ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal33b21
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_179725.1| Arabidopsis thaliana ATCNGC14; calmodulin bindi... 42 0.80
2gb|BT013888.1| Lycopersicon esculentum clone 132873F, mRNA sequence 42 0.80
3ref|NG_000839.1| Homo sapiens cystatin locus (CST@) on chromosom... 42 0.80
4emb|AL591074.10| Human DNA sequence from clone XXyac-60D10 on ch... 42 0.80
5emb|AJ849379.1| Lycopersicon esculentum mRNA for chloroplast mal... 42 0.80
6gb|AC006954.8| Arabidopsis thaliana chromosome 2 clone F25P17 ma... 42 0.80
7emb|BX323008.5| Zebrafish DNA sequence from clone DKEY-29D16 in ... 42 0.80
8emb|BX908758.16| Zebrafish DNA sequence from clone DKEY-32G22 in... 42 0.80
9emb|AJ833960.1| Saccharum hybrid cultivar R570 partial mRNA for ... 42 0.80
10emb|AJ565857.1|SSP565857 Saccharum sp. partial mRNA for NADP-mal... 42 0.80
11emb|AJ512370.1|OCO512370 Oplismenus compositus partial mRNA for ... 42 0.80
12emb|AJ320266.1|SOF320266 Saccharum officinarum partial mRNA for ... 42 0.80
13gb|L40958.2|FTRNADPMAL Flaveria bidentis NADP-malate dehydrogena... 42 0.80
14emb|AL590682.9| Human DNA sequence from clone RP11-435F13 on chr... 40 3.2
15emb|AJ605553.1| Solanum tuberosum mRNA for putrescine N-methyltr... 40 3.2

>ref|NM_179725.1| Arabidopsis thaliana ATCNGC14; calmodulin binding / cyclic nucleotide
            binding / ion channel AT2G24610 (ATCNGC14) mRNA, complete
            cds
          Length = 2398

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 89   actgtgatccttctaataata 109
            |||||||||||||||||||||
Sbjct: 1016 actgtgatccttctaataata 1036



to top

>gb|BT013888.1| Lycopersicon esculentum clone 132873F, mRNA sequence
          Length = 1512

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 224  cctgtaagatgggcaacacat 244
            |||||||||||||||||||||
Sbjct: 1271 cctgtaagatgggcaacacat 1251



to top

>ref|NG_000839.1| Homo sapiens cystatin locus (CST@) on chromosome 20
          Length = 477159

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 100    tctaataataacatgacatct 120
              |||||||||||||||||||||
Sbjct: 178154 tctaataataacatgacatct 178174



to top

>emb|AL591074.10| Human DNA sequence from clone XXyac-60D10 on chromosome 20 Contains the
             CST5 gene for cystatin D, the CST2 gene for cystatin SA,
             the CST1 gene for cystatin SN and the CSTP2 gene for
             cystatin pseudogene 2, complete sequence
          Length = 203076

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 100   tctaataataacatgacatct 120
             |||||||||||||||||||||
Sbjct: 28558 tctaataataacatgacatct 28538



to top

>emb|AJ849379.1| Lycopersicon esculentum mRNA for chloroplast malate dehydrogenase
            (mdh gene)
          Length = 1757

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 224  cctgtaagatgggcaacacat 244
            |||||||||||||||||||||
Sbjct: 1465 cctgtaagatgggcaacacat 1445



to top

>gb|AC006954.8| Arabidopsis thaliana chromosome 2 clone F25P17 map mi238, complete
             sequence
          Length = 93701

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 89    actgtgatccttctaataata 109
             |||||||||||||||||||||
Sbjct: 46839 actgtgatccttctaataata 46819



to top

>emb|BX323008.5| Zebrafish DNA sequence from clone DKEY-29D16 in linkage group 1, complete
              sequence
          Length = 216850

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 98     cttctaataataacatgacat 118
              |||||||||||||||||||||
Sbjct: 182546 cttctaataataacatgacat 182526



to top

>emb|BX908758.16| Zebrafish DNA sequence from clone DKEY-32G22 in linkage group 1,
            complete sequence
          Length = 35797

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 98   cttctaataataacatgacat 118
            |||||||||||||||||||||
Sbjct: 7167 cttctaataataacatgacat 7187



to top

>emb|AJ833960.1| Saccharum hybrid cultivar R570 partial mRNA for NADP-dependant malate
            dehydrogenase (nadp-MDH gene)
          Length = 1059

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 224  cctgtaagatgggcaacacat 244
            |||||||||||||||||||||
Sbjct: 1027 cctgtaagatgggcaacacat 1007



to top

>emb|AJ565857.1|SSP565857 Saccharum sp. partial mRNA for NADP-malate dehydrogenase (nadp-MDH
            gene)
          Length = 1058

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 224  cctgtaagatgggcaacacat 244
            |||||||||||||||||||||
Sbjct: 1026 cctgtaagatgggcaacacat 1006



to top

>emb|AJ512370.1|OCO512370 Oplismenus compositus partial mRNA for NADP-dependant malate
            dehydrogenase (nadp-mdh gene)
          Length = 1257

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 224  cctgtaagatgggcaacacat 244
            |||||||||||||||||||||
Sbjct: 1226 cctgtaagatgggcaacacat 1206



to top

>emb|AJ320266.1|SOF320266 Saccharum officinarum partial mRNA for malate deshydrogenase (mdh
           gene)
          Length = 357

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 224 cctgtaagatgggcaacacat 244
           |||||||||||||||||||||
Sbjct: 248 cctgtaagatgggcaacacat 228



to top

>gb|L40958.2|FTRNADPMAL Flaveria bidentis NADP-malate dehydrogenase precursor, mRNA, complete
            cds; nuclear gene encoding chloroplast protein
          Length = 1560

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 165  ctacatctctncaggaagcattgtatcc 192
            |||||| ||| |||||||||||||||||
Sbjct: 1395 ctacatttctccaggaagcattgtatcc 1368



to top

>emb|AL590682.9| Human DNA sequence from clone RP11-435F13 on chromosome 1 Contains a
             heterogeneous nuclear ribonucleoprotein A1 (HNRPA1)
             pseudogene, part of the RGS7 gene for regulator of
             G-protein signalling 7 and a ribosomal protein large P1
             (RPLP1) pseudogene, complete sequence
          Length = 155156

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 111   catgacatcttggtagcaat 130
             ||||||||||||||||||||
Sbjct: 47220 catgacatcttggtagcaat 47239



to top

>emb|AJ605553.1| Solanum tuberosum mRNA for putrescine N-methyltransferase (pmt
           gene)
          Length = 1332

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 106 aataacatgacatcttggta 125
           ||||||||||||||||||||
Sbjct: 317 aataacatgacatcttggta 298


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,726,057
Number of Sequences: 3902068
Number of extensions: 1726057
Number of successful extensions: 27103
Number of sequences better than 10.0: 15
Number of HSP's better than 10.0 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 27087
Number of HSP's gapped (non-prelim): 16
length of query: 246
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 224
effective length of database: 17,147,199,772
effective search space: 3840972748928
effective search space used: 3840972748928
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top