ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal8d20
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC137623.3| Oryza sativa (japonica cultivar-group) chromosome... 96 1e-16
2gb|AC124836.2| Oryza sativa (japonica cultivar-group) chromosome... 96 1e-16
3dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 96 1e-16
4dbj|AK060267.1| Oryza sativa (japonica cultivar-group) cDNA clon... 96 1e-16
5dbj|D12634.1|RICYCYTC Oryza sativa (japonica cultivar-group) mRN... 96 1e-16
6gb|M63704.1|RICCYTC Rice cytochrome c (OsCc-1) gene, complete cds 96 1e-16
7emb|AJ539068.1|NTA539068 Nicotiana tabacum cDNA-AFLP-fragment BT... 80 6e-12
8ref|XM_463549.1| Oryza sativa (japonica cultivar-group), predic... 74 4e-10
9dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 74 4e-10
10gb|AF229199.1|AF229199 Oryza sativa chromosome 1 clone OSJNBa004... 74 4e-10
11dbj|AP003379.2| Oryza sativa (japonica cultivar-group) genomic D... 74 4e-10
12dbj|AK121662.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 4e-10
13dbj|AK060676.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 4e-10
14gb|AC155340.1| Brassica rapa subsp. pekinensis chromosome Cytoge... 74 4e-10
15ref|NM_102130.2| Arabidopsis thaliana electron carrier/ electron... 68 2e-08
16gb|AY114580.1| Arabidopsis thaliana cytochrome C (At1g22840) mRN... 68 2e-08
17gb|AY062853.1| Arabidopsis thaliana cytochrome C (At1g22840; F19... 68 2e-08
18gb|AY087108.1| Arabidopsis thaliana clone 31770 mRNA, complete s... 68 2e-08
19gb|AF031540.1|AF031540 Fritillaria agrestis cytochrome C (cytC) ... 68 2e-08
20gb|AF000657.1|ATAF000657 Arabidopsis thaliana BAC F19G10, comple... 68 2e-08
21ref|NM_102131.3| Arabidopsis thaliana unknown protein AT1G22850 ... 64 4e-07
22gb|AF017367.1|AF017367 Oryza sativa cytochrome C mRNA, complete cds 62 1e-06
23gb|AY466606.1| Helianthus annuus cytochrome c mRNA, complete cds 60 6e-06
24emb|BX036717.1|CNS090HT Single read from an extremity of a full-... 54 4e-04
25emb|BX012845.1|CNS08I2P Single read from an extremity of a full-... 54 4e-04
26gb|AC142095.9| Medicago truncatula clone mth2-14c17, complete se... 52 0.001
27gb|AC171534.4| Medicago truncatula chromosome 7 BAC clone mth2-9... 52 0.001
28gb|L77113.1|HNNCYTC Helianthus annuus L. cytochrome c (cytc1) mR... 52 0.001
29emb|Z99829.1|CRCYC1GEN Chlamydomonas reinhardtii CYC1 gene encod... 48 0.022
30gb|M35173.1|CRECYCA C.reinhardtii mitochondrial apocytochrome c ... 48 0.022
31emb|BX071915.1|CNS09RNJ Single read from an extremity of a full-... 46 0.088
32emb|BX070970.1|CNS09QXA Single read from an extremity of a full-... 46 0.088
33emb|BX069282.1|CNS09PME Single read from an extremity of a full-... 46 0.088
34emb|BX068625.1|CNS09P45 Single read from an extremity of a full-... 46 0.088
35emb|BX068476.1|CNS09P00 Single read from an extremity of a full-... 46 0.088
36emb|BX068178.1|CNS09ORQ Single read from an extremity of a full-... 46 0.088
37emb|BX067682.1|CNS09ODY Single read from an extremity of a full-... 46 0.088
38emb|BX066463.1|CNS09NG3 Single read from an extremity of a full-... 46 0.088
39ref|XM_971011.1| PREDICTED: Tribolium castaneum similar to CG179... 46 0.088
40ref|XM_962134.1| PREDICTED: Tribolium castaneum similar to CG179... 46 0.088
41emb|BX064703.1|CNS09M37 Single read from an extremity of a full-... 46 0.088
42emb|BX062557.1|CNS09KFL Single read from an extremity of a full-... 46 0.088
43emb|BX061603.1|CNS09JP3 Single read from an extremity of a full-... 46 0.088
44emb|BX060541.1|CNS09IVL Single read from an extremity of a full-... 46 0.088
45emb|BX060188.1|CNS09ILS Single read from an extremity of a full-... 46 0.088
46emb|BX058941.1|CNS09HN5 Single read from an extremity of a full-... 46 0.088
47emb|BX058045.1|CNS09GY9 Single read from an extremity of a full-... 46 0.088
48emb|BX058044.1|CNS09GY8 Single read from an extremity of a full-... 46 0.088
49emb|BX057320.1|CNS09GE4 Single read from an extremity of a full-... 46 0.088
50emb|BX057317.1|CNS09GE1 Single read from an extremity of a full-... 46 0.088
51emb|BX055390.1|CNS09EWI Single read from an extremity of a full-... 46 0.088
52emb|BX055389.1|CNS09EWH Single read from an extremity of a full-... 46 0.088
53emb|BX053158.1|CNS09D6I Single read from an extremity of a full-... 46 0.088
54emb|BX052789.1|CNS09CW9 Single read from an extremity of a full-... 46 0.088
55emb|BX030987.1|CNS08W2N Single read from an extremity of a full-... 46 0.088
56emb|BX048689.1|CNS099QD Single read from an extremity of a full-... 46 0.088
57emb|BX043390.1|CNS095N6 Single read from an extremity of a full-... 46 0.088
58emb|BX043132.1|CNS095G0 Single read from an extremity of a full-... 46 0.088
59emb|BX040506.1|CNS093F2 Single read from an extremity of a full-... 46 0.088
60emb|BX039822.1|CNS092W2 Single read from an extremity of a full-... 46 0.088
61emb|BX039821.1|CNS092W1 Single read from an extremity of a full-... 46 0.088
62emb|BX036850.1|CNS090LI Single read from an extremity of a full-... 46 0.088
63emb|BX036056.1|CNS08ZZG Single read from an extremity of a full-... 46 0.088
64emb|BX036052.1|CNS08ZZC Single read from an extremity of a full-... 46 0.088
65emb|BX035216.1|CNS08ZC4 Single read from an extremity of a full-... 46 0.088
66emb|BX032226.1|CNS08X12 Single read from an extremity of a full-... 46 0.088
67emb|BX031975.1|CNS08WU3 Single read from an extremity of a full-... 46 0.088
68emb|BX030340.1|CNS08VKO Single read from an extremity of a full-... 46 0.088
69emb|BX027835.1|CNS08TN3 Single read from an extremity of a full-... 46 0.088
70emb|BX026468.1|CNS08SL4 Single read from an extremity of a full-... 46 0.088
71emb|BX026220.1|CNS08SE8 Single read from an extremity of a full-... 46 0.088
72emb|BX024107.1|CNS08QRJ Single read from an extremity of a full-... 46 0.088
73emb|BX024106.1|CNS08QRI Single read from an extremity of a full-... 46 0.088
74emb|BX023752.1|CNS08QHO Single read from an extremity of a full-... 46 0.088
75emb|BX019497.1|CNS08N7H Single read from an extremity of a full-... 46 0.088
76emb|BX018904.1|CNS08MR0 Single read from an extremity of a full-... 46 0.088
77emb|BX018903.1|CNS08MQZ Single read from an extremity of a full-... 46 0.088
78emb|BX017251.1|CNS08LH3 Single read from an extremity of a full-... 46 0.088
79emb|BX015930.1|CNS08KGE Single read from an extremity of a full-... 46 0.088
80emb|BX015215.1|CNS08JWJ Single read from an extremity of a full-... 46 0.088
81emb|BX010251.1|CNS08G2N Single read from an extremity of a full-... 46 0.088
82emb|BX007964.1|CNS08EB4 Single read from an extremity of a full-... 46 0.088
83dbj|D21275.1|RICSS393 Oryza sativa SS393 mRNA for cytochrome c, ... 46 0.088
84ref|XM_310154.2| Anopheles gambiae str. PEST ENSANGP00000020091 ... 46 0.088
85gb|AY431227.1| Aedes aegypti ASAP ID: 35977 cyctochrome c mRNA s... 44 0.35
86gb|DQ440105.1| Aedes aegypti clone AE-442 mitochondrial cytochro... 44 0.35
87gb|AC146549.8| Medicago truncatula clone mth2-7p18, complete seq... 44 0.35
88gb|AC146709.11| Medicago truncatula clone mth2-90m14, complete s... 44 0.35
89emb|AL357080.13| Human DNA sequence from clone RP11-432L12 on ch... 44 0.35
90emb|CR937943.1| Single read from an extremity of a full-length c... 44 0.35
91dbj|AK121277.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.35
92emb|CR762438.7| Zebrafish DNA sequence from clone CH211-12O9 in ... 42 1.4
93gb|AC148765.24| Medicago truncatula clone mth2-34f9, complete se... 42 1.4
94gb|AC104126.2| Homo sapiens chromosome 5 clone RP11-526F3, compl... 42 1.4
95gb|AC010261.5| Homo sapiens chromosome 5 clone CTC-459M5, comple... 42 1.4
96gb|AC124029.15| Mus musculus chromosome 1, clone RP23-238E7, com... 42 1.4
97emb|CR392343.29| Zebrafish DNA sequence from clone CH211-195G6 i... 42 1.4
98gb|AC102045.14| Mus musculus chromosome 1, clone RP23-335P21, co... 42 1.4
99gb|AY697432.1| Lactobacillus parabuchneri strain 33 glucansucras... 40 5.4
100gb|AC129206.3| Mus musculus BAC clone RP24-269P22 from chromosom... 40 5.4
101gb|AY071701.1| Drosophila melanogaster RH17228 full insert cDNA 40 5.4
102emb|BX068183.1|CNS09ORV Single read from an extremity of a full-... 40 5.4
103emb|BX066632.1|CNS09NKS Single read from an extremity of a full-... 40 5.4
104emb|BX064777.1|CNS09M59 Single read from an extremity of a full-... 40 5.4
105emb|BX033449.1|CNS08XZ1 Single read from an extremity of a full-... 40 5.4
106emb|BX027739.1|CNS08TKF Single read from an extremity of a full-... 40 5.4
107emb|BX019287.1|CNS08N1N Single read from an extremity of a full-... 40 5.4
108emb|X01760.1|DMCYCDC4 Drosophila melanogaster cytochrome c gene DC4 40 5.4
109emb|BX324156.6| Zebrafish DNA sequence from clone CH211-215C3 in... 40 5.4
110ref|NM_057828.3| Drosophila melanogaster Cytochrome c proximal C... 40 5.4
111gb|AC024900.20| Homo sapiens 12 BAC RP11-549E9 (Roswell Park Can... 40 5.4
112gb|AC093097.1| Drosophila melanogaster, chromosome 2L, region 36... 40 5.4
113dbj|AK049471.1| Mus musculus 7 days embryo whole body cDNA, RIKE... 40 5.4
114ref|NM_073755.2| Caenorhabditis elegans ZC116.2 (ZC116.2) mRNA, ... 40 5.4
115gb|AC006214.1|AC006214 Drosophila melanogaster, chromosome 2L, r... 40 5.4
116gb|AC175664.2| Mus musculus BAC clone RP24-391A3 from chromosome... 40 5.4
117emb|AL954339.10| Zebrafish DNA sequence from clone CH211-221J21 ... 40 5.4
118emb|BX469897.6| Zebrafish DNA sequence from clone CH211-39F22 in... 40 5.4
119dbj|AB017069.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 5.4
120gb|AE015450.1| Mycoplasma gallisepticum strain R complete genome 40 5.4
121gb|AE003652.2| Drosophila melanogaster chromosome 2L, section 61... 40 5.4
122dbj|AP000894.6| Homo sapiens genomic DNA, chromosome 18 clone:RP... 40 5.4
123emb|AL731735.14| Mouse DNA sequence from clone RP23-139P21 on ch... 40 5.4
124gb|M11381.1|DROCYCE D.melanogaster cytochrome C gene 40 5.4 
>gb|AC137623.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0426G01,
              complete sequence
          Length = 173074

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                          
Query: 326    gaggtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagacca 385
              ||||| |||| ||||||||| | ||| ||||||||||| ||||||||||||||||  |||
Sbjct: 159501 gaggttgcttccttcaggtaggaaataagatcagcacgctcctgtggcttcttcaaccca 159442

                                  
Query: 386    gggaagaccatcttggttcc 405
              ||||||||||||||||||||
Sbjct: 159441 gggaagaccatcttggttcc 159422



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 197    caagataattgtctcgtggat 217
              |||||||||||||||||||||
Sbjct: 159626 caagataattgtctcgtggat 159606
to top
>gb|AC124836.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBb0092E21, complete sequence
          Length = 132649

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                         
Query: 326   gaggtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagacca 385
             ||||| |||| ||||||||| | ||| ||||||||||| ||||||||||||||||  |||
Sbjct: 31235 gaggttgcttccttcaggtaggaaataagatcagcacgctcctgtggcttcttcaaccca 31176

                                 
Query: 386   gggaagaccatcttggttcc 405
             ||||||||||||||||||||
Sbjct: 31175 gggaagaccatcttggttcc 31156



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 197   caagataattgtctcgtggat 217
             |||||||||||||||||||||
Sbjct: 31360 caagataattgtctcgtggat 31340
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                            
Query: 326      gaggtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagacca 385
                ||||| |||| ||||||||| | ||| ||||||||||| ||||||||||||||||  |||
Sbjct: 20487756 gaggttgcttccttcaggtaggaaataagatcagcacgctcctgtggcttcttcaaccca 20487697

                                    
Query: 386      gggaagaccatcttggttcc 405
                ||||||||||||||||||||
Sbjct: 20487696 gggaagaccatcttggttcc 20487677



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 197      caagataattgtctcgtggat 217
                |||||||||||||||||||||
Sbjct: 20487881 caagataattgtctcgtggat 20487861
to top
>dbj|AK060267.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-005-D04, full
           insert sequence
          Length = 742

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 326 gaggtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagacca 385
           ||||| |||| ||||||||| | ||| ||||||||||| ||||||||||||||||  |||
Sbjct: 422 gaggttgcttccttcaggtaggaaataagatcagcacgctcctgtggcttcttcaaccca 363

                               
Query: 386 gggaagaccatcttggttcc 405
           ||||||||||||||||||||
Sbjct: 362 gggaagaccatcttggttcc 343



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 197 caagataattgtctcgtggat 217
           |||||||||||||||||||||
Sbjct: 547 caagataattgtctcgtggat 527
to top
>dbj|D12634.1|RICYCYTC Oryza sativa (japonica cultivar-group) mRNA for cytochrome C,
           complete cds
          Length = 654

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 326 gaggtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagacca 385
           ||||| |||| ||||||||| | ||| ||||||||||| ||||||||||||||||  |||
Sbjct: 340 gaggttgcttccttcaggtaggaaataagatcagcacgctcctgtggcttcttcaaccca 281

                               
Query: 386 gggaagaccatcttggttcc 405
           ||||||||||||||||||||
Sbjct: 280 gggaagaccatcttggttcc 261



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 197 caagataattgtctcgtggat 217
           |||||||||||||||||||||
Sbjct: 465 caagataattgtctcgtggat 445
to top
>gb|M63704.1|RICCYTC Rice cytochrome c (OsCc-1) gene, complete cds
          Length = 2408

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                        
Query: 326  gaggtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagacca 385
            ||||| |||| ||||||||| | ||| ||||||||||| ||||||||||||||||  |||
Sbjct: 2219 gaggttgcttccttcaggtaggaaataagatcagcacgctcctgtggcttcttcaaccca 2160

                                
Query: 386  gggaagaccatcttggttcc 405
            ||||||||||||||||||||
Sbjct: 2159 gggaagaccatcttggttcc 2140



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 197  caagataattgtctcgtggat 217
            |||||||||||||||||||||
Sbjct: 2344 caagataattgtctcgtggat 2324
to top
>emb|AJ539068.1|NTA539068 Nicotiana tabacum cDNA-AFLP-fragment BT42-M1-010
          Length = 450

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 61/68 (89%)
 Strand = Plus / Minus

                                                                       
Query: 338 ttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccatc 397
           |||||||| |||||||| || ||||| |||||||||||||||| ||||||||| ||||||
Sbjct: 269 ttcaggtaggcaatgaggtctgcacgctcctgtggcttcttcaaaccagggaaaaccatc 210

                   
Query: 398 ttggttcc 405
           || |||||
Sbjct: 209 tttgttcc 202
to top
>ref|XM_463549.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 336

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                
Query: 329 gtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcag 381
           ||||| ||||||||||| || ||||||||||||||||||||||||| ||||||
Sbjct: 329 gtggcgttcttcaggtatgcgatgagatcagcacggtcctgtggctgcttcag 277
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                     
Query: 329      gtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcag 381
                ||||| ||||||||||| || ||||||||||||||||||||||||| ||||||
Sbjct: 38439384 gtggcgttcttcaggtatgcgatgagatcagcacggtcctgtggctgcttcag 38439332
to top
>gb|AF229199.1|AF229199 Oryza sativa chromosome 1 clone OSJNBa0048I01, complete sequence
          Length = 193444

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                  
Query: 329   gtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcag 381
             ||||| ||||||||||| || ||||||||||||||||||||||||| ||||||
Sbjct: 32481 gtggcgttcttcaggtatgcgatgagatcagcacggtcctgtggctgcttcag 32429
to top
>dbj|AP003379.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0408G07
          Length = 126631

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                  
Query: 329   gtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcag 381
             ||||| ||||||||||| || ||||||||||||||||||||||||| ||||||
Sbjct: 24799 gtggcgttcttcaggtatgcgatgagatcagcacggtcctgtggctgcttcag 24747
to top
>dbj|AK121662.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033064H20, full
           insert sequence
          Length = 696

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                
Query: 329 gtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcag 381
           ||||| ||||||||||| || ||||||||||||||||||||||||| ||||||
Sbjct: 402 gtggcgttcttcaggtatgcgatgagatcagcacggtcctgtggctgcttcag 350
to top
>dbj|AK060676.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-029-B03, full
           insert sequence
          Length = 295

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                
Query: 329 gtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcag 381
           ||||| ||||||||||| || ||||||||||||||||||||||||| ||||||
Sbjct: 109 gtggcgttcttcaggtatgcgatgagatcagcacggtcctgtggctgcttcag 57
to top
>gb|AC155340.1| Brassica rapa subsp. pekinensis chromosome Cytogenetic chromosome 1 clone
              KBrH020D15, complete sequence
          Length = 143633

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 61/69 (88%)
 Strand = Plus / Plus

                                                                          
Query: 337    cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
              ||||| ||| || ||||||||||||||||| || |||||||| || ||||||||||||||
Sbjct: 102836 cttcaagtaggcgatgagatcagcacggtcttgaggcttcttgagcccagggaagaccat 102895

                       
Query: 397    cttggttcc 405
              ||| |||||
Sbjct: 102896 cttcgttcc 102904
to top
>ref|NM_102130.2| Arabidopsis thaliana electron carrier/ electron transporter
           AT1G22840 mRNA, complete cds
          Length = 727

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||| ||| || ||||||||||||||||| || |||||||| || |||||||| |||||
Sbjct: 418 cttcaagtaggcgatgagatcagcacggtcttgcggcttctttagcccagggaacaccat 359

                 
Query: 397 cttggt 402
           ||||||
Sbjct: 358 cttggt 353
to top
>gb|AY114580.1| Arabidopsis thaliana cytochrome C (At1g22840) mRNA, complete cds
          Length = 475

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||| ||| || ||||||||||||||||| || |||||||| || |||||||| |||||
Sbjct: 324 cttcaagtaggcgatgagatcagcacggtcttgcggcttctttagcccagggaacaccat 265

                 
Query: 397 cttggt 402
           ||||||
Sbjct: 264 cttggt 259
to top
>gb|AY062853.1| Arabidopsis thaliana cytochrome C (At1g22840; F19G10.20) mRNA,
           complete cds
          Length = 619

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||| ||| || ||||||||||||||||| || |||||||| || |||||||| |||||
Sbjct: 411 cttcaagtaggcgatgagatcagcacggtcttgcggcttctttagcccagggaacaccat 352

                 
Query: 397 cttggt 402
           ||||||
Sbjct: 351 cttggt 346
to top
>gb|AY087108.1| Arabidopsis thaliana clone 31770 mRNA, complete sequence
          Length = 627

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||| ||| || ||||||||||||||||| || |||||||| || |||||||| |||||
Sbjct: 418 cttcaagtaggcgatgagatcagcacggtcttgcggcttctttagcccagggaacaccat 359

                 
Query: 397 cttggt 402
           ||||||
Sbjct: 358 cttggt 353
to top
>gb|AF031540.1|AF031540 Fritillaria agrestis cytochrome C (cytC) mRNA, complete cds
          Length = 570

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                       
Query: 329 gtggctttcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccaggg 388
           ||||||| ||| ||||| ||||| || || || || || |||||||||||||||||||||
Sbjct: 386 gtggcttccttgaggtaagcaatcaggtccgctcgatcttgtggcttcttcagaccaggg 327

                         
Query: 389 aagaccatcttggt 402
           || |||||||||||
Sbjct: 326 aacaccatcttggt 313
to top
>gb|AF000657.1|ATAF000657 Arabidopsis thaliana BAC F19G10, complete sequence
          Length = 92948

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 58/66 (87%)
 Strand = Plus / Plus

                                                                         
Query: 337   cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
             ||||| ||| || ||||||||||||||||| || |||||||| || |||||||| |||||
Sbjct: 90776 cttcaagtaggcgatgagatcagcacggtcttgcggcttctttagcccagggaacaccat 90835

                   
Query: 397   cttggt 402
             ||||||
Sbjct: 90836 cttggt 90841
to top
>ref|NM_102131.3| Arabidopsis thaliana unknown protein AT1G22850 mRNA, complete cds
          Length = 1563

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 56/64 (87%)
 Strand = Plus / Plus

                                                                        
Query: 337  cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
            ||||| ||| || ||||||||||||||||| || |||||||| || |||||||| |||||
Sbjct: 1500 cttcaagtaggcgatgagatcagcacggtcttgcggcttctttagcccagggaacaccat 1559

                
Query: 397  cttg 400
            ||||
Sbjct: 1560 cttg 1563
to top
>gb|AF017367.1|AF017367 Oryza sativa cytochrome C mRNA, complete cds
          Length = 609

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 59/67 (88%), Gaps = 1/67 (1%)
 Strand = Plus / Minus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| | ||| ||||||||||| |||||||| || ||||  ||||||||||||||
Sbjct: 410 cttcaggtaggaaataagatcagcacgctcctgtggttt-ttcaacccagggaagaccat 352

                  
Query: 397 cttggtt 403
           |||||||
Sbjct: 351 cttggtt 345
to top
>gb|AY466606.1| Helianthus annuus cytochrome c mRNA, complete cds
          Length = 684

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 60/70 (85%)
 Strand = Plus / Minus

                                                                       
Query: 336 tcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagacca 395
           |||||| ||| ||||||||||| ||||| ||||||||||| ||| | || ||||| ||||
Sbjct: 443 tcttcaagtatgcaatgagatctgcacgctcctgtggctttttcggtcctgggaaaacca 384

                     
Query: 396 tcttggttcc 405
           |||| |||||
Sbjct: 383 tctttgttcc 374
to top
>emb|BX036717.1|CNS090HT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA8DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 270

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 54/63 (85%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| ||||| |||||
Sbjct: 193 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggggaacaccat 252

              
Query: 397 ctt 399
           |||
Sbjct: 253 ctt 255
to top
>emb|BX012845.1|CNS08I2P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA2BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 54/63 (85%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| ||||| |||||
Sbjct: 727 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggggaacaccat 786

              
Query: 397 ctt 399
           |||
Sbjct: 787 ctt 789
to top
>gb|AC142095.9| Medicago truncatula clone mth2-14c17, complete sequence
          Length = 110037

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                         
Query: 338   ttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccatc 397
             ||||| || ||||| ||||||||||| || || |||||||| |||||||| || ||||||
Sbjct: 58014 ttcagatatgcaataagatcagcacgttcttgaggcttcttaagaccaggaaaaaccatc 58073

               
Query: 398   tt 399
             ||
Sbjct: 58074 tt 58075
to top
>gb|AC171534.4| Medicago truncatula chromosome 7 BAC clone mth2-90a20, complete
             sequence
          Length = 88903

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                         
Query: 338   ttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccatc 397
             ||||| || ||||| ||||||||||| || || |||||||| |||||||| || ||||||
Sbjct: 79965 ttcagatatgcaataagatcagcacgttcttgaggcttcttaagaccaggaaaaaccatc 80024

               
Query: 398   tt 399
             ||
Sbjct: 80025 tt 80026
to top
>gb|L77113.1|HNNCYTC Helianthus annuus L. cytochrome c (cytc1) mRNA, complete cds
          Length = 559

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                       
Query: 336 tcttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagacca 395
           |||||| ||| ||||||||||| ||||| ||||||||||| || |  || ||||| ||||
Sbjct: 335 tcttcaagtatgcaatgagatctgcacgctcctgtggcttttttaagcctgggaaaacca 276

                     
Query: 396 tcttggttcc 405
           |||| |||||
Sbjct: 275 tctttgttcc 266
to top
>emb|Z99829.1|CRCYC1GEN Chlamydomonas reinhardtii CYC1 gene encoding cytochrome c
          Length = 3078

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 54/64 (84%)
 Strand = Plus / Minus

                                                                        
Query: 337  cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
            ||||||||| ||||| ||||| || || ||||  ||||||||||| |||| ||| |||||
Sbjct: 2540 cttcaggtaggcaatcagatcggcgcgctcctcgggcttcttcaggccagcgaacaccat 2481

                
Query: 397  cttg 400
            ||||
Sbjct: 2480 cttg 2477
to top
>gb|M35173.1|CRECYCA C.reinhardtii mitochondrial apocytochrome c (cyc) mRNA, complete
           cds
          Length = 662

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 54/64 (84%)
 Strand = Plus / Minus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| ||||| ||||| || || ||||  ||||||||||| |||| ||| |||||
Sbjct: 365 cttcaggtaggcaatcagatcggcgcgctcctcgggcttcttcaggccagcgaacaccat 306

               
Query: 397 cttg 400
           ||||
Sbjct: 305 cttg 302
to top
>emb|BX071915.1|CNS09RNJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1011

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 727 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 786

              
Query: 397 ctt 399
           |||
Sbjct: 787 ctt 789
to top
>emb|BX070970.1|CNS09QXA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 761

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 699 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 758

              
Query: 397 ctt 399
           |||
Sbjct: 759 ctt 761
to top
>emb|BX069282.1|CNS09PME Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1030

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 742 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 801

              
Query: 397 ctt 399
           |||
Sbjct: 802 ctt 804
to top
>emb|BX068625.1|CNS09P45 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 552

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||  |||||||||||||| ||||| |||||
Sbjct: 478 cttcaggtaggcgatcagatcgccacgctccttcggcttcttcagaccggggaacaccat 537

              
Query: 397 ctt 399
           |||
Sbjct: 538 ctt 540
to top
>emb|BX068476.1|CNS09P00 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52DA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 713 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 772

              
Query: 397 ctt 399
           |||
Sbjct: 773 ctt 775
to top
>emb|BX068178.1|CNS09ORQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52BA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 735 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 794

              
Query: 397 ctt 399
           |||
Sbjct: 795 ctt 797
to top
>emb|BX067682.1|CNS09ODY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1039

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 715 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 774

              
Query: 397 ctt 399
           |||
Sbjct: 775 ctt 777
to top
>emb|BX066463.1|CNS09NG3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 928

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 723 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 782

              
Query: 397 ctt 399
           |||
Sbjct: 783 ctt 785
to top
>ref|XM_971011.1| PREDICTED: Tribolium castaneum similar to CG17903-PA, transcript
           variant 2 (LOC659690), mRNA
          Length = 685

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 371 ggcttcttcagaccagggaagaccatcttggttcc 405
           |||||||||||||||| ||||||||| || |||||
Sbjct: 327 ggcttcttcagaccagcgaagaccatttttgttcc 293
to top
>ref|XM_962134.1| PREDICTED: Tribolium castaneum similar to CG17903-PA, transcript
           variant 1 (LOC659690), mRNA
          Length = 823

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 371 ggcttcttcagaccagggaagaccatcttggttcc 405
           |||||||||||||||| ||||||||| || |||||
Sbjct: 465 ggcttcttcagaccagcgaagaccatttttgttcc 431
to top
>emb|BX064703.1|CNS09M37 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 258

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 62  cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 121

              
Query: 397 ctt 399
           |||
Sbjct: 122 ctt 124
to top
>emb|BX062557.1|CNS09KFL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43DF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 911

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 730 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 789

              
Query: 397 ctt 399
           |||
Sbjct: 790 ctt 792
to top
>emb|BX061603.1|CNS09JP3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42CB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 709 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 768

              
Query: 397 ctt 399
           |||
Sbjct: 769 ctt 771
to top
>emb|BX060541.1|CNS09IVL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40DH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 715 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 774

              
Query: 397 ctt 399
           |||
Sbjct: 775 ctt 777
to top
>emb|BX060188.1|CNS09ILS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 913

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 716 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 775

              
Query: 397 ctt 399
           |||
Sbjct: 776 ctt 778
to top
>emb|BX058941.1|CNS09HN5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 716 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 775

              
Query: 397 ctt 399
           |||
Sbjct: 776 ctt 778
to top
>emb|BX058045.1|CNS09GY9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 721 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 780

              
Query: 397 ctt 399
           |||
Sbjct: 781 ctt 783
to top
>emb|BX058044.1|CNS09GY8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 995

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 344 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 285

              
Query: 397 ctt 399
           |||
Sbjct: 284 ctt 282
to top
>emb|BX057320.1|CNS09GE4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC37AH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 890

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 735 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 794

              
Query: 397 ctt 399
           |||
Sbjct: 795 ctt 797
to top
>emb|BX057317.1|CNS09GE1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37AH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 651

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 400 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 341

              
Query: 397 ctt 399
           |||
Sbjct: 340 ctt 338
to top
>emb|BX055390.1|CNS09EWI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC34AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 932

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 708 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 767

              
Query: 397 ctt 399
           |||
Sbjct: 768 ctt 770
to top
>emb|BX055389.1|CNS09EWH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 394 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 335

              
Query: 397 ctt 399
           |||
Sbjct: 334 ctt 332
to top
>emb|BX053158.1|CNS09D6I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 639

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 344 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 285

              
Query: 397 ctt 399
           |||
Sbjct: 284 ctt 282
to top
>emb|BX052789.1|CNS09CW9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30AD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 891

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 708 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 767

              
Query: 397 ctt 399
           |||
Sbjct: 768 ctt 770
to top
>emb|BX030987.1|CNS08W2N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA46BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 926

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 735 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 794

              
Query: 397 ctt 399
           |||
Sbjct: 795 ctt 797
to top
>emb|BX048689.1|CNS099QD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC23DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 588

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 521 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 580

              
Query: 397 ctt 399
           |||
Sbjct: 581 ctt 583
to top
>emb|BX043390.1|CNS095N6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC15DH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 740 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 799

              
Query: 397 ctt 399
           |||
Sbjct: 800 ctt 802
to top
>emb|BX043132.1|CNS095G0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC15CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 595

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 373 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 432

              
Query: 397 ctt 399
           |||
Sbjct: 433 ctt 435
to top
>emb|BX040506.1|CNS093F2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC11BE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 677

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 524 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 583

              
Query: 397 ctt 399
           |||
Sbjct: 584 ctt 586
to top
>emb|BX039822.1|CNS092W2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC10BC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 708 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 767

              
Query: 397 ctt 399
           |||
Sbjct: 768 ctt 770
to top
>emb|BX039821.1|CNS092W1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10BC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 345 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 286

              
Query: 397 ctt 399
           |||
Sbjct: 285 ctt 283
to top
>emb|BX036850.1|CNS090LI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9AC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 717 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 776

              
Query: 397 ctt 399
           |||
Sbjct: 777 ctt 779
to top
>emb|BX036056.1|CNS08ZZG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 371

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 262 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 321

              
Query: 397 ctt 399
           |||
Sbjct: 322 ctt 324
to top
>emb|BX036052.1|CNS08ZZC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7CG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 714 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 773

              
Query: 397 ctt 399
           |||
Sbjct: 774 ctt 776
to top
>emb|BX035216.1|CNS08ZC4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA6BH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 885

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 700 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 759

              
Query: 397 ctt 399
           |||
Sbjct: 760 ctt 762
to top
>emb|BX032226.1|CNS08X12 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA48AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 737 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 796

              
Query: 397 ctt 399
           |||
Sbjct: 797 ctt 799
to top
>emb|BX031975.1|CNS08WU3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47CE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 892

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 713 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 772

              
Query: 397 ctt 399
           |||
Sbjct: 773 ctt 775
to top
>emb|BX030340.1|CNS08VKO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA45BB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 709 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 768

              
Query: 397 ctt 399
           |||
Sbjct: 769 ctt 771
to top
>emb|BX027835.1|CNS08TN3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41CF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 950

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 704 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 763

              
Query: 397 ctt 399
           |||
Sbjct: 764 ctt 766
to top
>emb|BX026468.1|CNS08SL4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA4DA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 702 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 761

              
Query: 397 ctt 399
           |||
Sbjct: 762 ctt 764
to top
>emb|BX026220.1|CNS08SE8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA4BF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 846

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 678 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 737

              
Query: 397 ctt 399
           |||
Sbjct: 738 ctt 740
to top
>emb|BX024107.1|CNS08QRJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA36DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 668 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 727

              
Query: 397 ctt 399
           |||
Sbjct: 728 ctt 730
to top
>emb|BX024106.1|CNS08QRI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA36DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 433

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 217 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 158

              
Query: 397 ctt 399
           |||
Sbjct: 157 ctt 155
to top
>emb|BX023752.1|CNS08QHO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA36BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 876

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 753 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 812

              
Query: 397 ctt 399
           |||
Sbjct: 813 ctt 815
to top
>emb|BX019497.1|CNS08N7H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA29DA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 841

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 728 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 787

              
Query: 397 ctt 399
           |||
Sbjct: 788 ctt 790
to top
>emb|BX018904.1|CNS08MR0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA28CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 715 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 774

              
Query: 397 ctt 399
           |||
Sbjct: 775 ctt 777
to top
>emb|BX018903.1|CNS08MQZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 785

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 307 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 248

              
Query: 397 ctt 399
           |||
Sbjct: 247 ctt 245
to top
>emb|BX017251.1|CNS08LH3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 504

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 298 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 239

              
Query: 397 ctt 399
           |||
Sbjct: 238 ctt 236
to top
>emb|BX015930.1|CNS08KGE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA23DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 712 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 771

              
Query: 397 ctt 399
           |||
Sbjct: 772 ctt 774
to top
>emb|BX015215.1|CNS08JWJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA22DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 886

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 727 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 786

              
Query: 397 ctt 399
           |||
Sbjct: 787 ctt 789
to top
>emb|BX010251.1|CNS08G2N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 950

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 678 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 737

              
Query: 397 ctt 399
           |||
Sbjct: 738 ctt 740
to top
>emb|BX007964.1|CNS08EB4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1001

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 721 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 780

              
Query: 397 ctt 399
           |||
Sbjct: 781 ctt 783
to top
>dbj|D21275.1|RICSS393 Oryza sativa SS393 mRNA for cytochrome c, partial sequence
          Length = 344

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 383 ccagggaagaccatcttggttcc 405
           |||||||||||||||||||||||
Sbjct: 327 ccagggaagaccatcttggttcc 305
to top
>ref|XM_310154.2| Anopheles gambiae str. PEST ENSANGP00000020091
           (ENSANGG00000017602), mRNA
          Length = 1083

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                       
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccat 396
           ||||||||| || || |||||  |||| ||||| |||||||||||||| | ||| |||||
Sbjct: 407 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagaccggcgaacaccat 348

              
Query: 397 ctt 399
           |||
Sbjct: 347 ctt 345
to top
>gb|AY431227.1| Aedes aegypti ASAP ID: 35977 cyctochrome c mRNA sequence
          Length = 1095

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 338 ttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccatc 397
           |||||||| || |||||||| ||||| || |  ||||||||||| |||| ||||| ||||
Sbjct: 420 ttcaggtaagcgatgagatcggcacgctcattgggcttcttcaggccagcgaagatcatc 361

             
Query: 398 tt 399
           ||
Sbjct: 360 tt 359
to top
>gb|DQ440105.1| Aedes aegypti clone AE-442 mitochondrial cytochrome c mRNA,
           complete cds; nuclear gene for mitochondrial product
          Length = 327

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 338 ttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccatc 397
           |||||||| || |||||||| ||||| || |  ||||||||||| |||| ||||| ||||
Sbjct: 311 ttcaggtaagcgatgagatcggcacgctcattgggcttcttcaggccagcgaagatcatc 252

             
Query: 398 tt 399
           ||
Sbjct: 251 tt 250
to top
>gb|AC146549.8| Medicago truncatula clone mth2-7p18, complete sequence
          Length = 96612

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 109   ttttccagcaactgaatcaaaa 130
             ||||||||||||||||||||||
Sbjct: 89901 ttttccagcaactgaatcaaaa 89922
to top
>gb|AC146709.11| Medicago truncatula clone mth2-90m14, complete sequence
          Length = 110472

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 109   ttttccagcaactgaatcaaaa 130
             ||||||||||||||||||||||
Sbjct: 51396 ttttccagcaactgaatcaaaa 51417



 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 109   ttttccagcaactgaatcaaaa 130
             ||||||||||||||||||||||
Sbjct: 36211 ttttccagcaactgaatcaaaa 36232
to top
>emb|AL357080.13| Human DNA sequence from clone RP11-432L12 on chromosome 6 Contains STSs
             and GSSs, complete sequence
          Length = 172073

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 243   ctattaatgtctaatcttattatttt 268
             |||||||||||||| |||||||||||
Sbjct: 67056 ctattaatgtctaaacttattatttt 67081
to top
>emb|CR937943.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YP13AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 785

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 338 ttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagaccagggaagaccatc 397
           |||||||| || |||||||| ||||| || |  ||||||||||| |||| ||||| ||||
Sbjct: 414 ttcaggtaagcgatgagatcggcacgctcgttgggcttcttcaggccagcgaagatcatc 355

             
Query: 398 tt 399
           ||
Sbjct: 354 tt 353
to top
>dbj|AK121277.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023108A04, full
           insert sequence
          Length = 781

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 365 tcctgtggcttcttcagaccagggaagaccatcttggt 402
           ||||| ||||||||||| || ||||| |||||||||||
Sbjct: 564 tcctgcggcttcttcaggccggggaacaccatcttggt 527
to top
>emb|CR762438.7| Zebrafish DNA sequence from clone CH211-12O9 in linkage group 1,
            complete sequence
          Length = 16378

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 263  tattttactgcaaaatgaatt 283
            |||||||||||||||||||||
Sbjct: 3001 tattttactgcaaaatgaatt 2981
to top
>gb|AC148765.24| Medicago truncatula clone mth2-34f9, complete sequence
          Length = 85199

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 127   aaaagattgacgaagatttta 147
             |||||||||||||||||||||
Sbjct: 28730 aaaagattgacgaagatttta 28750
to top
>gb|AC104126.2| Homo sapiens chromosome 5 clone RP11-526F3, complete sequence
          Length = 187914

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 264   attttactgcaaaatgaattc 284
             |||||||||||||||||||||
Sbjct: 20468 attttactgcaaaatgaattc 20448
to top
>gb|AC010261.5| Homo sapiens chromosome 5 clone CTC-459M5, complete sequence
          Length = 146017

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 264   attttactgcaaaatgaattc 284
             |||||||||||||||||||||
Sbjct: 26905 attttactgcaaaatgaattc 26925
to top
>gb|AC124029.15| Mus musculus chromosome 1, clone RP23-238E7, complete sequence
          Length = 204904

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 285   actcgtaatgacatgatcacagcat 309
             |||| ||||||||||||||||||||
Sbjct: 47431 actcataatgacatgatcacagcat 47455
to top
>emb|CR392343.29| Zebrafish DNA sequence from clone CH211-195G6 in linkage group 22,
              complete sequence
          Length = 194465

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 249    atgtctaatcttattatttta 269
              |||||||||||||||||||||
Sbjct: 176130 atgtctaatcttattatttta 176150
to top
>gb|AC102045.14| Mus musculus chromosome 1, clone RP23-335P21, complete sequence
          Length = 190825

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 285    actcgtaatgacatgatcacagcat 309
              |||| ||||||||||||||||||||
Sbjct: 143364 actcataatgacatgatcacagcat 143388
to top
>gb|AY697432.1| Lactobacillus parabuchneri strain 33 glucansucrase gene, complete cds
          Length = 5028

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 82   ctggtggtcaaaacatgcgt 101
            ||||||||||||||||||||
Sbjct: 2252 ctggtggtcaaaacatgcgt 2271
to top
>gb|AC129206.3| Mus musculus BAC clone RP24-269P22 from chromosome 8, complete sequence
          Length = 181214

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 358    agcacggtcctgtggcttcttcag 381
              |||| |||||||||||||||||||
Sbjct: 106981 agcagggtcctgtggcttcttcag 106958
to top
>gb|AY071701.1| Drosophila melanogaster RH17228 full insert cDNA
          Length = 763

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 371 ggcttcttcagaccagggaagaccatcttggt 402
           |||||||||||||| | ||||| |||||||||
Sbjct: 422 ggcttcttcagaccggcgaagatcatcttggt 391
to top
>emb|BX068183.1|CNS09ORV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagacc 384
           ||||||||| || || |||||  |||| ||||| ||||||||||||||
Sbjct: 408 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagacc 361
to top
>emb|BX066632.1|CNS09NKS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 781

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagacc 384
           ||||||||| || || |||||  |||| ||||| ||||||||||||||
Sbjct: 722 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagacc 769
to top
>emb|BX064777.1|CNS09M59 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48BD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 796

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 360 cacggtcctgtggcttcttcagaccagggaagaccatctt 399
           |||| ||||| |||||||||||||| | ||| ||||||||
Sbjct: 736 cacgctcctgcggcttcttcagaccggcgaacaccatctt 775
to top
>emb|BX033449.1|CNS08XZ1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 935

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 360 cacggtcctgtggcttcttcagaccagggaagaccatctt 399
           |||| |||| ||||||||||||||| | ||| ||||||||
Sbjct: 690 cacgctcctttggcttcttcagaccggcgaacaccatctt 729
to top
>emb|BX027739.1|CNS08TKF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41CA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagacc 384
           ||||||||| || || |||||  |||| ||||| ||||||||||||||
Sbjct: 714 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagacc 761
to top
>emb|BX019287.1|CNS08N1N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA29BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 749

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 337 cttcaggtacgcaatgagatcagcacggtcctgtggcttcttcagacc 384
           ||||||||| || || |||||  |||| ||||| ||||||||||||||
Sbjct: 702 cttcaggtaggcgatcagatcgccacgctcctgcggcttcttcagacc 749
to top
>emb|X01760.1|DMCYCDC4 Drosophila melanogaster cytochrome c gene DC4
          Length = 1559

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 371  ggcttcttcagaccagggaagaccatcttggt 402
            |||||||||||||| | ||||| |||||||||
Sbjct: 1045 ggcttcttcagaccggcgaagatcatcttggt 1014
to top
>emb|BX324156.6| Zebrafish DNA sequence from clone CH211-215C3 in linkage group 1,
             complete sequence
          Length = 214471

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 263   tattttactgcaaaatgaat 282
             ||||||||||||||||||||
Sbjct: 39518 tattttactgcaaaatgaat 39537
to top
>ref|NM_057828.3| Drosophila melanogaster Cytochrome c proximal CG17903-RA (Cyt-c-p),
           mRNA
          Length = 754

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 371 ggcttcttcagaccagggaagaccatcttggt 402
           |||||||||||||| | ||||| |||||||||
Sbjct: 422 ggcttcttcagaccggcgaagatcatcttggt 391
to top
>gb|AC024900.20| Homo sapiens 12 BAC RP11-549E9 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 171970

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 172  acccatatcataaaaacgaaattc 195
            ||||||||||||||||| ||||||
Sbjct: 6957 acccatatcataaaaactaaattc 6934
to top
>gb|AC093097.1| Drosophila melanogaster, chromosome 2L, region 36A-36B, BAC clone
             BACR26O03, complete sequence
          Length = 175413

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 371   ggcttcttcagaccagggaagaccatcttggt 402
             |||||||||||||| | ||||| |||||||||
Sbjct: 95417 ggcttcttcagaccggcgaagatcatcttggt 95386
to top
>dbj|AK049471.1| Mus musculus 7 days embryo whole body cDNA, RIKEN full-length
            enriched library, clone:C430015E13
            product:unclassifiable, full insert sequence
          Length = 2783

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 358  agcacggtcctgtggcttcttcag 381
            |||| |||||||||||||||||||
Sbjct: 1809 agcagggtcctgtggcttcttcag 1832
to top
>ref|NM_073755.2| Caenorhabditis elegans ZC116.2 (ZC116.2) mRNA, complete cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 374 ttcttcagaccagggaagaccatcttggttcc 405
           ||||||| ||||| |||||||||||| |||||
Sbjct: 305 ttcttcaaaccagcgaagaccatcttagttcc 274
to top
>gb|AC006214.1|AC006214 Drosophila melanogaster, chromosome 2L, region 36A7-36A13, P1 clones
              DS04680 and DS00592, complete sequence
          Length = 129779

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 371    ggcttcttcagaccagggaagaccatcttggt 402
              |||||||||||||| | ||||| |||||||||
Sbjct: 127326 ggcttcttcagaccggcgaagatcatcttggt 127295
to top
>gb|AC175664.2| Mus musculus BAC clone RP24-391A3 from chromosome 8, complete sequence
          Length = 168189

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 260   tattattttactgcaaaatgaatt 283
             ||||||||||||| ||||||||||
Sbjct: 76861 tattattttactggaaaatgaatt 76838
to top
>emb|AL954339.10| Zebrafish DNA sequence from clone CH211-221J21 in linkage group 12,
             complete sequence
          Length = 203958

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 244   tattaatgtctaatcttatt 263
             ||||||||||||||||||||
Sbjct: 25289 tattaatgtctaatcttatt 25270
to top
>emb|BX469897.6| Zebrafish DNA sequence from clone CH211-39F22 in linkage group 4,
              complete sequence
          Length = 186500

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 114    cagcaactgaatcaaaagat 133
              ||||||||||||||||||||
Sbjct: 112675 cagcaactgaatcaaaagat 112656
to top
>dbj|AB017069.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNJ8
          Length = 88128

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 259   ttattattttactgcaaaat 278
             ||||||||||||||||||||
Sbjct: 50912 ttattattttactgcaaaat 50931
to top
>gb|AE015450.1| Mycoplasma gallisepticum strain R complete genome
          Length = 996422

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 21     tatatnaattttaaagatctcat 43
              ||||| |||||||||||||||||
Sbjct: 156168 tatattaattttaaagatctcat 156190
to top
>gb|AE003652.2| Drosophila melanogaster chromosome 2L, section 61 of 83 of the complete
              sequence
          Length = 262525

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 371    ggcttcttcagaccagggaagaccatcttggt 402
              |||||||||||||| | ||||| |||||||||
Sbjct: 106451 ggcttcttcagaccggcgaagatcatcttggt 106420
to top
>dbj|AP000894.6| Homo sapiens genomic DNA, chromosome 18 clone:RP11-672L10, complete
             sequence
          Length = 170522

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 76    cgccacctggtggtcaaaac 95
             ||||||||||||||||||||
Sbjct: 44317 cgccacctggtggtcaaaac 44336
to top
>emb|AL731735.14| Mouse DNA sequence from clone RP23-139P21 on chromosome X, complete
             sequence
          Length = 201223

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 264   attttactgcaaaatgaatt 283
             ||||||||||||||||||||
Sbjct: 82766 attttactgcaaaatgaatt 82785
to top
>gb|M11381.1|DROCYCE D.melanogaster cytochrome C gene
          Length = 1015

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 371 ggcttcttcagaccagggaagaccatcttggt 402
           |||||||||||||| | ||||| |||||||||
Sbjct: 621 ggcttcttcagaccggcgaagatcatcttggt 590


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,998,257
Number of Sequences: 3902068
Number of extensions: 3998257
Number of successful extensions: 76203
Number of sequences better than 10.0: 124
Number of HSP's better than 10.0 without gapping: 124
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 75997
Number of HSP's gapped (non-prelim): 205
length of query: 406
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 384
effective length of database: 17,147,199,772
effective search space: 6584524712448
effective search space used: 6584524712448
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top