>gb|AC099616.35| Mus musculus chromosome 14, clone RP23-445I22, complete sequence
          Length = 167460

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 198   gtcagagcagaagagtaaaaaatgaataat 227
             ||||| ||||||||| ||||||||||||||
Sbjct: 75870 gtcagggcagaagagaaaaaaatgaataat 75841

>emb|AL590666.8| Human DNA sequence from clone RP11-66D17 on chromosome 1 Contains the
             3' end of the SH2D2A gene for SH2 domain protein 2A, the
             PRCC gene for papillary renal cell carcinoma
             (translocation-associated), the HDGF gene for
             hepatoma-derived growth factor (high-mobility group
             protein 1-like), the MRPL24 gene for mitochondrial
             ribosomal protein L24, the gene for CGI-41 protein
             (CGI-41), a novel gene (FLJ12671), a novel gene, the
             CRABP2 gene for cellular retinoic acid binding protein 2,
             a novel gene, the gene for NES nestin, the 5' end of a
             novel gene, the 3' end of the BCAN gene for brevican and 5
             CpG islands, complete sequence
          Length = 160597

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 309   aaaccaaacagcaggatttatg 330
             ||||||||||||||||||||||
Sbjct: 27698 aaaccaaacagcaggatttatg 27677

>ref|XM_847313.1| PREDICTED: Canis familiaris similar to Phosphatidylinositol 3-kinase
            regulatory beta subunit (PI3-kinase p85-beta subunit)
            (PtdIns-3-kinase p85-beta) (LOC609956), mRNA
          Length = 2822

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 20   agaaagaaatgcagaggatcc 40
            |||||||||||||||||||||
Sbjct: 2177 agaaagaaatgcagaggatcc 2197

>gb|AF101310.3| Caenorhabditis elegans cosmid C39F7, complete sequence
          Length = 46226

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 134   actagctgcaaggtcaaaaat 154
             |||||||||||||||||||||
Sbjct: 13188 actagctgcaaggtcaaaaat 13168

>emb|CR762496.7| Zebrafish DNA sequence from clone DKEY-212J2 in linkage group 21,
             complete sequence
          Length = 239780

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 62    atatatttgccattctcctaaaatg 86
             |||||||||||||||||| ||||||
Sbjct: 89180 atatatttgccattctccaaaaatg 89156

>ref|NM_174576.1| Bos taurus phosphoinositide-3-kinase, regulatory subunit, polypeptide
            2 (p85 beta) (PIK3R2), mRNA
          Length = 2175

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 20   agaaagaaatgcagaggatcc 40
            |||||||||||||||||||||
Sbjct: 1532 agaaagaaatgcagaggatcc 1552

>gb|M61746.1|BOVP85AB Bos taurus phosphatidylinositol 3-kinase (p85-beta subunit) complete
            cds
          Length = 2175

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 20   agaaagaaatgcagaggatcc 40
            |||||||||||||||||||||
Sbjct: 1532 agaaagaaatgcagaggatcc 1552

>gb|BC041818.1| Homo sapiens similar to RIKEN cDNA 4933434I20, mRNA (cDNA clone
            MGC:43429 IMAGE:5267198), complete cds
          Length = 3799

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 59   tgtatatatttgccattctc 78
            ||||||||||||||||||||
Sbjct: 2239 tgtatatatttgccattctc 2258

>gb|DQ025556.1| Oncorhynchus tshawytscha clone Ots.SWS1op.40.17 genomic sequence
          Length = 540

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 205 cagaagagtaaaaaatgaat 224
           ||||||||||||||||||||
Sbjct: 163 cagaagagtaaaaaatgaat 182

>ref|NM_001034840.1| Homo sapiens similar to RIKEN cDNA 4933434I20 (LOC152586), mRNA
          Length = 3799

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 59   tgtatatatttgccattctc 78
            ||||||||||||||||||||
Sbjct: 2239 tgtatatatttgccattctc 2258

>gb|AC118698.7| Mus musculus chromosome 1, clone RP24-82I5, complete sequence
          Length = 233783

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 24     agaaatgcagaggatccact 43
              ||||||||||||||||||||
Sbjct: 135732 agaaatgcagaggatccact 135751

>ref|XM_868331.1| PREDICTED: Bos taurus similar to cytochrome P450 monooxygenase
           CYP2T1 (LOC616335), mRNA
          Length = 1323

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 443 tggagttcctgaggctcctg 462
           ||||||||||||||||||||
Sbjct: 566 tggagttcctgaggctcctg 585

>ref|XM_667860.1| Plasmodium berghei strain ANKA hypothetical protein (PB301529.00.0)
           partial mRNA
          Length = 1362

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 17  tgaagaaagaaatgcagagg 36
           ||||||||||||||||||||
Sbjct: 378 tgaagaaagaaatgcagagg 397

>gb|AC102145.3| Mus musculus chromosome 6, clone RP23-302K3, complete sequence
          Length = 199882

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 439    ctggtggagttcctgaggct 458
              ||||||||||||||||||||
Sbjct: 165791 ctggtggagttcctgaggct 165810

>gb|AC149804.11| Medicago truncatula clone mth2-73h22, complete sequence
          Length = 121763

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 90   aaatctatatacatgttttt 109
            ||||||||||||||||||||
Sbjct: 3791 aaatctatatacatgttttt 3772

>emb|CR450821.7| Zebrafish DNA sequence from clone CH211-156B7 in linkage group 3,
             complete sequence
          Length = 163751

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 78    cctaaaatgctaaaatctatatacatgttttt 109
             ||||||||||  ||||||||||| ||||||||
Sbjct: 25852 cctaaaatgcataaatctatataaatgttttt 25821

>emb|AL449343.16| Human DNA sequence from clone RP11-574F9 on chromosome 6, complete
             sequence
          Length = 103487

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 145   ggtcaaaaatattctatgaatttg 168
             |||||| |||||||||||||||||
Sbjct: 66697 ggtcaacaatattctatgaatttg 66674

>emb|AL391215.12| Human DNA sequence from clone RP11-408B19 on chromosome 1 Contains part
             of a novel gene (KIAA1026) and a CpG island, complete
             sequence
          Length = 120551

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 457   ctcctgtcattgggtcatca 476
             ||||||||||||||||||||
Sbjct: 32280 ctcctgtcattgggtcatca 32299

>emb|AL050403.16|HSDJ697P8 Human DNA sequence from clone RP4-697P8 on chromosome 20 Contains two
             novel genes and the FAT1P1 gene for FAT tumour suppressor
             homolog 1 (Drosophila) pseudogene 1, complete sequence
          Length = 144924

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 65    tatttgccattctcctaaaatgct 88
             ||||||||||||||| ||||||||
Sbjct: 41546 tatttgccattctccgaaaatgct 41523

>gb|AC079842.19| Homo sapiens 12q BAC RP11-989K8 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 133000

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 367   tcagttcatcttccttaaca 386
             ||||||||||||||||||||
Sbjct: 13419 tcagttcatcttccttaaca 13438

>emb|BX294140.1| Pirellula sp. strain 1 complete genome; segment 8/24
          Length = 307050

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 355    ggctgtcaaccttcagttca 374
              ||||||||||||||||||||
Sbjct: 201318 ggctgtcaaccttcagttca 201337

>gb|AC110603.7| Homo sapiens chromosome 18, clone CTD-2006O16, complete sequence
          Length = 149256

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 159    tatgaatttgtttctcctct 178
              ||||||||||||||||||||
Sbjct: 103741 tatgaatttgtttctcctct 103760

>gb|AC104422.4| Homo sapiens chromosome 18, clone RP11-260B14, complete sequence
          Length = 147210

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 159    tatgaatttgtttctcctct 178
              ||||||||||||||||||||
Sbjct: 117967 tatgaatttgtttctcctct 117948

>gb|AC161417.5| Mus musculus BAC clone RP23-325H23 from chromosome 6, complete sequence
          Length = 173502

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 439    ctggtggagttcctgaggct 458
              ||||||||||||||||||||
Sbjct: 118943 ctggtggagttcctgaggct 118924

>gb|AC084117.6| Homo sapiens chromosome 11, clone RP11-107C21, complete sequence
          Length = 166973

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 283   ttcttgtaagcttggtgaaa 302
             ||||||||||||||||||||
Sbjct: 13412 ttcttgtaagcttggtgaaa 13393

>gb|AC107948.7| Homo sapiens chromosome 11, clone RP11-81D23, complete sequence
          Length = 156839

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 283   ttcttgtaagcttggtgaaa 302
             ||||||||||||||||||||
Sbjct: 24285 ttcttgtaagcttggtgaaa 24304

>gb|AC098680.3| Homo sapiens BAC clone RP11-600L4 from 4, complete sequence
          Length = 180918

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 153   atattctatgaatttgtttc 172
             ||||||||||||||||||||
Sbjct: 13392 atattctatgaatttgtttc 13411

>gb|AC093671.3| Homo sapiens BAC clone RP11-542P2 from 4, complete sequence
          Length = 186370

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 59    tgtatatatttgccattctc 78
             ||||||||||||||||||||
Sbjct: 87126 tgtatatatttgccattctc 87107

>gb|AC147482.2| Medicago truncatula chromosome 7 BAC clone mth2-93e11, complete
             sequence
          Length = 119127

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 90    aaatctatatacatgttttt 109
             ||||||||||||||||||||
Sbjct: 12029 aaatctatatacatgttttt 12048

>gb|AF143873.1|AF143873 Homo sapiens clone IMAGE:111722 mRNA sequence
          Length = 879

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 159 tatgaatttgtttctcctct 178
           ||||||||||||||||||||
Sbjct: 324 tatgaatttgtttctcctct 305

>gb|AE016796.1| Vibrio vulnificus CMCP6 chromosome II, complete sequence
          Length = 1844853

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 293    cttggtgaaacagcataaac 312
              ||||||||||||||||||||
Sbjct: 285761 cttggtgaaacagcataaac 285742

>gb|AC002500.1|AC002500 Human Cosmid g5129z101 from 7q31.3, complete sequence
          Length = 41084

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 565   tagcagcatttgagtgttct 584
             ||||||||||||||||||||
Sbjct: 24489 tagcagcatttgagtgttct 24508

>emb|AL645491.15| Mouse DNA sequence from clone RP23-10H1 on chromosome X, complete
             sequence
          Length = 127402

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 17    tgaagaaagaaatgcagagg 36
             ||||||||||||||||||||
Sbjct: 34767 tgaagaaagaaatgcagagg 34748


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7,303,520
Number of Sequences: 3902068
Number of extensions: 7303520
Number of successful extensions: 140324
Number of sequences better than 10.0: 33
Number of HSP's better than 10.0 without gapping: 33
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 140260
Number of HSP's gapped (non-prelim): 64
length of query: 629
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 606
effective length of database: 17,143,297,704
effective search space: 10388838408624
effective search space used: 10388838408624
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)