ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal33j03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC144740.3| Oryza sativa (japonica cultivar-group) chromosome... 119 1e-23
2gb|AY090535.1| Deschampsia antarctica unknown cold induced prote... 119 1e-23
3dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 119 1e-23
4dbj|AK067043.1| Oryza sativa (japonica cultivar-group) cDNA clon... 119 1e-23
5gb|AY111310.1| Zea mays CL13668_1 mRNA sequence 94 7e-16
6gb|BT019309.1| Zea mays clone Contig982.F mRNA sequence 50 0.010
7ref|NM_191137.1| Oryza sativa (japonica cultivar-group), predic... 44 0.60
8gb|AC167331.3| Mus musculus chromosome 1, clone RP23-301L19, com... 44 0.60
9gb|AC008325.5| Drosophila melanogaster clone BACR05M06, complete... 44 0.60
10gb|AC140455.2| Mus musculus BAC clone RP23-24B2 from chromosome ... 44 0.60
11gb|AC117260.3| Mus musculus BAC clone RP24-498G10 from chromosom... 44 0.60
12ref|NM_001017123.2| Xenopus tropicalis ubiquitin-like 7 (bone ma... 44 0.60
13ref|NM_164640.1| Drosophila melanogaster CG14021-RA, transcript ... 44 0.60
14ref|NM_135079.4| Drosophila melanogaster CG14021-RB, transcript ... 44 0.60
15gb|AY058386.1| Drosophila melanogaster GH14865 full length cDNA 44 0.60
16gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 44 0.60
17dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.60
18dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.60
19dbj|AP002972.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.60
20dbj|AP005457.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.60
21dbj|AK121118.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.60
22dbj|AK107208.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.60
23emb|CR761134.2| Xenopus tropicalis finished cDNA, clone TEgg085c12 44 0.60
24gb|AE003609.4| Drosophila melanogaster chromosome 2L, section 18... 44 0.60
25gb|BC084315.1| Xenopus laevis hypothetical LOC495126, mRNA (cDNA... 44 0.60
26ref|XM_517703.1| PREDICTED: Pan troglodytes similar to KIAA0888 ... 42 2.4
27ref|XM_473655.1| Oryza sativa (japonica cultivar-group), predic... 42 2.4
28gb|BT019268.1| Zea mays clone Contig941.F mRNA sequence 42 2.4
29gb|CP000066.1| Trypanosoma brucei chromosome 3, complete sequence 42 2.4
30gb|AC159430.1| Trypanosoma brucei chromosome 3 clone RPCI93-28C2... 42 2.4
31gb|AC104708.2| Oryza sativa (japonica cultivar-group) chromosome... 42 2.4
32gb|AC150551.1| Drosophila melanogaster clone BACR16A12, complete... 42 2.4
33emb|CT005239.3| Pan troglodytes chromosome X clone PTB-125H24 ma... 42 2.4
34ref|XM_819214.1| Trypanosoma brucei TREU927 clone RPCI93-28C22 h... 42 2.4
35ref|XM_544374.2| PREDICTED: Canis familiaris similar to CG14692-... 42 2.4
36gb|AC133000.5| Rattus Norvegicus Strain CH230-62B6 BAC, BN/SsNHs... 42 2.4
37emb|AL662987.3|OSJN00188 Oryza sativa genomic DNA, chromosome 4,... 42 2.4
38emb|CR936791.1| Homo sapiens mRNA; cDNA DKFZp781C2356 (from clon... 42 2.4
39gb|AC010501.7| Homo sapiens chromosome 5 clone CTD-2377O17, comp... 42 2.4
40dbj|AK057210.1| Homo sapiens cDNA FLJ32648 fis, clone SYNOV20014... 42 2.4
41gb|AC115482.2| Drosophila melanogaster, chromosome 2L, region 21... 42 2.4
42gb|AC090281.8| Homo sapiens chromosome 8, clone RP5-1009N12, com... 42 2.4
43gb|AC008066.4| Homo sapiens BAC clone RP11-293D9 from 8, complet... 42 2.4
44ref|XM_943531.1| PREDICTED: Homo sapiens KIAA0888 protein, trans... 42 2.4
45ref|XM_032571.7| PREDICTED: Homo sapiens KIAA0888 protein, trans... 42 2.4
46gb|AY823630.2| Aplysia californica pannexin 7 mRNA, complete cds 42 2.4
47gb|AC016594.7| Homo sapiens chromosome 5 clone CTD-2010O3, compl... 42 2.4
48dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.4
49gb|AC007330.6|AC007330 Drosophila melanogaster, chromosome 2R, r... 42 2.4
50gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 42 2.4
51emb|BX647536.1|HSM807682 Homo sapiens mRNA; cDNA DKFZp686E0692 (... 42 2.4
52emb|BX640902.1|HSM807037 Homo sapiens mRNA; cDNA DKFZp686O1754 (... 42 2.4
53gb|AC002126.1|AC002126 Homo sapiens DNA from chromosome 19-cosmi... 42 2.4
54dbj|AK073181.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.4
55dbj|AK072244.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.4
56gb|AE003832.4| Drosophila melanogaster chromosome 2R, section 18... 42 2.4
57gb|AE003589.4| Drosophila melanogaster chromosome 2L, section 2 ... 42 2.4
58gb|AC005762.1|AC005762 Drosophila melanogaster DNA sequence (P1s... 42 2.4
59gb|AC005269.1|AC005269 Drosophila melanogaster DNA sequence (P1s... 42 2.4
60emb|AL833803.8| Mouse DNA sequence from clone RP23-244H7 on chro... 42 2.4
61emb|CT010501.6| Mouse DNA sequence from clone RP23-333D13 on chr... 42 2.4
62dbj|AB020695.1| Homo sapiens mRNA for KIAA0888 protein, partial cds 42 2.4
63gb|AY739095.1| Takifugu rubripes frMCM8, frQ9UJA2, frPLCB1, frAL... 40 9.4
64gb|AC119832.9| Mus musculus chromosome 3, clone RP23-471I16, com... 40 9.4
65gb|AC163099.5| Mus musculus chromosome 8, clone RP23-395L6, comp... 40 9.4
66gb|AY113697.1| Homo sapiens SCF apoptosis response protein-1 mRN... 40 9.4
67gb|DQ177407.1| Drosophila pseudoobscura Iris gene, complete cds 40 9.4
68gb|AC166821.2| Mus musculus BAC clone RP24-68F22 from chromosome... 40 9.4
69ref|XM_510007.1| PREDICTED: Pan troglodytes similar to farnesylt... 40 9.4
70ref|XM_471415.1| Oryza sativa (japonica cultivar-group), predic... 40 9.4
71gb|AC161812.3| Mus musculus chromosome 15, clone RP23-195I24, co... 40 9.4
72gb|AC124981.25| Mus musculus chromosome 5, clone RP24-170P20, co... 40 9.4
73gb|AC158463.7| Mus musculus chromosome 19, clone RP23-71D10, com... 40 9.4
74gb|AC122893.6| Mus musculus BAC clone RP23-67C3 from chromosome ... 40 9.4
75gb|AC113720.6| Rattus norvegicus 1 BAC CH230-117B1 (Children's H... 40 9.4
76gb|AC012376.12| Drosophila melanogaster clone BACR48C12, complet... 40 9.4
77ref|NM_002028.3| Homo sapiens farnesyltransferase, CAAX box, bet... 40 9.4
78gb|AC146600.4| Mus musculus BAC clone RP23-386G7 from chromosome... 40 9.4
79gb|BC070382.1| Homo sapiens cDNA clone IMAGE:6713934, partial cds 40 9.4
80ref|NM_178548.2| Homo sapiens transcription factor AP-2 epsilon ... 40 9.4
81gb|AY342408.1|AY342406S3 Mus musculus CMKLR1 (Cmklr1) gene, intr... 40 9.4
82gb|AC161169.10| Mus musculus chromosome 5, clone RP24-102B13, co... 40 9.4
83gb|AC161884.5| Mus musculus BAC clone RP23-77K23 from chromosome... 40 9.4
84gb|AY225134.1| Feldmannia irregularis virus a strain FirrV-1 con... 40 9.4
85ref|XM_979354.1| PREDICTED: Mus musculus hypothetical protein LO... 40 9.4
86emb|BX640472.24| Zebrafish DNA sequence from clone CH211-251J10 ... 40 9.4
87gb|BT011066.1| Drosophila melanogaster GM09828 full insert cDNA 40 9.4
88gb|AC122377.4| Mus musculus BAC clone RP23-473B13 from chromosom... 40 9.4
89gb|AC132349.3| Mus musculus BAC clone RP24-82B7 from chromosome ... 40 9.4
90gb|AY326454.1| Homo sapiens transcription factor AP-2 epsilon mR... 40 9.4
91gb|AC108780.10| Mus musculus chromosome 14, clone RP23-445H16, c... 40 9.4
92gb|AC123029.3| Mus musculus BAC clone RP24-571B18 from chromosom... 40 9.4
93gb|AC122456.4| Mus musculus BAC clone RP24-265M23 from chromosom... 40 9.4
94ref|XM_547686.2| PREDICTED: Canis familiaris similar to Nucleopo... 40 9.4
95gb|AC117235.3| Mus musculus BAC clone RP23-415F18 from 17, compl... 40 9.4
96gb|AC002432.1| Homo sapiens BAC clone CTA-317G18 from 7, complet... 40 9.4
97gb|AC101659.12| Mus musculus chromosome 7, clone RP23-202M11, co... 40 9.4
98gb|BC023562.2| Homo sapiens dysbindin (dystrobrevin binding prot... 40 9.4
99gb|BC001105.2| Homo sapiens dysbindin (dystrobrevin binding prot... 40 9.4
100gb|BC012818.2| Homo sapiens dysbindin (dystrobrevin binding prot... 40 9.4
101emb|BX649553.6| Human DNA sequence from clone RP4-674K6 on chrom... 40 9.4
102emb|AL513263.9| Human DNA sequence from clone CTB-1189H8 on chro... 40 9.4
103emb|AL391666.5| Human DNA sequence from clone RP13-130D24 on chr... 40 9.4
104emb|AL160400.20| Human DNA sequence from clone RP11-367G6 on chr... 40 9.4
105ref|NM_018478.2| Homo sapiens dysbindin (dystrobrevin binding pr... 40 9.4
106emb|AL157951.5| Human DNA sequence from clone RP5-983H21 on chro... 40 9.4
107emb|AL109920.15|HSDJ335E1 Human DNA sequence from clone RP3-335E... 40 9.4
108gb|AC105336.14| Mus musculus chromosome 3, clone RP24-277J22, co... 40 9.4
109gb|AC158467.3| Mus musculus chromosome 3, clone RP23-116C1, comp... 40 9.4
110emb|AL021578.4|HS453C12 Human DNA sequence from clone RP3-453C12... 40 9.4
111gb|AC118477.14| Mus musculus chromosome 1, clone RP24-178B14, co... 40 9.4
112gb|AC163019.5| Mus musculus chromosome 19, clone RP24-290E5, com... 40 9.4
113gb|AC164556.2| Mus musculus BAC clone RP23-334L9 from chromosome... 40 9.4
114emb|BX248269.1|CNSLT1I8S human full-length cDNA clone CS0DC015YK... 40 9.4
115gb|AC163012.4| Mus musculus chromosome 8, clone RP23-22A17, comp... 40 9.4
116emb|AL596084.13| Mouse DNA sequence from clone RP23-196B5 on chr... 40 9.4
117emb|BX572636.6| Zebrafish DNA sequence from clone CH211-192C1 in... 40 9.4
118gb|AC175824.2| Pan troglodytes BAC clone CH251-171H18 from chrom... 40 9.4
119gb|AC104834.4| Mus Musculus Strain C57BL6/J Chromosome 15 RP23-2... 40 9.4
120emb|CR625786.1| full-length cDNA clone CS0DC013YL13 of Neuroblas... 40 9.4
121gb|AC010688.6| Drosophila melanogaster 3L BAC RP98-11G5 (Roswell... 40 9.4
122emb|CR622797.1| full-length cDNA clone CS0DI011YJ02 of Placenta ... 40 9.4
123emb|CR618346.1| full-length cDNA clone CS0DN001YE03 of Adult bra... 40 9.4
124emb|CR618315.1| full-length cDNA clone CS0DE007YE21 of Placenta ... 40 9.4
125emb|CR618022.1| full-length cDNA clone CS0DI032YJ19 of Placenta ... 40 9.4
126emb|CR610357.1| full-length cDNA clone CS0DN001YK18 of Adult bra... 40 9.4
127gb|AC010118.8| Drosophila melanogaster 3L BAC RP98-10D15 (Roswel... 40 9.4
128dbj|AK093298.1| Homo sapiens cDNA FLJ35979 fis, clone TESTI20135... 40 9.4
129emb|CR600511.1| full-length cDNA clone CS0DJ006YL21 of T cells (... 40 9.4
130emb|CR595212.1| full-length cDNA clone CS0DK012YC08 of HeLa cell... 40 9.4
131gb|AC035138.9| Homo sapiens chromosome 10 clone RP11-314D6, comp... 40 9.4
132gb|CP000133.1| Rhizobium etli CFN 42, complete genome 40 9.4
133gb|AC099520.2| Homo sapiens chromosome 5 clone RP11-6N13, comple... 40 9.4
134gb|AC010751.5| Drosophila melanogaster 3L BAC RP98-9A23 (Roswell... 40 9.4
135emb|BX511237.5| Zebrafish DNA sequence from clone CH211-251M3 in... 40 9.4
136gb|AC155321.2| Pan troglodytes BAC clone CH251-489N11 from chrom... 40 9.4
137gb|S82645.1| Ldh-B=lactate dehydrogenase {5' region} [Fundulus h... 40 9.4
138gb|AC026733.5| Homo sapiens chromosome 5 clone CTD-2325O18, comp... 40 9.4
139gb|AC034244.6| Homo sapiens chromosome 5 clone RP11-101B14, comp... 40 9.4
140dbj|AK087159.1| Mus musculus 0 day neonate lung cDNA, RIKEN full... 40 9.4
141gb|AC011071.12|AC011071 Drosophila melanogaster, chromosome X, r... 40 9.4
142ref|NM_152982.2| Danio rerio myosin, heavy polypeptide 2, fast m... 40 9.4
143dbj|AK037370.1| Mus musculus 16 days neonate thymus cDNA, RIKEN ... 40 9.4
144emb|AL607078.26| Mouse DNA sequence from clone RP23-422H14 on ch... 40 9.4
145gb|AC073542.4|AC073542 Homo sapiens chromosome 5 clone RP11-221L... 40 9.4
146emb|CR338837.1| Gallus gallus finished cDNA, clone ChEST850i12 40 9.4
147dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 9.4
148gb|AC108022.3| Homo sapiens BAC clone RP11-9D8 from 4, complete ... 40 9.4
149gb|AC104686.2| Homo sapiens BAC clone RP11-74M11 from 4, complet... 40 9.4
150gb|AC157813.6| Mus musculus chromosome 1, clone RP24-70I14, comp... 40 9.4
151gb|AC087217.1|AC087217 Mus musculus chromosome 17 clone GS-384N1... 40 9.4
152gb|AC104201.12| Mus musculus chromosome 19, clone RP24-531I1, co... 40 9.4
153gb|AC079384.26| Homo sapiens 12 BAC RP11-148B3 (Roswell Park Can... 40 9.4
154gb|AF220191.1|AF220191 Homo sapiens uncharacterized hypothalamus... 40 9.4
155gb|AC112947.8| Mus musculus chromosome 8, clone RP23-375F22, com... 40 9.4
156emb|BX546441.10| Mouse DNA sequence from clone RP23-366I14 on ch... 40 9.4
157dbj|AP004038.2| Oryza sativa (japonica cultivar-group) genomic D... 40 9.4
158emb|AL807388.8| Mouse DNA sequence from clone RP23-255K14 on chr... 40 9.4
159emb|AL671907.6| Mouse DNA sequence from clone RP23-245F8 on chro... 40 9.4
160dbj|AK000531.1| Homo sapiens cDNA FLJ20524 fis, clone KAT10570 40 9.4
161dbj|AK026642.1| Homo sapiens cDNA: FLJ22989 fis, clone KAT11824,... 40 9.4
162emb|AJ276469.1|HSA276469 Homo sapiens mRNA for hypothetical prot... 40 9.4
163emb|AL591565.1|HS453C126 Novel human gene mapping to chomosome 20 40 9.4
164gb|BC071279.1| Danio rerio myosin, heavy polypeptide 2, fast mus... 40 9.4
165gb|BC041175.1| Homo sapiens transcription factor AP-2 epsilon (a... 40 9.4
166gb|BC020232.1| Homo sapiens farnesyltransferase, CAAX box, beta,... 40 9.4
167gb|AC107766.14| Mus musculus chromosome 1, clone RP23-166L24, co... 40 9.4
168gb|AC006933.3|AC006933 Drosophila melanogaster, chromosome 3L, r... 40 9.4
169gb|AF082702.1|AF082702 Fundulus heteroclitus clone FHME6 lactate... 40 9.4
170gb|AF082701.1|AF082701 Fundulus heteroclitus clone FHME5 lactate... 40 9.4
171gb|AF082700.1|AF082700 Fundulus heteroclitus clone FHME4 lactate... 40 9.4
172gb|AF082699.1|AF082699 Fundulus heteroclitus clone FHME3 lactate... 40 9.4
173gb|AF082698.1|AF082698 Fundulus heteroclitus clone FHME2 lactate... 40 9.4
174gb|AF082697.1|AF082697 Fundulus heteroclitus clone FHME1 lactate... 40 9.4
175emb|AL139022.4|CNS01DX4 Human chromosome 14 DNA sequence BAC R-8... 40 9.4
176gb|AE003526.4| Drosophila melanogaster chromosome 3L, section 59... 40 9.4
177gb|AE003512.3| Drosophila melanogaster chromosome X, section 64 ... 40 9.4
178gb|AE003473.3| Drosophila melanogaster chromosome 3L, section 7 ... 40 9.4
179gb|AC101745.9| Mus musculus chromosome 19, clone RP23-473I8, com... 40 9.4
180gb|BC078926.1| Rattus norvegicus similar to 9230105E10Rik protei... 40 9.4
181gb|AC005557.1|AC005557 Drosophila melanogaster, chromosome 3L, r... 40 9.4
182gb|AC004713.1|AC004713 Drosophila melanogaster, chromosome 3L, r... 40 9.4
183emb|AL732502.32| Mouse DNA sequence from clone RP23-292G12 on ch... 40 9.4
184emb|BX005415.5| Zebrafish DNA sequence from clone DKEY-21I5 in l... 40 9.4
185gb|AC153542.4| Mus musculus 10 BAC RP23-463O2 (Roswell Park Canc... 40 9.4
186emb|AL627098.30| Mouse DNA sequence from clone RP23-108K17 on ch... 40 9.4
187gb|AC107236.8| Mus musculus chromosome 8, clone RP23-296C23, com... 40 9.4
188ref|NM_001014023.1| Rattus norvegicus similar to 9230105E10Rik p... 40 9.4
189gb|AC167333.3| Mus musculus BAC clone RP23-92L4 from chromosome ... 40 9.4
190gb|BC013574.1| Homo sapiens cDNA clone IMAGE:3898137, containing... 40 9.4
191emb|CT010565.14| Mouse DNA sequence from clone RP23-263E11 on ch... 40 9.4
192gb|AC111011.6| Mus musculus BAC clone RP23-424D18 from 1, comple... 40 9.4
193emb|CR974466.14| Mouse DNA sequence from clone RP23-331E12 on ch... 40 9.4
194gb|U59856.1|FHU59856 Fundulus heteroclitus lactate dehydrogenase... 40 9.4
195gb|U59852.1|FHU59852 Fundulus heteroclitus lactate dehydrogenase... 40 9.4
196gb|U59851.1|FHU59851 Fundulus heteroclitus lactate dehydrogenase... 40 9.4
197gb|U59850.1|FHU59850 Fundulus heteroclitus lactate dehydrogenase... 40 9.4
198gb|U59849.1|FHU59849 Fundulus heteroclitus lactate dehydrogenase... 40 9.4
199gb|U59848.1|FHU59848 Fundulus heteroclitus lactate dehydrogenase... 40 9.4
200gb|U59847.1|FHU59847 Fundulus heteroclitus lactate dehydrogenase... 40 9.4
201gb|U59846.1|FHU59846 Fundulus heteroclitus lactate dehydrogenase... 40 9.4
202gb|U59845.1|FHU59845 Fundulus heteroclitus lactate dehydrogenase... 40 9.4
203gb|DQ286748.1| Strongylocentrotus purpuratus forkhead transcript... 40 9.4
204gb|AY870928.1| Physcomitrella patens small rho-1 GTP-binding pro... 40 9.4
205gb|AC132939.23| Mus musculus chromosome 5, clone RP24-91I11, com... 40 9.4
206gb|AC165416.12| Mus musculus chromosome 3, clone RP23-86I19, com... 40 9.4
207gb|L10414.1|HUMFTB Human farnesyltransferase beta-subunit mRNA, ... 40 9.4
208emb|AL713989.20| Mouse DNA sequence from clone RP23-5I4 on chrom... 40 9.4
209emb|AL732474.8| Mouse DNA sequence from clone RP23-180I2 on chro... 40 9.4
210emb|AL451076.14| Mouse DNA sequence from clone RP23-43O20 on chr... 40 9.4
211emb|AL591946.14| Mouse DNA sequence from clone RP23-290M7 on chr... 40 9.4
212gb|AC101932.9| Mus musculus chromosome 7, clone RP24-66E13, comp... 40 9.4
213gb|L00635.1|HUMFPTB Human farnesyl-protein transferase beta-subu... 40 9.4
214gb|AC154653.2| Mus musculus BAC clone RP24-262N5 from chromosome... 40 9.4
215dbj|AB037179.1| Candida tropicalis CtPP1 gene for protein-tyrosi... 40 9.4

>gb|AC144740.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0075A10,
              complete sequence
          Length = 171101

 Score =  119 bits (60), Expect = 1e-23
 Identities = 78/84 (92%)
 Strand = Plus / Minus

                                                                          
Query: 420    cttcttgggcaggtcctccaggcacctcacctccgacatgcacgcgaaggactgggactt 479
              ||||||| |||| ||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 129064 cttcttgcgcagatcctccaggcacctcacctccgacatgcacgcgaacgactgggactt 129005

                                      
Query: 480    gccgtcgtagtacttggacaaccc 503
               || ||||||||| ||||||||||
Sbjct: 129004 cccctcgtagtacctggacaaccc 128981



to top

>gb|AY090535.1| Deschampsia antarctica unknown cold induced protein mRNA, complete
           cds; nuclear gene for plastid product
          Length = 774

 Score =  119 bits (60), Expect = 1e-23
 Identities = 90/100 (90%)
 Strand = Plus / Minus

                                                                       
Query: 404 tcttgttgtagggtctcttcttgggcaggtcctccaggcacctcacctccgacatgcacg 463
           |||| ||||| || |||||||||||||| || |||||||| || ||||| ||||||||||
Sbjct: 461 tcttcttgtacgggctcttcttgggcagatcttccaggcatctgacctcggacatgcacg 402

                                                   
Query: 464 cgaaggactgggacttgccgtcgtagtacttggacaaccc 503
           ||||||||||||||||||||||||||||  ||||||||||
Sbjct: 401 cgaaggactgggacttgccgtcgtagtatctggacaaccc 362



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 622 gcctcgtcgtcggagtcgcaggagaaggaggaggaggtctcgaacaggtcctcgtcttcc 681
           ||||| ||||| ||||||||||||| ||| || |||||||||||||| || |||||||||
Sbjct: 228 gcctcatcgtctgagtcgcaggagatggaagacgaggtctcgaacagatcttcgtcttcc 169



 Score = 48.1 bits (24), Expect = 0.038
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 213 gctcttgttgacggggatggcgggaggcctgtagagcatg 252
           ||||||||| || || || |||||||||||||||||||||
Sbjct: 643 gctcttgttcacaggaatcgcgggaggcctgtagagcatg 604



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  119 bits (60), Expect = 1e-23
 Identities = 78/84 (92%)
 Strand = Plus / Minus

                                                                            
Query: 420      cttcttgggcaggtcctccaggcacctcacctccgacatgcacgcgaaggactgggactt 479
                ||||||| |||| ||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 25887532 cttcttgcgcagatcctccaggcacctcacctccgacatgcacgcgaacgactgggactt 25887473

                                        
Query: 480      gccgtcgtagtacttggacaaccc 503
                 || ||||||||| ||||||||||
Sbjct: 25887472 cccctcgtagtacctggacaaccc 25887449



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                             
Query: 630      gtcggagtcgcaggagaaggaggaggagg 658
                |||||||||| ||||| ||||||||||||
Sbjct: 19624626 gtcggagtcggaggaggaggaggaggagg 19624654



to top

>dbj|AK067043.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013091B04, full
           insert sequence
          Length = 977

 Score =  119 bits (60), Expect = 1e-23
 Identities = 78/84 (92%)
 Strand = Plus / Minus

                                                                       
Query: 420 cttcttgggcaggtcctccaggcacctcacctccgacatgcacgcgaaggactgggactt 479
           ||||||| |||| ||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 560 cttcttgcgcagatcctccaggcacctcacctccgacatgcacgcgaacgactgggactt 501

                                   
Query: 480 gccgtcgtagtacttggacaaccc 503
            || ||||||||| ||||||||||
Sbjct: 500 cccctcgtagtacctggacaaccc 477



to top

>gb|AY111310.1| Zea mays CL13668_1 mRNA sequence
          Length = 528

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 65/71 (91%)
 Strand = Plus / Plus

                                                                       
Query: 420 cttcttgggcaggtcctccaggcacctcacctccgacatgcacgcgaaggactgggactt 479
           ||||||| ||||||| |||||||| | ||||||||||||||||||||| |||||||||||
Sbjct: 357 cttcttgcgcaggtcgtccaggcagcgcacctccgacatgcacgcgaacgactgggactt 416

                      
Query: 480 gccgtcgtagt 490
           ||| |||||||
Sbjct: 417 gccctcgtagt 427



to top

>gb|BT019309.1| Zea mays clone Contig982.F mRNA sequence
          Length = 723

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                       
Query: 423 cttgggcaggtcctccaggcacctcacctccgacatgcacgcgaaggactgggacttgcc 482
           ||||||||||||||| ||||  | |||| ||| ||   ||||||| ||||| ||||||||
Sbjct: 404 cttgggcaggtcctcgaggccgcccaccgccgccagcgacgcgaacgactgcgacttgcc 463

                            
Query: 483 gtcgtagtacttggaca 499
           |||| || |||||||||
Sbjct: 464 gtcgaagaacttggaca 480



to top

>ref|NM_191137.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 528

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 64/78 (82%)
 Strand = Plus / Minus

                                                                       
Query: 420 cttcttgggcaggtcctccaggcacctcacctccgacatgcacgcgaaggactgggactt 479
           ||||||| | || ||||| ||||| |||||||| ||||| || || || || || |||||
Sbjct: 318 cttcttgcgtagatcctctaggcatctcacctcagacatacatgcaaaagattgagactt 259

                             
Query: 480 gccgtcgtagtacttgga 497
            ||||||||||| |||||
Sbjct: 258 tccgtcgtagtatttgga 241



to top

>gb|AC167331.3| Mus musculus chromosome 1, clone RP23-301L19, complete sequence
          Length = 197718

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 253   ctggagctgccgctccgcgcca 274
             ||||||||||||||||||||||
Sbjct: 51349 ctggagctgccgctccgcgcca 51370



to top

>gb|AC008325.5| Drosophila melanogaster clone BACR05M06, complete sequence
          Length = 166423

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 633    ggagtcgcaggagaaggaggaggagg 658
              |||| |||||||||||||||||||||
Sbjct: 105999 ggaggcgcaggagaaggaggaggagg 105974



to top

>gb|AC140455.2| Mus musculus BAC clone RP23-24B2 from chromosome 18, complete sequence
          Length = 242533

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 641   aggagaaggaggaggaggtctc 662
             ||||||||||||||||||||||
Sbjct: 45639 aggagaaggaggaggaggtctc 45618



to top

>gb|AC117260.3| Mus musculus BAC clone RP24-498G10 from chromosome 18, complete sequence
          Length = 211919

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 641    aggagaaggaggaggaggtctc 662
              ||||||||||||||||||||||
Sbjct: 119082 aggagaaggaggaggaggtctc 119061



to top

>ref|NM_001017123.2| Xenopus tropicalis ubiquitin-like 7 (bone marrow stromal
            cell-derived) (ubl7), mRNA
          Length = 1391

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 230  tggcgggaggcctgtagagcatgctg 255
            |||| |||||||||||||||||||||
Sbjct: 1020 tggctggaggcctgtagagcatgctg 995



to top

>ref|NM_164640.1| Drosophila melanogaster CG14021-RA, transcript variant A (CG14021),
           mRNA
          Length = 2618

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 633 ggagtcgcaggagaaggaggaggagg 658
           |||| |||||||||||||||||||||
Sbjct: 782 ggaggcgcaggagaaggaggaggagg 807



to top

>ref|NM_135079.4| Drosophila melanogaster CG14021-RB, transcript variant B (CG14021),
           mRNA
          Length = 2411

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 633 ggagtcgcaggagaaggaggaggagg 658
           |||| |||||||||||||||||||||
Sbjct: 575 ggaggcgcaggagaaggaggaggagg 600



to top

>gb|AY058386.1| Drosophila melanogaster GH14865 full length cDNA
          Length = 1944

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 633 ggagtcgcaggagaaggaggaggagg 658
           |||| |||||||||||||||||||||
Sbjct: 92  ggaggcgcaggagaaggaggaggagg 117



to top

>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 362    ggtcaccgtcgatctcgacgtg 383
              ||||||||||||||||||||||
Sbjct: 835999 ggtcaccgtcgatctcgacgtg 836020



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                              
Query: 627      gtcgtcggagtcgcaggagaaggaggagga 656
                ||||||||||||| ||||| ||||||||||
Sbjct: 28448456 gtcgtcggagtcggaggaggaggaggagga 28448485



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                            
Query: 420      cttcttgggcaggtcctccaggcacctcacctccgacatgcacgcgaaggactgggactt 479
                ||||||| | || ||||| ||||| |||||||| ||||| || || || || || |||||
Sbjct: 30879063 cttcttgcgtagatcctctaggcatctcacctcagacatacatgcaaaagattgagactt 30879122

                                  
Query: 480      gccgtcgtagtacttgga 497
                 ||||||||||| |||||
Sbjct: 30879123 tccgtcgtagtatttgga 30879140



to top

>dbj|AP002972.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0638D12
          Length = 161277

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                         
Query: 420   cttcttgggcaggtcctccaggcacctcacctccgacatgcacgcgaaggactgggactt 479
             ||||||| | || ||||| ||||| |||||||| ||||| || || || || || |||||
Sbjct: 79430 cttcttgcgtagatcctctaggcatctcacctcagacatacatgcaaaagattgagactt 79489

                               
Query: 480   gccgtcgtagtacttgga 497
              ||||||||||| |||||
Sbjct: 79490 tccgtcgtagtatttgga 79507



to top

>dbj|AP005457.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0532H03
          Length = 166128

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 627   gtcgtcggagtcgcaggagaaggaggagga 656
             ||||||||||||| ||||| ||||||||||
Sbjct: 55489 gtcgtcggagtcggaggaggaggaggagga 55518



to top

>dbj|AK121118.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023074B04, full
           insert sequence
          Length = 1070

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 64/78 (82%)
 Strand = Plus / Minus

                                                                       
Query: 420 cttcttgggcaggtcctccaggcacctcacctccgacatgcacgcgaaggactgggactt 479
           ||||||| | || ||||| ||||| |||||||| ||||| || || || || || |||||
Sbjct: 436 cttcttgcgtagatcctctaggcatctcacctcagacatacatgcaaaagattgagactt 377

                             
Query: 480 gccgtcgtagtacttgga 497
            ||||||||||| |||||
Sbjct: 376 tccgtcgtagtatttgga 359



to top

>dbj|AK107208.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-125-B11, full
            insert sequence
          Length = 2043

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 627  gtcgtcggagtcgcaggagaaggaggagga 656
            ||||||||||||| ||||| ||||||||||
Sbjct: 1581 gtcgtcggagtcggaggaggaggaggagga 1552



to top

>emb|CR761134.2| Xenopus tropicalis finished cDNA, clone TEgg085c12
          Length = 1391

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 230  tggcgggaggcctgtagagcatgctg 255
            |||| |||||||||||||||||||||
Sbjct: 1020 tggctggaggcctgtagagcatgctg 995



to top

>gb|AE003609.4| Drosophila melanogaster chromosome 2L, section 18 of 83 of the complete
              sequence
          Length = 319287

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 633    ggagtcgcaggagaaggaggaggagg 658
              |||| |||||||||||||||||||||
Sbjct: 216238 ggaggcgcaggagaaggaggaggagg 216213



to top

>gb|BC084315.1| Xenopus laevis hypothetical LOC495126, mRNA (cDNA clone
            IMAGE:7008166), partial cds
          Length = 1447

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 230  tggcgggaggcctgtagagcatgctg 255
            |||| |||||||||||||||||||||
Sbjct: 1068 tggctggaggcctgtagagcatgctg 1043



to top

>ref|XM_517703.1| PREDICTED: Pan troglodytes similar to KIAA0888 protein (LOC461805),
           mRNA
          Length = 2055

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 81  tacatttgacaggctaatagg 101
           |||||||||||||||||||||
Sbjct: 336 tacatttgacaggctaatagg 316



to top

>ref|XM_473655.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 618

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 461 acgcgaaggactgggacttgccgtcgtagtacttgga 497
           ||||||| ||||| |||||||||||| || |||||||
Sbjct: 259 acgcgaacgactgcgacttgccgtcgaagaacttgga 223



to top

>gb|BT019268.1| Zea mays clone Contig941.F mRNA sequence
          Length = 904

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                
Query: 463 gcgaaggactgggacttgccgtcgtagtacttggaca 499
           ||||||||||| |||||||||||| || || ||||||
Sbjct: 476 gcgaaggactgcgacttgccgtcgaagaacctggaca 512



to top

>gb|CP000066.1| Trypanosoma brucei chromosome 3, complete sequence
          Length = 1653225

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 634     gagtcgcaggagaaggaggaggagg 658
               |||||||||||| ||||||||||||
Sbjct: 1108789 gagtcgcaggaggaggaggaggagg 1108813



to top

>gb|AC159430.1| Trypanosoma brucei chromosome 3 clone RPCI93-28C22, complete sequence
          Length = 142068

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 634   gagtcgcaggagaaggaggaggagg 658
             |||||||||||| ||||||||||||
Sbjct: 38788 gagtcgcaggaggaggaggaggagg 38764



to top

>gb|AC104708.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1174_H11,
             complete sequence
          Length = 102567

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 630   gtcggagtcgcaggagaaggaggaggagg 658
             |||||||||| ||||| ||||||||||||
Sbjct: 84525 gtcggagtcggaggaggaggaggaggagg 84553



to top

>gb|AC150551.1| Drosophila melanogaster clone BACR16A12, complete sequence
          Length = 185417

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 639    gcaggagaaggaggaggaggt 659
              |||||||||||||||||||||
Sbjct: 101950 gcaggagaaggaggaggaggt 101930



to top

>emb|CT005239.3| Pan troglodytes chromosome X clone PTB-125H24 map Xq28, complete sequence
          Length = 262483

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 639    gcaggagaaggaggaggaggt 659
              |||||||||||||||||||||
Sbjct: 224789 gcaggagaaggaggaggaggt 224769



to top

>ref|XM_819214.1| Trypanosoma brucei TREU927 clone RPCI93-28C22 hypothetical protein
            (Tb927.3.3950) partial mRNA
          Length = 1653

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 634  gagtcgcaggagaaggaggaggagg 658
            |||||||||||| ||||||||||||
Sbjct: 1219 gagtcgcaggaggaggaggaggagg 1243



to top

>ref|XM_544374.2| PREDICTED: Canis familiaris similar to CG14692-PA (LOC487248), mRNA
          Length = 2013

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 81  tacatttgacaggctaatagg 101
           |||||||||||||||||||||
Sbjct: 156 tacatttgacaggctaatagg 136



to top

>gb|AC133000.5| Rattus Norvegicus Strain CH230-62B6 BAC, BN/SsNHsd/MCW, complete sequence
          Length = 245581

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 630    gtcggagtcgcaggagaaggaggaggagg 658
              |||||||||| ||||| ||||||||||||
Sbjct: 229884 gtcggagtcggaggagcaggaggaggagg 229912



to top

>emb|AL662987.3|OSJN00188 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0088A01,
              complete sequence
          Length = 186325

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                   
Query: 461    acgcgaaggactgggacttgccgtcgtagtacttgga 497
              ||||||| ||||| |||||||||||| || |||||||
Sbjct: 112688 acgcgaacgactgcgacttgccgtcgaagaacttgga 112724



to top

>emb|CR936791.1| Homo sapiens mRNA; cDNA DKFZp781C2356 (from clone DKFZp781C2356)
          Length = 6005

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 81  tacatttgacaggctaatagg 101
           |||||||||||||||||||||
Sbjct: 429 tacatttgacaggctaatagg 409



to top

>gb|AC010501.7| Homo sapiens chromosome 5 clone CTD-2377O17, complete sequence
          Length = 61738

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 81   tacatttgacaggctaatagg 101
            |||||||||||||||||||||
Sbjct: 8214 tacatttgacaggctaatagg 8234



to top

>dbj|AK057210.1| Homo sapiens cDNA FLJ32648 fis, clone SYNOV2001451, highly similar to
            MYOCYTE-SPECIFIC ENHANCER FACTOR 2B
          Length = 1683

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 467  aggactgggacttgccgtcgt 487
            |||||||||||||||||||||
Sbjct: 1013 aggactgggacttgccgtcgt 993



to top

>gb|AC115482.2| Drosophila melanogaster, chromosome 2L, region 21D-21D, BAC clone
              BACR04A24, complete sequence
          Length = 166677

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 639    gcaggagaaggaggaggaggt 659
              |||||||||||||||||||||
Sbjct: 107380 gcaggagaaggaggaggaggt 107360



to top

>gb|AC090281.8| Homo sapiens chromosome 8, clone RP5-1009N12, complete sequence
          Length = 114875

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 160   gacagacactctgagtctcaa 180
             |||||||||||||||||||||
Sbjct: 37875 gacagacactctgagtctcaa 37895



to top

>gb|AC008066.4| Homo sapiens BAC clone RP11-293D9 from 8, complete sequence
          Length = 174347

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 160    gacagacactctgagtctcaa 180
              |||||||||||||||||||||
Sbjct: 144212 gacagacactctgagtctcaa 144192



to top

>ref|XM_943531.1| PREDICTED: Homo sapiens KIAA0888 protein, transcript variant 3
           (KIAA0888), mRNA
          Length = 6666

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 81  tacatttgacaggctaatagg 101
           |||||||||||||||||||||
Sbjct: 156 tacatttgacaggctaatagg 136



to top

>ref|XM_032571.7| PREDICTED: Homo sapiens KIAA0888 protein, transcript variant 1
           (KIAA0888), mRNA
          Length = 6895

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 81  tacatttgacaggctaatagg 101
           |||||||||||||||||||||
Sbjct: 377 tacatttgacaggctaatagg 357



to top

>gb|AY823630.2| Aplysia californica pannexin 7 mRNA, complete cds
          Length = 1272

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 639  gcaggagaaggaggaggaggt 659
            |||||||||||||||||||||
Sbjct: 1159 gcaggagaaggaggaggaggt 1179



to top

>gb|AC016594.7| Homo sapiens chromosome 5 clone CTD-2010O3, complete sequence
          Length = 146235

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 81     tacatttgacaggctaatagg 101
              |||||||||||||||||||||
Sbjct: 123949 tacatttgacaggctaatagg 123969



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                     
Query: 461      acgcgaaggactgggacttgccgtcgtagtacttgga 497
                ||||||| ||||| |||||||||||| || |||||||
Sbjct: 29439672 acgcgaacgactgcgacttgccgtcgaagaacttgga 29439708



to top

>gb|AC007330.6|AC007330 Drosophila melanogaster, chromosome 2R, region 46C-46D, BAC clone
             BACR30G11, complete sequence
          Length = 166854

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 637   tcgcaggagaaggaggaggag 657
             |||||||||||||||||||||
Sbjct: 17300 tcgcaggagaaggaggaggag 17320



to top

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 571     cgcgccggcggggaggccggc 591
               |||||||||||||||||||||
Sbjct: 2037348 cgcgccggcggggaggccggc 2037328



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 568     cgccgcgccggcggggaggccggc 591
               |||||||||||||| |||||||||
Sbjct: 2414327 cgccgcgccggcggcgaggccggc 2414304



to top

>emb|BX647536.1|HSM807682 Homo sapiens mRNA; cDNA DKFZp686E0692 (from clone DKFZp686E0692)
          Length = 5973

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 81  tacatttgacaggctaatagg 101
           |||||||||||||||||||||
Sbjct: 384 tacatttgacaggctaatagg 364



to top

>emb|BX640902.1|HSM807037 Homo sapiens mRNA; cDNA DKFZp686O1754 (from clone DKFZp686O1754)
          Length = 5782

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 81  tacatttgacaggctaatagg 101
           |||||||||||||||||||||
Sbjct: 200 tacatttgacaggctaatagg 180



to top

>gb|AC002126.1|AC002126 Homo sapiens DNA from chromosome 19-cosmids R30102:R29350:R27740
             containing MEF2B, genomic sequence, complete sequence
          Length = 89818

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 467   aggactgggacttgccgtcgt 487
             |||||||||||||||||||||
Sbjct: 36973 aggactgggacttgccgtcgt 36993



to top

>dbj|AK073181.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033001M05, full
           insert sequence
          Length = 964

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 461 acgcgaaggactgggacttgccgtcgtagtacttgga 497
           ||||||| ||||| |||||||||||| || |||||||
Sbjct: 408 acgcgaacgactgcgacttgccgtcgaagaacttgga 372



to top

>dbj|AK072244.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023003F07, full
           insert sequence
          Length = 3941

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 630 gtcggagtcgcaggagaaggaggaggagg 658
           |||||||||| ||||| ||||||||||||
Sbjct: 90  gtcggagtcggaggaggaggaggaggagg 118



to top

>gb|AE003832.4| Drosophila melanogaster chromosome 2R, section 18 of 73 of the complete
              sequence
          Length = 242171

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 637    tcgcaggagaaggaggaggag 657
              |||||||||||||||||||||
Sbjct: 200339 tcgcaggagaaggaggaggag 200359



to top

>gb|AE003589.4| Drosophila melanogaster chromosome 2L, section 2 of 83 of the complete
              sequence
          Length = 306076

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 639    gcaggagaaggaggaggaggt 659
              |||||||||||||||||||||
Sbjct: 135543 gcaggagaaggaggaggaggt 135523



to top

>gb|AC005762.1|AC005762 Drosophila melanogaster DNA sequence (P1s DS00679 (D272) and DS05054
             (D135)), complete sequence
          Length = 81053

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 639   gcaggagaaggaggaggaggt 659
             |||||||||||||||||||||
Sbjct: 80769 gcaggagaaggaggaggaggt 80749



to top

>gb|AC005269.1|AC005269 Drosophila melanogaster DNA sequence (P1s DS00764 (D273) and DS00501
            (D274)), complete sequence
          Length = 104278

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 639  gcaggagaaggaggaggaggt 659
            |||||||||||||||||||||
Sbjct: 4912 gcaggagaaggaggaggaggt 4892



to top

>emb|AL833803.8| Mouse DNA sequence from clone RP23-244H7 on chromosome 2, complete
              sequence
          Length = 226251

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 633    ggagtcgcaggagaaggaggaggag 657
              |||| ||||||||||||||||||||
Sbjct: 149805 ggaggcgcaggagaaggaggaggag 149829



to top

>emb|CT010501.6| Mouse DNA sequence from clone RP23-333D13 on chromosome 17, complete
              sequence
          Length = 207346

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 643    gagaaggaggaggaggtctcgaaca 667
              ||||||||||||||||| |||||||
Sbjct: 140852 gagaaggaggaggaggtgtcgaaca 140876



to top

>dbj|AB020695.1| Homo sapiens mRNA for KIAA0888 protein, partial cds
          Length = 3882

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 81  tacatttgacaggctaatagg 101
           |||||||||||||||||||||
Sbjct: 199 tacatttgacaggctaatagg 179



to top

>gb|AY739095.1| Takifugu rubripes frMCM8, frQ9UJA2, frPLCB1, frAL834445, frCDC5L, and
             frSUPTH3 genes, complete sequence; frRUNT (frRUNT) gene,
             complete cds; and frFSTL6 gene, complete sequence
          Length = 109075

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 86399 gcaggagaaggaggaggagg 86380



to top

>gb|AC119832.9| Mus musculus chromosome 3, clone RP23-471I16, complete sequence
          Length = 178681

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 639    gcaggagaaggaggaggagg 658
              ||||||||||||||||||||
Sbjct: 159502 gcaggagaaggaggaggagg 159483



to top

>gb|AC163099.5| Mus musculus chromosome 8, clone RP23-395L6, complete sequence
          Length = 188439

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 639    gcaggagaaggaggaggagg 658
              ||||||||||||||||||||
Sbjct: 165591 gcaggagaaggaggaggagg 165610



to top

>gb|AY113697.1| Homo sapiens SCF apoptosis response protein-1 mRNA, complete cds
          Length = 1082

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 633 ggagtcgcaggagaaggaggaggaggtc 660
           ||||||| ||||| ||||||||||||||
Sbjct: 500 ggagtcggaggaggaggaggaggaggtc 473



to top

>gb|DQ177407.1| Drosophila pseudoobscura Iris gene, complete cds
          Length = 1596

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 645  gaaggaggaggaggtctcga 664
            ||||||||||||||||||||
Sbjct: 1152 gaaggaggaggaggtctcga 1171



to top

>gb|AC166821.2| Mus musculus BAC clone RP24-68F22 from chromosome 17, complete sequence
          Length = 202649

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 640    caggagaaggaggaggaggtctcg 663
              ||||||||||||||||||| ||||
Sbjct: 151619 caggagaaggaggaggagggctcg 151596



to top

>ref|XM_510007.1| PREDICTED: Pan troglodytes similar to farnesyltransferase, CAAX
           box, beta (LOC452971), mRNA
          Length = 1422

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 442 cacctcacctccgacatgca 461
           ||||||||||||||||||||
Sbjct: 813 cacctcacctccgacatgca 794



to top

>ref|XM_471415.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 816

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 640 caggagaaggaggaggaggt 659
           ||||||||||||||||||||
Sbjct: 391 caggagaaggaggaggaggt 372



to top

>gb|AC161812.3| Mus musculus chromosome 15, clone RP23-195I24, complete sequence
          Length = 204464

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 76171 gcaggagaaggaggaggagg 76152



to top

>gb|AC124981.25| Mus musculus chromosome 5, clone RP24-170P20, complete sequence
          Length = 153767

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 24128 gcaggagaaggaggaggagg 24109



to top

>gb|AC158463.7| Mus musculus chromosome 19, clone RP23-71D10, complete sequence
          Length = 190195

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 639    gcaggagaaggaggaggagg 658
              ||||||||||||||||||||
Sbjct: 183147 gcaggagaaggaggaggagg 183128



to top

>gb|AC122893.6| Mus musculus BAC clone RP23-67C3 from chromosome 17, complete sequence
          Length = 206456

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 639    gcaggagaaggaggaggagg 658
              ||||||||||||||||||||
Sbjct: 136265 gcaggagaaggaggaggagg 136246



to top

>gb|AC113720.6| Rattus norvegicus 1 BAC CH230-117B1 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 249629

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 119    ccatcctcaaggaacaaagaagag 142
              |||||| |||||||||||||||||
Sbjct: 218086 ccatccccaaggaacaaagaagag 218109



to top

>gb|AC012376.12| Drosophila melanogaster clone BACR48C12, complete sequence
          Length = 183048

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 639    gcaggagaaggaggaggagg 658
              ||||||||||||||||||||
Sbjct: 178538 gcaggagaaggaggaggagg 178519



to top

>ref|NM_002028.3| Homo sapiens farnesyltransferase, CAAX box, beta (FNTB), mRNA
          Length = 2836

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 442 cacctcacctccgacatgca 461
           ||||||||||||||||||||
Sbjct: 762 cacctcacctccgacatgca 743



to top

>gb|AC146600.4| Mus musculus BAC clone RP23-386G7 from chromosome 17, complete sequence
          Length = 198403

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 639    gcaggagaaggaggaggagg 658
              ||||||||||||||||||||
Sbjct: 150769 gcaggagaaggaggaggagg 150750



to top

>gb|BC070382.1| Homo sapiens cDNA clone IMAGE:6713934, partial cds
          Length = 1059

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 642 ggagaaggaggaggaggtct 661
           ||||||||||||||||||||
Sbjct: 349 ggagaaggaggaggaggtct 330



to top

>ref|NM_178548.2| Homo sapiens transcription factor AP-2 epsilon (activating enhancer
            binding protein 2 epsilon) (TFAP2E), mRNA
          Length = 2201

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 122  tcctcaaggaacaaagaaga 141
            ||||||||||||||||||||
Sbjct: 2063 tcctcaaggaacaaagaaga 2082



to top

>gb|AY342408.1|AY342406S3 Mus musculus CMKLR1 (Cmklr1) gene, intron 2
          Length = 985

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 639 gcaggagaaggaggaggagg 658
           ||||||||||||||||||||
Sbjct: 632 gcaggagaaggaggaggagg 651



to top

>gb|AC161169.10| Mus musculus chromosome 5, clone RP24-102B13, complete sequence
          Length = 239061

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 639  gcaggagaaggaggaggagg 658
            ||||||||||||||||||||
Sbjct: 9975 gcaggagaaggaggaggagg 9956



to top

>gb|AC161884.5| Mus musculus BAC clone RP23-77K23 from chromosome 14, complete sequence
          Length = 243730

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 639    gcaggagaaggaggaggagg 658
              ||||||||||||||||||||
Sbjct: 192724 gcaggagaaggaggaggagg 192705



to top

>gb|AY225134.1| Feldmannia irregularis virus a strain FirrV-1 contig B, partial
             sequence
          Length = 48352

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 380   cgtggctccggcatggcttc 399
             ||||||||||||||||||||
Sbjct: 33578 cgtggctccggcatggcttc 33559



to top

>ref|XM_979354.1| PREDICTED: Mus musculus hypothetical protein LOC670134 (LOC670134),
           mRNA
          Length = 600

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 639 gcaggagaaggaggaggagg 658
           ||||||||||||||||||||
Sbjct: 339 gcaggagaaggaggaggagg 358



to top

>emb|BX640472.24| Zebrafish DNA sequence from clone CH211-251J10 in linkage group 8,
             complete sequence
          Length = 104986

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 641   aggagaaggaggaggaggtc 660
             ||||||||||||||||||||
Sbjct: 57913 aggagaaggaggaggaggtc 57894



to top

>gb|BT011066.1| Drosophila melanogaster GM09828 full insert cDNA
          Length = 3788

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 639  gcaggagaaggaggaggagg 658
            ||||||||||||||||||||
Sbjct: 2848 gcaggagaaggaggaggagg 2867



to top

>gb|AC122377.4| Mus musculus BAC clone RP23-473B13 from chromosome 17, complete
             sequence
          Length = 174143

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 90560 gcaggagaaggaggaggagg 90579



to top

>gb|AC132349.3| Mus musculus BAC clone RP24-82B7 from chromosome 16, complete sequence
          Length = 216783

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 49326 gcaggagaaggaggaggagg 49307



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 49094 gcaggagaaggaggaggagg 49075



to top

>gb|AY326454.1| Homo sapiens transcription factor AP-2 epsilon mRNA, complete cds
          Length = 2201

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 122  tcctcaaggaacaaagaaga 141
            ||||||||||||||||||||
Sbjct: 2063 tcctcaaggaacaaagaaga 2082



to top

>gb|AC108780.10| Mus musculus chromosome 14, clone RP23-445H16, complete sequence
          Length = 196236

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 69617 gcaggagaaggaggaggagg 69636



to top

>gb|AC123029.3| Mus musculus BAC clone RP24-571B18 from chromosome 8, complete sequence
          Length = 154235

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 96445 gcaggagaaggaggaggagg 96464



to top

>gb|AC122456.4| Mus musculus BAC clone RP24-265M23 from chromosome 16, complete
             sequence
          Length = 158610

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 87798 gcaggagaaggaggaggagg 87779



to top

>ref|XM_547686.2| PREDICTED: Canis familiaris similar to Nucleoporin SEH1-like
            (SEC13-like protein), transcript variant 1 (LOC490564),
            mRNA
          Length = 1858

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 79   tttacatttgacaggctaat 98
            ||||||||||||||||||||
Sbjct: 1786 tttacatttgacaggctaat 1805



to top

>gb|AC117235.3| Mus musculus BAC clone RP23-415F18 from 17, complete sequence
          Length = 207331

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 639    gcaggagaaggaggaggagg 658
              ||||||||||||||||||||
Sbjct: 140160 gcaggagaaggaggaggagg 140141



to top

>gb|AC002432.1| Homo sapiens BAC clone CTA-317G18 from 7, complete sequence
          Length = 143427

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 74614 gcaggagaaggaggaggagg 74595



to top

>gb|AC101659.12| Mus musculus chromosome 7, clone RP23-202M11, complete sequence
          Length = 244819

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 72949 gcaggagaaggaggaggagg 72968



to top

>gb|BC023562.2| Homo sapiens dysbindin (dystrobrevin binding protein 1) domain
           containing 2, mRNA (cDNA clone IMAGE:3639906)
          Length = 1330

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 633 ggagtcgcaggagaaggaggaggaggtc 660
           ||||||| ||||| ||||||||||||||
Sbjct: 726 ggagtcggaggaggaggaggaggaggtc 699



to top

>gb|BC001105.2| Homo sapiens dysbindin (dystrobrevin binding protein 1) domain
           containing 2, mRNA (cDNA clone MGC:834 IMAGE:2959575),
           complete cds
          Length = 1023

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 633 ggagtcgcaggagaaggaggaggaggtc 660
           ||||||| ||||| ||||||||||||||
Sbjct: 416 ggagtcggaggaggaggaggaggaggtc 389



to top

>gb|BC012818.2| Homo sapiens dysbindin (dystrobrevin binding protein 1) domain
           containing 2, mRNA (cDNA clone MGC:4222 IMAGE:2959575),
           complete cds
          Length = 1023

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 633 ggagtcgcaggagaaggaggaggaggtc 660
           ||||||| ||||| ||||||||||||||
Sbjct: 416 ggagtcggaggaggaggaggaggaggtc 389



to top

>emb|BX649553.6| Human DNA sequence from clone RP4-674K6 on chromosome X, complete
             sequence
          Length = 86882

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 53883 gcaggagaaggaggaggagg 53864



to top

>emb|AL513263.9| Human DNA sequence from clone CTB-1189H8 on chromosome 1 Contains the
             3' end of the SYT14 gene for synaptotagmin XIV, complete
             sequence
          Length = 125553

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 122   tcctcaaggaacaaagaaga 141
             ||||||||||||||||||||
Sbjct: 15602 tcctcaaggaacaaagaaga 15621



to top

>emb|AL391666.5| Human DNA sequence from clone RP13-130D24 on chromosome Xq21.31-22.1
              Contains a karyopherin (importin) beta 1 (KPNB1)
              pseudogene, complete sequence
          Length = 147080

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 64     ggatgcagaagcctctttac 83
              ||||||||||||||||||||
Sbjct: 103802 ggatgcagaagcctctttac 103783



to top

>emb|AL160400.20| Human DNA sequence from clone RP11-367G6 on chromosome 6 Contains a
             peptidylprolyl isomerase A (cyclophilin A) (PPIA)
             pseudogene and an argininosuccinate synthetase (ASS)
             (ASS1,CTLN1) pseudogene, complete sequence
          Length = 58408

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 642   ggagaaggaggaggaggtct 661
             ||||||||||||||||||||
Sbjct: 42788 ggagaaggaggaggaggtct 42807



to top

>ref|NM_018478.2| Homo sapiens dysbindin (dystrobrevin binding protein 1) domain
           containing 2 (DBNDD2), transcript variant 1, mRNA
          Length = 1504

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 633 ggagtcgcaggagaaggaggaggaggtc 660
           ||||||| ||||| ||||||||||||||
Sbjct: 894 ggagtcggaggaggaggaggaggaggtc 867



to top

>emb|AL157951.5| Human DNA sequence from clone RP5-983H21 on chromosome 1p33-34.3
             Contains the 3' end of a novel protein similar to
             transcription factor AP-2 beta (activating enhancer
             binding protein 2 beta) and the 3' end of the PSMB2 gene
             for proteasome (prosome, macropain) subunit, beta type, 2,
             complete sequence
          Length = 29889

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 122   tcctcaaggaacaaagaaga 141
             ||||||||||||||||||||
Sbjct: 13938 tcctcaaggaacaaagaaga 13919



to top

>emb|AL109920.15|HSDJ335E1 Human DNA sequence from clone RP3-335E1 on chromosome 6q16.2-21 Contains
              a CpG island, complete sequence
          Length = 143805

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 639    gcaggagaaggaggaggagg 658
              ||||||||||||||||||||
Sbjct: 142529 gcaggagaaggaggaggagg 142548



to top

>gb|AC105336.14| Mus musculus chromosome 3, clone RP24-277J22, complete sequence
          Length = 176399

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 639    gcaggagaaggaggaggagg 658
              ||||||||||||||||||||
Sbjct: 103573 gcaggagaaggaggaggagg 103554



to top

>gb|AC158467.3| Mus musculus chromosome 3, clone RP23-116C1, complete sequence
          Length = 173252

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 80373 gcaggagaaggaggaggagg 80354



to top

>emb|AL021578.4|HS453C12 Human DNA sequence from clone RP3-453C12 on chromosome 20q12-13.12
              Contains the MATN4 gene for matrilin 4, the RBPSUHL gene
              for recombining binding protein suppressor of hairless
              (Drosophila)-like, the SDC4 (syndecan 4 (amphiglycan,
              ryudocan)) gene, the C20orf169 gene for a novel protein
              similar to Drosophila CG11753, the C20orf10 gene for p53
              response element (clg01), the C20orf35 gene for
              uncharacterized hypothalamus protein, the C20orf10 gene,
              the PIGT gene for phosphatidyl inositol glycan class T, an
              NADH dehydrogenase (ubiquinone) 1 beta subcomplex 4
              (NDUFB4) pseudogene and CpG islands, complete sequence
          Length = 147620

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 633    ggagtcgcaggagaaggaggaggaggtc 660
              ||||||| ||||| ||||||||||||||
Sbjct: 121293 ggagtcggaggaggaggaggaggaggtc 121266



to top

>gb|AC118477.14| Mus musculus chromosome 1, clone RP24-178B14, complete sequence
          Length = 191518

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 82640 gcaggagaaggaggaggagg 82659



to top

>gb|AC163019.5| Mus musculus chromosome 19, clone RP24-290E5, complete sequence
          Length = 152969

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 33041 gcaggagaaggaggaggagg 33060



to top

>gb|AC164556.2| Mus musculus BAC clone RP23-334L9 from chromosome 12, complete sequence
          Length = 182308

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 639    gcaggagaaggaggaggagg 658
              ||||||||||||||||||||
Sbjct: 122843 gcaggagaaggaggaggagg 122862



to top

>emb|BX248269.1|CNSLT1I8S human full-length cDNA clone CS0DC015YK16 of Neuroblastoma of Homo
           sapiens (human)
          Length = 2611

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 442 cacctcacctccgacatgca 461
           ||||||||||||||||||||
Sbjct: 608 cacctcacctccgacatgca 589



to top

>gb|AC163012.4| Mus musculus chromosome 8, clone RP23-22A17, complete sequence
          Length = 211779

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 639    gcaggagaaggaggaggagg 658
              ||||||||||||||||||||
Sbjct: 184557 gcaggagaaggaggaggagg 184538



to top

>emb|AL596084.13| Mouse DNA sequence from clone RP23-196B5 on chromosome 11 Contains the
              Pank3 gene for pantothenate kinase 3, a pseudogene similar
              to part of ribosomal protein L7a (Rpl7a), a pseudogene
              similar to part of fibrillarin (Fbl), the Rars gene for
              arginyl-tRNA synthetase, the 3' end of the gene for a novel
              protein similar to human KIBRA and two CpG islands,
              complete sequence
          Length = 181103

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 639    gcaggagaaggaggaggagg 658
              ||||||||||||||||||||
Sbjct: 130840 gcaggagaaggaggaggagg 130859



to top

>emb|BX572636.6| Zebrafish DNA sequence from clone CH211-192C1 in linkage group 8,
             complete sequence
          Length = 169758

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 641   aggagaaggaggaggaggtc 660
             ||||||||||||||||||||
Sbjct: 67030 aggagaaggaggaggaggtc 67049



to top

>gb|AC175824.2| Pan troglodytes BAC clone CH251-171H18 from chromosome unknown,
             complete sequence
          Length = 146069

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 84838 gcaggagaaggaggaggagg 84857



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 84814 gcaggagaaggaggaggagg 84833



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 84790 gcaggagaaggaggaggagg 84809



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 84766 gcaggagaaggaggaggagg 84785



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 84742 gcaggagaaggaggaggagg 84761



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 84718 gcaggagaaggaggaggagg 84737



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 84694 gcaggagaaggaggaggagg 84713



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 84670 gcaggagaaggaggaggagg 84689



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 84646 gcaggagaaggaggaggagg 84665



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 84622 gcaggagaaggaggaggagg 84641



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 84598 gcaggagaaggaggaggagg 84617



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 84574 gcaggagaaggaggaggagg 84593



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 84550 gcaggagaaggaggaggagg 84569



to top

>gb|AC104834.4| Mus Musculus Strain C57BL6/J Chromosome 15 RP23-274F23, complete sequence
          Length = 215113

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 639    gcaggagaaggaggaggagg 658
              ||||||||||||||||||||
Sbjct: 203862 gcaggagaaggaggaggagg 203881



to top

>emb|CR625786.1| full-length cDNA clone CS0DC013YL13 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 767

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 633 ggagtcgcaggagaaggaggaggaggtc 660
           ||||||| ||||| ||||||||||||||
Sbjct: 183 ggagtcggaggaggaggaggaggaggtc 156



to top

>gb|AC010688.6| Drosophila melanogaster 3L BAC RP98-11G5 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 201313

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 639    gcaggagaaggaggaggagg 658
              ||||||||||||||||||||
Sbjct: 181487 gcaggagaaggaggaggagg 181506



to top

>emb|CR622797.1| full-length cDNA clone CS0DI011YJ02 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1210

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 633 ggagtcgcaggagaaggaggaggaggtc 660
           ||||||| ||||| ||||||||||||||
Sbjct: 655 ggagtcggaggaggaggaggaggaggtc 628



to top

>emb|CR618346.1| full-length cDNA clone CS0DN001YE03 of Adult brain of Homo sapiens
           (human)
          Length = 1015

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 633 ggagtcgcaggagaaggaggaggaggtc 660
           ||||||| ||||| ||||||||||||||
Sbjct: 431 ggagtcggaggaggaggaggaggaggtc 404



to top

>emb|CR618315.1| full-length cDNA clone CS0DE007YE21 of Placenta of Homo sapiens
           (human)
          Length = 2710

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 442 cacctcacctccgacatgca 461
           ||||||||||||||||||||
Sbjct: 665 cacctcacctccgacatgca 646



to top

>emb|CR618022.1| full-length cDNA clone CS0DI032YJ19 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1133

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 633 ggagtcgcaggagaaggaggaggaggtc 660
           ||||||| ||||| ||||||||||||||
Sbjct: 567 ggagtcggaggaggaggaggaggaggtc 540



to top

>emb|CR610357.1| full-length cDNA clone CS0DN001YK18 of Adult brain of Homo sapiens
           (human)
          Length = 1076

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 633 ggagtcgcaggagaaggaggaggaggtc 660
           ||||||| ||||| ||||||||||||||
Sbjct: 560 ggagtcggaggaggaggaggaggaggtc 533



to top

>gb|AC010118.8| Drosophila melanogaster 3L BAC RP98-10D15 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 171868

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 639    gcaggagaaggaggaggagg 658
              ||||||||||||||||||||
Sbjct: 141877 gcaggagaaggaggaggagg 141896



to top

>dbj|AK093298.1| Homo sapiens cDNA FLJ35979 fis, clone TESTI2013545, highly similar
           to PROTEIN FARNESYLTRANSFERASE BETA SUBUNIT (EC 2.5.1.-)
          Length = 2575

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 442 cacctcacctccgacatgca 461
           ||||||||||||||||||||
Sbjct: 357 cacctcacctccgacatgca 338



to top

>emb|CR600511.1| full-length cDNA clone CS0DJ006YL21 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 783

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 633 ggagtcgcaggagaaggaggaggaggtc 660
           ||||||| ||||| ||||||||||||||
Sbjct: 199 ggagtcggaggaggaggaggaggaggtc 172



to top

>emb|CR595212.1| full-length cDNA clone CS0DK012YC08 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 896

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 633 ggagtcgcaggagaaggaggaggaggtc 660
           ||||||| ||||| ||||||||||||||
Sbjct: 312 ggagtcggaggaggaggaggaggaggtc 285



to top

>gb|AC035138.9| Homo sapiens chromosome 10 clone RP11-314D6, complete sequence
          Length = 184328

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 640    caggagaaggaggaggaggt 659
              ||||||||||||||||||||
Sbjct: 168078 caggagaaggaggaggaggt 168059



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 640    caggagaaggaggaggaggt 659
              ||||||||||||||||||||
Sbjct: 167970 caggagaaggaggaggaggt 167951



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 640    caggagaaggaggaggaggt 659
              ||||||||||||||||||||
Sbjct: 167934 caggagaaggaggaggaggt 167915



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 640    caggagaaggaggaggaggt 659
              ||||||||||||||||||||
Sbjct: 167898 caggagaaggaggaggaggt 167879



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 640    caggagaaggaggaggaggt 659
              ||||||||||||||||||||
Sbjct: 167826 caggagaaggaggaggaggt 167807



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 640    caggagaaggaggaggaggt 659
              ||||||||||||||||||||
Sbjct: 167790 caggagaaggaggaggaggt 167771



to top

>gb|CP000133.1| Rhizobium etli CFN 42, complete genome
          Length = 4381608

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 572     gcgccggcggggaggccggc 591
               ||||||||||||||||||||
Sbjct: 3251605 gcgccggcggggaggccggc 3251586



to top

>gb|AC099520.2| Homo sapiens chromosome 5 clone RP11-6N13, complete sequence
          Length = 180219

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 14137 gcaggagaaggaggaggagg 14156



to top

>gb|AC010751.5| Drosophila melanogaster 3L BAC RP98-9A23 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 181437

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 639    gcaggagaaggaggaggagg 658
              ||||||||||||||||||||
Sbjct: 148242 gcaggagaaggaggaggagg 148223



to top

>emb|BX511237.5| Zebrafish DNA sequence from clone CH211-251M3 in linkage group 5,
             complete sequence
          Length = 52527

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 72    aagcctctttacatttgaca 91
             ||||||||||||||||||||
Sbjct: 40721 aagcctctttacatttgaca 40740



to top

>gb|AC155321.2| Pan troglodytes BAC clone CH251-489N11 from chromosome unknown, complete
              sequence
          Length = 202104

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 413    agggtctcttcttgggcagg 432
              ||||||||||||||||||||
Sbjct: 121399 agggtctcttcttgggcagg 121418



to top

>gb|S82645.1| Ldh-B=lactate dehydrogenase {5' region} [Fundulus heteroclitus,
           testes, Genomic, 272 nt]
          Length = 272

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 639 gcaggagaaggaggaggagg 658
           ||||||||||||||||||||
Sbjct: 230 gcaggagaaggaggaggagg 211



to top

>gb|AC026733.5| Homo sapiens chromosome 5 clone CTD-2325O18, complete sequence
          Length = 132120

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 639    gcaggagaaggaggaggagg 658
              ||||||||||||||||||||
Sbjct: 106527 gcaggagaaggaggaggagg 106546



to top

>gb|AC034244.6| Homo sapiens chromosome 5 clone RP11-101B14, complete sequence
          Length = 182892

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 43865 gcaggagaaggaggaggagg 43884



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 43817 gcaggagaaggaggaggagg 43836



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 43793 gcaggagaaggaggaggagg 43812



to top

>dbj|AK087159.1| Mus musculus 0 day neonate lung cDNA, RIKEN full-length enriched
           library, clone:E030030I02 product:unclassifiable, full
           insert sequence
          Length = 1839

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 151 ccagccctggacagacactc 170
           ||||||||||||||||||||
Sbjct: 380 ccagccctggacagacactc 361



to top

>gb|AC011071.12|AC011071 Drosophila melanogaster, chromosome X, region 18C-18D, BAC clone
             BACR27L16, complete sequence
          Length = 182623

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 39492 gcaggagaaggaggaggagg 39473



to top

>ref|NM_152982.2| Danio rerio myosin, heavy polypeptide 2, fast muscle specific
            (myhz2), mRNA
          Length = 5991

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 72   aagcctctttacatttgaca 91
            ||||||||||||||||||||
Sbjct: 2636 aagcctctttacatttgaca 2617



to top

>dbj|AK037370.1| Mus musculus 16 days neonate thymus cDNA, RIKEN full-length enriched
            library, clone:A130010O03 product:unclassifiable, full
            insert sequence
          Length = 4856

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 640  caggagaaggaggaggaggtctcg 663
            ||||||||||||||||||| ||||
Sbjct: 2502 caggagaaggaggaggagggctcg 2479



to top

>emb|AL607078.26| Mouse DNA sequence from clone RP23-422H14 on chromosome 4, complete
             sequence
          Length = 138211

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 15437 gcaggagaaggaggaggagg 15456



to top

>gb|AC073542.4|AC073542 Homo sapiens chromosome 5 clone RP11-221L16, complete sequence
          Length = 141633

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 57850 gcaggagaaggaggaggagg 57869



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 57802 gcaggagaaggaggaggagg 57821



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 57778 gcaggagaaggaggaggagg 57797



to top

>emb|CR338837.1| Gallus gallus finished cDNA, clone ChEST850i12
          Length = 1327

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 134 aaagaagagacgcgaagcca 153
           ||||||||||||||||||||
Sbjct: 315 aaagaagagacgcgaagcca 334



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 631      tcggagtcgcaggagaaggaggaggagg 658
                ||||||||| ||||| ||||||||||||
Sbjct: 20807147 tcggagtcggaggaggaggaggaggagg 20807174



to top

>gb|AC108022.3| Homo sapiens BAC clone RP11-9D8 from 4, complete sequence
          Length = 162609

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 135   aagaagagacgcgaagccag 154
             ||||||||||||||||||||
Sbjct: 34675 aagaagagacgcgaagccag 34656



to top

>gb|AC104686.2| Homo sapiens BAC clone RP11-74M11 from 4, complete sequence
          Length = 149964

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 22507 gcaggagaaggaggaggagg 22526



to top

>gb|AC157813.6| Mus musculus chromosome 1, clone RP24-70I14, complete sequence
          Length = 177317

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 639    gcaggagaaggaggaggagg 658
              ||||||||||||||||||||
Sbjct: 107114 gcaggagaaggaggaggagg 107095



to top

>gb|AC087217.1|AC087217 Mus musculus chromosome 17 clone GS-384N12, complete sequence
          Length = 77366

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 53200 gcaggagaaggaggaggagg 53181



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 53062 gcaggagaaggaggaggagg 53043



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 53029 gcaggagaaggaggaggagg 53010



to top

>gb|AC104201.12| Mus musculus chromosome 19, clone RP24-531I1, complete sequence
          Length = 166165

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 62714 gcaggagaaggaggaggagg 62733



to top

>gb|AC079384.26| Homo sapiens 12 BAC RP11-148B3 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 180555

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 639    gcaggagaaggaggaggagg 658
              ||||||||||||||||||||
Sbjct: 149107 gcaggagaaggaggaggagg 149126



to top

>gb|AF220191.1|AF220191 Homo sapiens uncharacterized hypothalamus protein HSMNP1 mRNA,
           complete cds
          Length = 1510

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 633 ggagtcgcaggagaaggaggaggaggtc 660
           ||||||| ||||| ||||||||||||||
Sbjct: 900 ggagtcggaggaggaggaggaggaggtc 873



to top

>gb|AC112947.8| Mus musculus chromosome 8, clone RP23-375F22, complete sequence
          Length = 191154

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 639    gcaggagaaggaggaggagg 658
              ||||||||||||||||||||
Sbjct: 117206 gcaggagaaggaggaggagg 117225



to top

>emb|BX546441.10| Mouse DNA sequence from clone RP23-366I14 on chromosome 2, complete
            sequence
          Length = 114325

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 151  ccagccctggacagacactc 170
            ||||||||||||||||||||
Sbjct: 9118 ccagccctggacagacactc 9099



to top

>dbj|AP004038.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1004_H01
          Length = 121377

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 631   tcggagtcgcaggagaaggaggaggagg 658
             ||||||||| ||||| ||||||||||||
Sbjct: 49608 tcggagtcggaggaggaggaggaggagg 49635



to top

>emb|AL807388.8| Mouse DNA sequence from clone RP23-255K14 on chromosome X, complete
              sequence
          Length = 157955

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 42     tcaattccttctcgaacaacatggatgc 69
              ||||||||||||| |||| |||||||||
Sbjct: 107372 tcaattccttctctaacaccatggatgc 107399



to top

>emb|AL671907.6| Mouse DNA sequence from clone RP23-245F8 on chromosome X, complete
             sequence
          Length = 144116

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 12017 gcaggagaaggaggaggagg 12036



to top

>dbj|AK000531.1| Homo sapiens cDNA FLJ20524 fis, clone KAT10570
          Length = 1017

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 633 ggagtcgcaggagaaggaggaggaggtc 660
           ||||||| ||||| ||||||||||||||
Sbjct: 404 ggagtcggaggaggaggaggaggaggtc 377



to top

>dbj|AK026642.1| Homo sapiens cDNA: FLJ22989 fis, clone KAT11824, highly similar to
            AF220191 Homo sapiens uncharacterized hypothalamus
            protein HSMNP1 mRNA
          Length = 1653

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 633  ggagtcgcaggagaaggaggaggaggtc 660
            ||||||| ||||| ||||||||||||||
Sbjct: 1055 ggagtcggaggaggaggaggaggaggtc 1028



to top

>emb|AJ276469.1|HSA276469 Homo sapiens mRNA for hypothetical protein (ORF1 DNA), clone STRAIT
           06042
          Length = 1073

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 633 ggagtcgcaggagaaggaggaggaggtc 660
           ||||||| ||||| ||||||||||||||
Sbjct: 491 ggagtcggaggaggaggaggaggaggtc 464



to top

>emb|AL591565.1|HS453C126 Novel human gene mapping to chomosome 20
          Length = 991

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 633 ggagtcgcaggagaaggaggaggaggtc 660
           ||||||| ||||| ||||||||||||||
Sbjct: 406 ggagtcggaggaggaggaggaggaggtc 379



to top

>gb|BC071279.1| Danio rerio myosin, heavy polypeptide 2, fast muscle specific, mRNA
            (cDNA clone MGC:85728 IMAGE:6969669), complete cds
          Length = 5991

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 72   aagcctctttacatttgaca 91
            ||||||||||||||||||||
Sbjct: 2636 aagcctctttacatttgaca 2617



to top

>gb|BC041175.1| Homo sapiens transcription factor AP-2 epsilon (activating enhancer
            binding protein 2 epsilon), mRNA (cDNA clone MGC:49007
            IMAGE:5786430), complete cds
          Length = 2201

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 122  tcctcaaggaacaaagaaga 141
            ||||||||||||||||||||
Sbjct: 2063 tcctcaaggaacaaagaaga 2082



to top

>gb|BC020232.1| Homo sapiens farnesyltransferase, CAAX box, beta, mRNA (cDNA clone
           MGC:31935 IMAGE:4652202), complete cds
          Length = 2686

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 442 cacctcacctccgacatgca 461
           ||||||||||||||||||||
Sbjct: 612 cacctcacctccgacatgca 593



to top

>gb|AC107766.14| Mus musculus chromosome 1, clone RP23-166L24, complete sequence
          Length = 182865

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 20038 gcaggagaaggaggaggagg 20057



to top

>gb|AC006933.3|AC006933 Drosophila melanogaster, chromosome 3L, region 73B7-73D6, BAC clone
              BACR48E21, complete sequence
          Length = 186002

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 639    gcaggagaaggaggaggagg 658
              ||||||||||||||||||||
Sbjct: 130734 gcaggagaaggaggaggagg 130715



to top

>gb|AF082702.1|AF082702 Fundulus heteroclitus clone FHME6 lactate dehydrogenase B gene,
           promoter
          Length = 313

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 639 gcaggagaaggaggaggagg 658
           ||||||||||||||||||||
Sbjct: 217 gcaggagaaggaggaggagg 198



to top

>gb|AF082701.1|AF082701 Fundulus heteroclitus clone FHME5 lactate dehydrogenase B gene,
           promoter
          Length = 313

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 639 gcaggagaaggaggaggagg 658
           ||||||||||||||||||||
Sbjct: 217 gcaggagaaggaggaggagg 198



to top

>gb|AF082700.1|AF082700 Fundulus heteroclitus clone FHME4 lactate dehydrogenase B gene,
           promoter
          Length = 313

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 639 gcaggagaaggaggaggagg 658
           ||||||||||||||||||||
Sbjct: 217 gcaggagaaggaggaggagg 198



to top

>gb|AF082699.1|AF082699 Fundulus heteroclitus clone FHME3 lactate dehydrogenase B gene,
           promoter
          Length = 313

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 639 gcaggagaaggaggaggagg 658
           ||||||||||||||||||||
Sbjct: 217 gcaggagaaggaggaggagg 198



to top

>gb|AF082698.1|AF082698 Fundulus heteroclitus clone FHME2 lactate dehydrogenase B gene,
           promoter
          Length = 313

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 639 gcaggagaaggaggaggagg 658
           ||||||||||||||||||||
Sbjct: 217 gcaggagaaggaggaggagg 198



to top

>gb|AF082697.1|AF082697 Fundulus heteroclitus clone FHME1 lactate dehydrogenase B gene,
           promoter
          Length = 313

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 639 gcaggagaaggaggaggagg 658
           ||||||||||||||||||||
Sbjct: 217 gcaggagaaggaggaggagg 198



to top

>emb|AL139022.4|CNS01DX4 Human chromosome 14 DNA sequence BAC R-840I19 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 190517

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 442   cacctcacctccgacatgca 461
             ||||||||||||||||||||
Sbjct: 78410 cacctcacctccgacatgca 78429



to top

>gb|AE003526.4| Drosophila melanogaster chromosome 3L, section 59 of 83 of the complete
              sequence
          Length = 281100

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 639    gcaggagaaggaggaggagg 658
              ||||||||||||||||||||
Sbjct: 185360 gcaggagaaggaggaggagg 185379



to top

>gb|AE003512.3| Drosophila melanogaster chromosome X, section 64 of 74 of the complete
             sequence
          Length = 346474

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 83738 gcaggagaaggaggaggagg 83719



to top

>gb|AE003473.3| Drosophila melanogaster chromosome 3L, section 7 of 83 of the complete
             sequence
          Length = 315108

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 28567 gcaggagaaggaggaggagg 28586



to top

>gb|AC101745.9| Mus musculus chromosome 19, clone RP23-473I8, complete sequence
          Length = 174866

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 639    gcaggagaaggaggaggagg 658
              ||||||||||||||||||||
Sbjct: 117185 gcaggagaaggaggaggagg 117204



to top

>gb|BC078926.1| Rattus norvegicus similar to 9230105E10Rik protein, mRNA (cDNA
           clone MGC:93716 IMAGE:7106563), complete cds
          Length = 2470

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 119 ccatcctcaaggaacaaagaagag 142
           |||||| |||||||||||||||||
Sbjct: 910 ccatccccaaggaacaaagaagag 933



to top

>gb|AC005557.1|AC005557 Drosophila melanogaster, chromosome 3L, region 62A10-62B5, P1 clones
              DS02777, DS03222, DS02345, and DS04808, complete sequence
          Length = 257867

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 639    gcaggagaaggaggaggagg 658
              ||||||||||||||||||||
Sbjct: 254865 gcaggagaaggaggaggagg 254884



to top

>gb|AC004713.1|AC004713 Drosophila melanogaster, chromosome 3L, region 62B8-62B11, P1 clone
           DS04710, complete sequence
          Length = 72327

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 639 gcaggagaaggaggaggagg 658
           ||||||||||||||||||||
Sbjct: 91  gcaggagaaggaggaggagg 110



to top

>emb|AL732502.32| Mouse DNA sequence from clone RP23-292G12 on chromosome 4, complete
             sequence
          Length = 173351

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 40113 gcaggagaaggaggaggagg 40132



to top

>emb|BX005415.5| Zebrafish DNA sequence from clone DKEY-21I5 in linkage group 5, complete
              sequence
          Length = 243510

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 72     aagcctctttacatttgaca 91
              ||||||||||||||||||||
Sbjct: 222467 aagcctctttacatttgaca 222448



to top

>gb|AC153542.4| Mus musculus 10 BAC RP23-463O2 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 187858

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 639    gcaggagaaggaggaggagg 658
              ||||||||||||||||||||
Sbjct: 123573 gcaggagaaggaggaggagg 123592



to top

>emb|AL627098.30| Mouse DNA sequence from clone RP23-108K17 on chromosome 4, complete
             sequence
          Length = 208131

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 93665 gcaggagaaggaggaggagg 93684



to top

>gb|AC107236.8| Mus musculus chromosome 8, clone RP23-296C23, complete sequence
          Length = 193105

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 73707 gcaggagaaggaggaggagg 73726



to top

>ref|NM_001014023.1| Rattus norvegicus similar to 9230105E10Rik protein (RGD1304579),
           mRNA
          Length = 2470

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 119 ccatcctcaaggaacaaagaagag 142
           |||||| |||||||||||||||||
Sbjct: 910 ccatccccaaggaacaaagaagag 933



to top

>gb|AC167333.3| Mus musculus BAC clone RP23-92L4 from chromosome 5, complete sequence
          Length = 236596

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 639    gcaggagaaggaggaggagg 658
              ||||||||||||||||||||
Sbjct: 162084 gcaggagaaggaggaggagg 162065



to top

>gb|BC013574.1| Homo sapiens cDNA clone IMAGE:3898137, containing frame-shift
           errors
          Length = 2707

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 442 cacctcacctccgacatgca 461
           ||||||||||||||||||||
Sbjct: 635 cacctcacctccgacatgca 616



to top

>emb|CT010565.14| Mouse DNA sequence from clone RP23-263E11 on chromosome 16, complete
             sequence
          Length = 200242

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 53689 gcaggagaaggaggaggagg 53670



to top

>gb|AC111011.6| Mus musculus BAC clone RP23-424D18 from 1, complete sequence
          Length = 201846

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 639    gcaggagaaggaggaggagg 658
              ||||||||||||||||||||
Sbjct: 174847 gcaggagaaggaggaggagg 174828



to top

>emb|CR974466.14| Mouse DNA sequence from clone RP23-331E12 on chromosome 17, complete
             sequence
          Length = 210806

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 58161 gcaggagaaggaggaggagg 58142



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 58092 gcaggagaaggaggaggagg 58073



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 57954 gcaggagaaggaggaggagg 57935



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 57921 gcaggagaaggaggaggagg 57902



to top

>gb|U59856.1|FHU59856 Fundulus heteroclitus lactate dehydrogenase-B (Ldh-B) gene, 5'UTR
          Length = 1071

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 639  gcaggagaaggaggaggagg 658
            ||||||||||||||||||||
Sbjct: 1000 gcaggagaaggaggaggagg 981



to top

>gb|U59852.1|FHU59852 Fundulus heteroclitus lactate dehydrogenase-B (Ldh-B) gene, 5'UTR
          Length = 1048

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 639 gcaggagaaggaggaggagg 658
           ||||||||||||||||||||
Sbjct: 977 gcaggagaaggaggaggagg 958



to top

>gb|U59851.1|FHU59851 Fundulus heteroclitus lactate dehydrogenase-B (Ldh-B) gene, 5'UTR
          Length = 1065

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 639 gcaggagaaggaggaggagg 658
           ||||||||||||||||||||
Sbjct: 994 gcaggagaaggaggaggagg 975



to top

>gb|U59850.1|FHU59850 Fundulus heteroclitus lactate dehydrogenase-B (Ldh-B) gene, 5'UTR
          Length = 1073

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 639  gcaggagaaggaggaggagg 658
            ||||||||||||||||||||
Sbjct: 1002 gcaggagaaggaggaggagg 983



to top

>gb|U59849.1|FHU59849 Fundulus heteroclitus lactate dehydrogenase-B (Ldh-B) gene, 5'UTR
          Length = 1073

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 639  gcaggagaaggaggaggagg 658
            ||||||||||||||||||||
Sbjct: 1002 gcaggagaaggaggaggagg 983



to top

>gb|U59848.1|FHU59848 Fundulus heteroclitus lactate dehydrogenase-B (Ldh-B) gene, 5'UTR
          Length = 1071

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 639  gcaggagaaggaggaggagg 658
            ||||||||||||||||||||
Sbjct: 1000 gcaggagaaggaggaggagg 981



to top

>gb|U59847.1|FHU59847 Fundulus heteroclitus lactate dehydrogenase-B (Ldh-B) gene, 5'UTR
          Length = 1073

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 639  gcaggagaaggaggaggagg 658
            ||||||||||||||||||||
Sbjct: 1002 gcaggagaaggaggaggagg 983



to top

>gb|U59846.1|FHU59846 Fundulus heteroclitus lactate dehydrogenase-B (Ldh-B) gene, 5'UTR
          Length = 1073

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 639  gcaggagaaggaggaggagg 658
            ||||||||||||||||||||
Sbjct: 1002 gcaggagaaggaggaggagg 983



to top

>gb|U59845.1|FHU59845 Fundulus heteroclitus lactate dehydrogenase-B (Ldh-B) gene, 5'UTR
          Length = 1074

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 639  gcaggagaaggaggaggagg 658
            ||||||||||||||||||||
Sbjct: 1003 gcaggagaaggaggaggagg 984



to top

>gb|DQ286748.1| Strongylocentrotus purpuratus forkhead transcription factor K (FoxK)
            mRNA, partial cds
          Length = 1820

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 261  gccgctccgcgccatcatca 280
            ||||||||||||||||||||
Sbjct: 1098 gccgctccgcgccatcatca 1117



to top

>gb|AY870928.1| Physcomitrella patens small rho-1 GTP-binding protein (Rac-1) gene,
           complete cds
          Length = 4922

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 639 gcaggagaaggaggaggagg 658
           ||||||||||||||||||||
Sbjct: 958 gcaggagaaggaggaggagg 977



to top

>gb|AC132939.23| Mus musculus chromosome 5, clone RP24-91I11, complete sequence
          Length = 224918

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 639    gcaggagaaggaggaggagg 658
              ||||||||||||||||||||
Sbjct: 200823 gcaggagaaggaggaggagg 200842



to top

>gb|AC165416.12| Mus musculus chromosome 3, clone RP23-86I19, complete sequence
          Length = 130155

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 46097 gcaggagaaggaggaggagg 46116



to top

>gb|L10414.1|HUMFTB Human farnesyltransferase beta-subunit mRNA, complete cds
          Length = 1248

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 442 cacctcacctccgacatgca 461
           ||||||||||||||||||||
Sbjct: 447 cacctcacctccgacatgca 428



to top

>emb|AL713989.20| Mouse DNA sequence from clone RP23-5I4 on chromosome 5, complete sequence
          Length = 215210

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 639    gcaggagaaggaggaggagg 658
              ||||||||||||||||||||
Sbjct: 114977 gcaggagaaggaggaggagg 114958



to top

>emb|AL732474.8| Mouse DNA sequence from clone RP23-180I2 on chromosome 4, complete
             sequence
          Length = 151555

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 644   agaaggaggaggaggtctcg 663
             ||||||||||||||||||||
Sbjct: 33175 agaaggaggaggaggtctcg 33194



to top

>emb|AL451076.14| Mouse DNA sequence from clone RP23-43O20 on chromosome X, complete
             sequence
          Length = 203581

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 43411 gcaggagaaggaggaggagg 43430



to top

>emb|AL591946.14| Mouse DNA sequence from clone RP23-290M7 on chromosome 15, complete
             sequence
          Length = 188892

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 438   caggcacctcacctccgaca 457
             ||||||||||||||||||||
Sbjct: 84377 caggcacctcacctccgaca 84358



to top

>gb|AC101932.9| Mus musculus chromosome 7, clone RP24-66E13, complete sequence
          Length = 214419

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 68002 gcaggagaaggaggaggagg 68021



to top

>gb|L00635.1|HUMFPTB Human farnesyl-protein transferase beta-subunit mRNA, complete cds
          Length = 1582

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 442 cacctcacctccgacatgca 461
           ||||||||||||||||||||
Sbjct: 616 cacctcacctccgacatgca 597



to top

>gb|AC154653.2| Mus musculus BAC clone RP24-262N5 from chromosome 16, complete sequence
          Length = 164851

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 639   gcaggagaaggaggaggagg 658
             ||||||||||||||||||||
Sbjct: 46888 gcaggagaaggaggaggagg 46907



to top

>dbj|AB037179.1| Candida tropicalis CtPP1 gene for protein-tyrosine phosphatase,
            complete cds
          Length = 1773

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 315  gactaccttgctgctgttgt 334
            ||||||||||||||||||||
Sbjct: 1056 gactaccttgctgctgttgt 1037


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,379,080
Number of Sequences: 3902068
Number of extensions: 6379080
Number of successful extensions: 387166
Number of sequences better than 10.0: 216
Number of HSP's better than 10.0 without gapping: 217
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 384088
Number of HSP's gapped (non-prelim): 3075
length of query: 684
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 661
effective length of database: 17,143,297,704
effective search space: 11331719782344
effective search space used: 11331719782344
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top