
length of query: 279
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 257
effective length of database: 17,147,199,772
effective search space: 4406830341404
effective search space used: 4406830341404
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)