>emb|AJ245479.1|BNA245479 Brassica napus subsp. napus Sll3, slk, srk, CePP, Fmt, SIAH1, AtPP,
SIAH2, & ClpP genes
Length = 64348
Score = 42.1 bits (21), Expect = 0.47
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 86 tttctcgggggaggaggcatt 106
|||||||||||||||||||||
Sbjct: 18618 tttctcgggggaggaggcatt 18638
>gb|AC113082.6| Mus musculus chromosome 9, clone RP23-291C4, complete sequence
Length = 218087
Score = 38.2 bits (19), Expect = 7.3
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 11 catcatgtctacaacatcc 29
|||||||||||||||||||
Sbjct: 74339 catcatgtctacaacatcc 74357
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 940,829
Number of Sequences: 3902068
Number of extensions: 940829
Number of successful extensions: 53101
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 53088
Number of HSP's gapped (non-prelim): 13
length of query: 151
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 130
effective length of database: 17,151,101,840
effective search space: 2229643239200
effective search space used: 2229643239200
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)