Clone Name	rbaal33a17
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|BT018920.1| Zea mays clone Contig21.F mRNA sequence	54	5e-04
2	ref|XM_600052.2| PREDICTED: Bos taurus similar to transmembrane ...	50	0.008
3	dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005	50	0.008
4	ref|XM_462221.1| Debaryomyces hansenii CBS767 hypothetical prote...	42	1.9
5	gb|AY659174.1| Synthetic construct Peudomonas aeruginosa clone F...	42	1.9
6	gb|BT012702.1| Lycopersicon esculentum clone 113577R, mRNA sequence	42	1.9
7	emb|CR382139.1| Debaryomyces hansenii chromosome G of strain CBS...	42	1.9
8	gb|AC128039.4| Rattus norvegicus BAC CH230-394A24 (Children's H...	42	1.9
9	gb|AE004490.1| Pseudomonas aeruginosa PAO1, section 51 of 529 of...	42	1.9
10	gb|AF484513.1| HIV-1 isolate 98UG57146 from Uganda, partial genome	42	1.9
11	dbj|AP006545.1| Homo sapiens genomic DNA, chromosome 8p11.21, cl...	42	1.9
12	gb|AC155338.1| Brassica rapa subsp. pekinensis chromosome Cytoge...	42	1.9
13	gb|AC160552.13| Mus musculus chromosome 3, clone RP23-326D6, com...	40	7.5
14	ref|XM_483028.1| Oryza sativa (japonica cultivar-group), mRNA	40	7.5
15	ref|NM_053485.2| Rattus norvegicus S100 calcium binding protein ...	40	7.5
16	gb|AF140232.1| Rattus norvegicus calcium binding protein (S100A6...	40	7.5
17	gb|AY159316.1| Homo sapiens lung cancer oncogene 7 mRNA, complet...	40	7.5
18	gb|BC009017.1| Homo sapiens S100 calcium binding protein A6 (cal...	40	7.5
19	gb|AC168064.3| Mus musculus BAC clone RP23-182K16 from chromosom...	40	7.5
20	gb|AC128270.3| Rattus norvegicus 12 BAC CH230-48A22 (Children's ...	40	7.5
21	gb|BC001431.2| Homo sapiens S100 calcium binding protein A6 (cal...	40	7.5
22	gb|BC010774.1| Mus musculus S100 calcium binding protein A6 (cal...	40	7.5
23	ref|NM_011313.1| Mus musculus S100 calcium binding protein A6 (c...	40	7.5
24	gb|BC003832.1| Mus musculus S100 calcium binding protein A6 (cal...	40	7.5
25	emb|CR848682.9| Zebrafish DNA sequence from clone CH211-286K10 i...	40	7.5
26	emb|CR538727.16| Zebrafish DNA sequence from clone DKEY-9G20 in ...	40	7.5
27	gb|AC132330.5| Mus musculus BAC clone RP24-213O22 from chromosom...	40	7.5
28	gb|AF549497.1| Mus musculus MC3T3-E1 calcyclin mRNA, complete cds	40	7.5
29	emb|BX470102.12| Human DNA sequence from clone RP11-49N14 on chr...	40	7.5
30	emb|AL592063.10| Human DNA sequence from clone RP11-575F9 on chr...	40	7.5
31	ref|XM_504224.1| Yarrowia lipolytica CLIB122, YALI0E21307g predi...	40	7.5
32	ref|NM_014624.3| Homo sapiens S100 calcium binding protein A6 (c...	40	7.5
33	emb|X52278.1|MM5B10 Mouse 5B10 mRNA for calcyclin	40	7.5
34	emb|X66449.1|MMCALC M.musculus mRNA for calcyclin	40	7.5
35	emb|AJ132717.1|RNO132717 Rattus norvegicus mRNA for calcyclin	40	7.5
36	gb|BT007814.1| Synthetic construct Homo sapiens S100 calcium bin...	40	7.5
37	gb|BT006965.1| Homo sapiens S100 calcium binding protein A6 (cal...	40	7.5
38	emb|AL645844.18| Mouse DNA sequence from clone RP23-82B4 on chro...	40	7.5
39	emb|BX548160.13| Zebrafish DNA sequence from clone DKEY-25G11 in...	40	7.5
40	gb|AC105350.2| Drosophila melanogaster X BAC RP98-30C13 (Roswell...	40	7.5
41	gb|AC148584.23| Gasterosteus aculeatus clone ch213-278g3, comple...	40	7.5
42	gb|AC015724.9| Homo sapiens chromosome 17, clone RP11-45J24, com...	40	7.5
43	dbj|AK151587.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	40	7.5
44	dbj|AK150408.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	40	7.5
45	dbj|AK151144.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	40	7.5
46	gb|AF422844.1|AF422844 Yucaipa virus F protein and HN protein ge...	40	7.5
47	dbj|AK008941.1| Mus musculus adult male stomach cDNA, RIKEN full...	40	7.5
48	gb|AY034480.1| Homo sapiens S100 calcium-binding protein A6 gene...	40	7.5
49	dbj|AK008241.1| Mus musculus adult male small intestine cDNA, RI...	40	7.5
50	dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D...	40	7.5
51	gb|AC010890.9| Homo sapiens BAC clone RP11-449L24 from 2, comple...	40	7.5
52	gb|AF252955.1|AF252955 HIV-1 isolate 07c02 from USA nef protein ...	40	7.5
53	emb|BX088527.5| Zebrafish DNA sequence from clone DKEY-200F8 in ...	40	7.5
54	gb|AY891800.1| Synthetic construct Homo sapiens clone FLH110757....	40	7.5
55	gb|AY891799.1| Synthetic construct Homo sapiens clone FLH110756....	40	7.5
56	gb|AY889312.1| Synthetic construct Homo sapiens clone FLH110761....	40	7.5
57	gb|AY889311.1| Synthetic construct Homo sapiens clone FLH110760....	40	7.5
58	emb|AL929559.12| Zebrafish DNA sequence from clone CH211-106G5 i...	40	7.5
59	dbj|AP005918.3| Oryza sativa (japonica cultivar-group) genomic D...	40	7.5
60	gb|AF484515.1| HIV-1 isolate 99UGE13613 from Uganda, partial genome	40	7.5
61	gb|AE003446.4| Drosophila melanogaster chromosome X, section 30 ...	40	7.5
62	gb|AC005553.1|AC005553 Homo sapiens chromosome 17, clone hRPK.11...	40	7.5
63	emb|AL845274.17| Mouse DNA sequence from clone RP23-146F24 on ch...	40	7.5
64	gb|AE009442.1| Xylella fastidiosa Temecula1, complete genome	40	7.5
65	gb|AF064672.1|AF064672 HIV-1 patient 26 clone 26-P7 from Austral...	40	7.5
66	gb|AF064671.1|AF064671 HIV-1 patient 26 clone 26-P6 from Austral...	40	7.5
67	gb|AF064670.1|AF064670 HIV-1 patient 26 clone 26-P4 from Austral...	40	7.5
68	emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB ...	40	7.5
69	gb|AF462775.1| HIV-1 isolate 93KBH7 from South Korea nef-like ge...	40	7.5
70	gb|U31867.1|RNU31867 Rattus norvegicus Tclone15 mRNA	40	7.5
71	gb|M18981.1|HUMCACYA Human prolactin receptor-associated protein...	40	7.5
72	gb|J02763.1|HUMCACY Human calcyclin gene, complete cds	40	7.5
73	gb|M37761.1|MUSCALC23 Mouse calcyclin mRNA, complete cds	40	7.5
74	gb|M14300.1|HUMGFI2A9 Human growth factor-inducible 2A9 gene, co...	40	7.5
75	dbj|D14030.1|APFHENE2 Avian parainfluenza virus type2 RNA for he...	40	7.5
76	gb|U04815.1|HSU04815 Human protein kinase PITSLRE alpha 1 mRNA, ...	40	7.5

---

>gb|BT018920.1| Zea mays clone Contig21.F mRNA sequence
          Length = 931

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 300 cgcagcctgcttgcgacgcagtcagggcttc 330
           |||||||||||||||| ||||||||||||||
Sbjct: 438 cgcagcctgcttgcgatgcagtcagggcttc 468

---

>ref|XM_600052.2| PREDICTED: Bos taurus similar to transmembrane protein 16F
            (LOC521784), mRNA
          Length = 3405

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                     
Query: 120  gccacatccatcactgcttccctca 144
            |||||||||||||||||||||||||
Sbjct: 2176 gccacatccatcactgcttccctca 2200

---

>dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005
          Length = 4429080

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                        
Query: 167     acaaccaacaaacccaaaacacacc 191
               |||||||||||||||||||||||||
Sbjct: 3680040 acaaccaacaaacccaaaacacacc 3680064

---

>ref|XM_462221.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0G16676g)
           partial mRNA
          Length = 3801

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 341 ccacttcctcttcttcttcggctcc 365
           ||||||| |||||||||||||||||
Sbjct: 76  ccacttcttcttcttcttcggctcc 52

---

>gb|AY659174.1| Synthetic construct Peudomonas aeruginosa clone FLH036934.01F
           PA0536 gene, partial cds
          Length = 1026

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 348 ctcttcttcttcggctccggc 368
           |||||||||||||||||||||
Sbjct: 620 ctcttcttcttcggctccggc 600

---

>gb|BT012702.1| Lycopersicon esculentum clone 113577R, mRNA sequence
          Length = 1952

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 449  cttgcagaccacatcagcagt 469
            |||||||||||||||||||||
Sbjct: 1041 cttgcagaccacatcagcagt 1021

---

>emb|CR382139.1| Debaryomyces hansenii chromosome G of strain CBS767 of Debaryomyces
               hansenii
          Length = 2051428

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 341     ccacttcctcttcttcttcggctcc 365
               ||||||| |||||||||||||||||
Sbjct: 1277411 ccacttcttcttcttcttcggctcc 1277387

---

>gb|AC128039.4| Rattus norvegicus  BAC CH230-394A24 (Children's Hospital Oakland Research
              Institute Rat (BN/SsNHsd/MCW) BAC library) complete
              sequence
          Length = 164278

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 167    acaaccaacaaacccaaaaca 187
              |||||||||||||||||||||
Sbjct: 121583 acaaccaacaaacccaaaaca 121563

---

>gb|AE004490.1| Pseudomonas aeruginosa PAO1, section 51 of 529 of the complete genome
          Length = 11445

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 348  ctcttcttcttcggctccggc 368
            |||||||||||||||||||||
Sbjct: 4823 ctcttcttcttcggctccggc 4843

---

>gb|AF484513.1| HIV-1 isolate 98UG57146 from Uganda, partial genome
          Length = 8768

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 339  acccacttcctcttcttcttc 359
            |||||||||||||||||||||
Sbjct: 8162 acccacttcctcttcttcttc 8142

---

>dbj|AP006545.1| Homo sapiens genomic DNA, chromosome 8p11.21, clone: KB1836B05, complete
              sequence
          Length = 156888

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 339    acccacttcctcttcttcttc 359
              |||||||||||||||||||||
Sbjct: 110842 acccacttcctcttcttcttc 110822

---

>gb|AC155338.1| Brassica rapa subsp. pekinensis chromosome Cytogenetic chromosome 1
             clone KBrH138P04, complete sequence
          Length = 137697

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 339   acccacttcctcttcttcttc 359
             |||||||||||||||||||||
Sbjct: 95960 acccacttcctcttcttcttc 95940

---

>gb|AC160552.13| Mus musculus chromosome 3, clone RP23-326D6, complete sequence
          Length = 210051

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 476    cttcctgggggccttggctt 495
              ||||||||||||||||||||
Sbjct: 173957 cttcctgggggccttggctt 173976

---

>ref|XM_483028.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 948

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 341 ccacttcctcttcttcttcg 360
           ||||||||||||||||||||
Sbjct: 469 ccacttcctcttcttcttcg 450

---

>ref|NM_053485.2| Rattus norvegicus S100 calcium binding protein A6 (calcyclin)
           (S100a6), mRNA
          Length = 402

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 476 cttcctgggggccttggctt 495
           ||||||||||||||||||||
Sbjct: 264 cttcctgggggccttggctt 283

---

>gb|AF140232.1| Rattus norvegicus calcium binding protein (S100A6) mRNA, complete
           cds
          Length = 402

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 476 cttcctgggggccttggctt 495
           ||||||||||||||||||||
Sbjct: 264 cttcctgggggccttggctt 283

---

>gb|AY159316.1| Homo sapiens lung cancer oncogene 7 mRNA, complete cds
          Length = 1616

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 476 cttcctgggggccttggctt 495
           ||||||||||||||||||||
Sbjct: 221 cttcctgggggccttggctt 202

---

>gb|BC009017.1| Homo sapiens S100 calcium binding protein A6 (calcyclin), mRNA
           (cDNA clone MGC:18233 IMAGE:4157026), complete cds
          Length = 679

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 476 cttcctgggggccttggctt 495
           ||||||||||||||||||||
Sbjct: 520 cttcctgggggccttggctt 539

---

>gb|AC168064.3| Mus musculus BAC clone RP23-182K16 from chromosome 14, complete
             sequence
          Length = 220900

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 173   aacaaacccaaaacacacca 192
             ||||||||||||||||||||
Sbjct: 34257 aacaaacccaaaacacacca 34276

---

>gb|AC128270.3| Rattus norvegicus 12 BAC CH230-48A22 (Children's Hospital Oakland
              Research Institute Rat (BN/SsNHsd/MCW) BAC library)
              complete sequence
          Length = 236843

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 124    catccatcactgcttccctc 143
              ||||||||||||||||||||
Sbjct: 154444 catccatcactgcttccctc 154425



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 124    catccatcactgcttccctc 143
              ||||||||||||||||||||
Sbjct: 154064 catccatcactgcttccctc 154045



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 124    catccatcactgcttccctc 143
              ||||||||||||||||||||
Sbjct: 153980 catccatcactgcttccctc 153961



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 124    catccatcactgcttccctc 143
              ||||||||||||||||||||
Sbjct: 153896 catccatcactgcttccctc 153877



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 124    catccatcactgcttccctc 143
              ||||||||||||||||||||
Sbjct: 153608 catccatcactgcttccctc 153589

---

>gb|BC001431.2| Homo sapiens S100 calcium binding protein A6 (calcyclin), mRNA
           (cDNA clone MGC:2187 IMAGE:3138609), complete cds
          Length = 506

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 476 cttcctgggggccttggctt 495
           ||||||||||||||||||||
Sbjct: 344 cttcctgggggccttggctt 363

---

>gb|BC010774.1| Mus musculus S100 calcium binding protein A6 (calcyclin), mRNA
           (cDNA clone MGC:18644 IMAGE:4219642), complete cds
          Length = 470

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 476 cttcctgggggccttggctt 495
           ||||||||||||||||||||
Sbjct: 307 cttcctgggggccttggctt 326

---

>ref|NM_011313.1| Mus musculus S100 calcium binding protein A6 (calcyclin) (S100a6),
           mRNA
          Length = 551

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 476 cttcctgggggccttggctt 495
           ||||||||||||||||||||
Sbjct: 384 cttcctgggggccttggctt 403

---

>gb|BC003832.1| Mus musculus S100 calcium binding protein A6 (calcyclin), mRNA
           (cDNA clone MGC:6260 IMAGE:3490662), complete cds
          Length = 499

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 476 cttcctgggggccttggctt 495
           ||||||||||||||||||||
Sbjct: 345 cttcctgggggccttggctt 364

---

>emb|CR848682.9| Zebrafish DNA sequence from clone CH211-286K10 in linkage group 9,
             complete sequence
          Length = 84943

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 173   aacaaacccaaaacacacca 192
             ||||||||||||||||||||
Sbjct: 52508 aacaaacccaaaacacacca 52527

---

>emb|CR538727.16| Zebrafish DNA sequence from clone DKEY-9G20 in linkage group 9,
             complete sequence
          Length = 155321

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 173   aacaaacccaaaacacacca 192
             ||||||||||||||||||||
Sbjct: 38534 aacaaacccaaaacacacca 38553

---

>gb|AC132330.5| Mus musculus BAC clone RP24-213O22 from chromosome 14, complete
             sequence
          Length = 178081

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 173   aacaaacccaaaacacacca 192
             ||||||||||||||||||||
Sbjct: 85124 aacaaacccaaaacacacca 85105

---

>gb|AF549497.1| Mus musculus MC3T3-E1 calcyclin mRNA, complete cds
          Length = 445

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 476 cttcctgggggccttggctt 495
           ||||||||||||||||||||
Sbjct: 290 cttcctgggggccttggctt 309

---

>emb|BX470102.12| Human DNA sequence from clone RP11-49N14 on chromosome 1 Contains the
            S100A6 gene for S100 calcium binding protein A6
            (calcyclin), a novel gene, the S100A5 gene for S100
            calcium binding protein A5, the S100A4 gene for S100
            calcium binding protein A4 (calcium protein, calvasculin,
            metastasin, murine placental homolog), the S100A3 gene
            for S100 calcium binding protein A3, the S100A2 gene for
            S100 calcium binding protein A2, the S100A16 gene for
            S100 calcium binding protein A16, the S100A14 gene for
            S100 calcium binding protein A14, and the 3' end of the
            S100A13 gene for S100 calcium binding protein A13,
            complete sequence
          Length = 100590

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 476  cttcctgggggccttggctt 495
            ||||||||||||||||||||
Sbjct: 8842 cttcctgggggccttggctt 8823

---

>emb|AL592063.10| Human DNA sequence from clone RP11-575F9 on chromosome 1, complete
             sequence
          Length = 160396

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 393   tcctggtgacattccagaga 412
             ||||||||||||||||||||
Sbjct: 82964 tcctggtgacattccagaga 82983

---

>ref|XM_504224.1| Yarrowia lipolytica CLIB122, YALI0E21307g predicted mRNA
          Length = 1482

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 343 acttcctcttcttcttcggc 362
           ||||||||||||||||||||
Sbjct: 260 acttcctcttcttcttcggc 241

---

>ref|NM_014624.3| Homo sapiens S100 calcium binding protein A6 (calcyclin) (S100A6),
           mRNA
          Length = 683

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 476 cttcctgggggccttggctt 495
           ||||||||||||||||||||
Sbjct: 539 cttcctgggggccttggctt 558

---

>emb|X52278.1|MM5B10 Mouse 5B10 mRNA for calcyclin
          Length = 434

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 476 cttcctgggggccttggctt 495
           ||||||||||||||||||||
Sbjct: 300 cttcctgggggccttggctt 319

---

>emb|X66449.1|MMCALC M.musculus mRNA for calcyclin
          Length = 551

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 476 cttcctgggggccttggctt 495
           ||||||||||||||||||||
Sbjct: 384 cttcctgggggccttggctt 403

---

>emb|AJ132717.1|RNO132717 Rattus norvegicus mRNA for calcyclin
          Length = 291

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 476 cttcctgggggccttggctt 495
           ||||||||||||||||||||
Sbjct: 237 cttcctgggggccttggctt 256

---

>gb|BT007814.1| Synthetic construct Homo sapiens S100 calcium binding protein A6
           (calcyclin) mRNA, partial cds
          Length = 273

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 476 cttcctgggggccttggctt 495
           ||||||||||||||||||||
Sbjct: 225 cttcctgggggccttggctt 244

---

>gb|BT006965.1| Homo sapiens S100 calcium binding protein A6 (calcyclin) mRNA,
           complete cds
          Length = 273

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 476 cttcctgggggccttggctt 495
           ||||||||||||||||||||
Sbjct: 225 cttcctgggggccttggctt 244

---

>emb|AL645844.18| Mouse DNA sequence from clone RP23-82B4 on chromosome 11 Contains a
             heat shock protein Hsp90 family pseudogene, complete
             sequence
          Length = 146832

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 85    ccacaacaaaatgatagcaa 104
             ||||||||||||||||||||
Sbjct: 17212 ccacaacaaaatgatagcaa 17193

---

>emb|BX548160.13| Zebrafish DNA sequence from clone DKEY-25G11 in linkage group 11,
              complete sequence
          Length = 237930

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 177    aacccaaaacacaccaccaa 196
              ||||||||||||||||||||
Sbjct: 236729 aacccaaaacacaccaccaa 236710

---

>gb|AC105350.2| Drosophila melanogaster X BAC RP98-30C13 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 184334

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 344   cttcctcttcttcttcggct 363
             ||||||||||||||||||||
Sbjct: 36788 cttcctcttcttcttcggct 36807

---

>gb|AC148584.23| Gasterosteus aculeatus clone ch213-278g3, complete sequence
          Length = 169579

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 127   ccatcactgcttccctcaat 146
             ||||||||||||||||||||
Sbjct: 71009 ccatcactgcttccctcaat 70990

---

>gb|AC015724.9| Homo sapiens chromosome 17, clone RP11-45J24, complete sequence
          Length = 189055

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 124   catccatcactgcttccctc 143
             ||||||||||||||||||||
Sbjct: 85299 catccatcactgcttccctc 85318

---

>dbj|AK151587.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830031P06 product:S100 calcium
           binding protein A6 (calcyclin), full insert sequence
          Length = 429

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 476 cttcctgggggccttggctt 495
           ||||||||||||||||||||
Sbjct: 293 cttcctgggggccttggctt 312

---

>dbj|AK150408.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830006O04 product:S100 calcium
           binding protein A6 (calcyclin), full insert sequence
          Length = 430

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 476 cttcctgggggccttggctt 495
           ||||||||||||||||||||
Sbjct: 293 cttcctgggggccttggctt 312

---

>dbj|AK151144.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830026A04 product:S100 calcium
           binding protein A6 (calcyclin), full insert sequence
          Length = 430

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 476 cttcctgggggccttggctt 495
           ||||||||||||||||||||
Sbjct: 293 cttcctgggggccttggctt 312

---

>gb|AF422844.1|AF422844 Yucaipa virus F protein and HN protein genes, complete cds
          Length = 3615

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 254  caagtcacaagatcaagttg 273
            ||||||||||||||||||||
Sbjct: 1772 caagtcacaagatcaagttg 1753

---

>dbj|AK008941.1| Mus musculus adult male stomach cDNA, RIKEN full-length enriched
           library, clone:2210415I10 product:S100 calcium binding
           protein A6 (calcyclin), full insert sequence
          Length = 430

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 476 cttcctgggggccttggctt 495
           ||||||||||||||||||||
Sbjct: 293 cttcctgggggccttggctt 312

---

>gb|AY034480.1| Homo sapiens S100 calcium-binding protein A6 gene, complete cds
          Length = 274

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 476 cttcctgggggccttggctt 495
           ||||||||||||||||||||
Sbjct: 225 cttcctgggggccttggctt 244

---

>dbj|AK008241.1| Mus musculus adult male small intestine cDNA, RIKEN full-length
           enriched library, clone:2010015A02 product:S100 calcium
           binding protein A6 (calcyclin), full insert sequence
          Length = 430

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 476 cttcctgggggccttggctt 495
           ||||||||||||||||||||
Sbjct: 293 cttcctgggggccttggctt 312

---

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 341      ccacttcctcttcttcttcg 360
                ||||||||||||||||||||
Sbjct: 23944994 ccacttcctcttcttcttcg 23944975

---

>gb|AC010890.9| Homo sapiens BAC clone RP11-449L24 from 2, complete sequence
          Length = 62764

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 111  accacaccagccacatccatcact 134
            |||||||||||| |||||||||||
Sbjct: 4224 accacaccagcctcatccatcact 4247

---

>gb|AF252955.1|AF252955 HIV-1 isolate 07c02 from USA nef protein (nef) gene, complete cds
          Length = 621

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 339 acccacttcctcttcttctt 358
           ||||||||||||||||||||
Sbjct: 201 acccacttcctcttcttctt 182

---

>emb|BX088527.5| Zebrafish DNA sequence from clone DKEY-200F8 in linkage group 1, complete
              sequence
          Length = 148904

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 1      catttttgataaatagacaa 20
              ||||||||||||||||||||
Sbjct: 125180 catttttgataaatagacaa 125199

---

>gb|AY891800.1| Synthetic construct Homo sapiens clone FLH110757.01L S100 calcium
           binding protein A6 (S100A6) mRNA, partial cds
          Length = 273

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 476 cttcctgggggccttggctt 495
           ||||||||||||||||||||
Sbjct: 225 cttcctgggggccttggctt 244

---

>gb|AY891799.1| Synthetic construct Homo sapiens clone FLH110756.01L S100 calcium
           binding protein A6 (S100A6) mRNA, partial cds
          Length = 273

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 476 cttcctgggggccttggctt 495
           ||||||||||||||||||||
Sbjct: 225 cttcctgggggccttggctt 244

---

>gb|AY889312.1| Synthetic construct Homo sapiens clone FLH110761.01X S100 calcium
           binding protein A6 (S100A6) mRNA, complete cds
          Length = 273

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 476 cttcctgggggccttggctt 495
           ||||||||||||||||||||
Sbjct: 225 cttcctgggggccttggctt 244

---

>gb|AY889311.1| Synthetic construct Homo sapiens clone FLH110760.01X S100 calcium
           binding protein A6 (S100A6) mRNA, complete cds
          Length = 273

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 476 cttcctgggggccttggctt 495
           ||||||||||||||||||||
Sbjct: 225 cttcctgggggccttggctt 244

---

>emb|AL929559.12| Zebrafish DNA sequence from clone CH211-106G5 in linkage group 1,
             complete sequence
          Length = 163933

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 178   acccaaaacacaccaccaac 197
             ||||||||||||||||||||
Sbjct: 66997 acccaaaacacaccaccaac 66978

---

>dbj|AP005918.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0419H09
          Length = 143533

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 341   ccacttcctcttcttcttcg 360
             ||||||||||||||||||||
Sbjct: 78145 ccacttcctcttcttcttcg 78126

---

>gb|AF484515.1| HIV-1 isolate 99UGE13613 from Uganda, partial genome
          Length = 8774

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 339  acccacttcctcttcttctt 358
            ||||||||||||||||||||
Sbjct: 8171 acccacttcctcttcttctt 8152

---

>gb|AE003446.4| Drosophila melanogaster chromosome X, section 30 of 74 of the complete
              sequence
          Length = 290970

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 344    cttcctcttcttcttcggct 363
              ||||||||||||||||||||
Sbjct: 286933 cttcctcttcttcttcggct 286914

---

>gb|AC005553.1|AC005553 Homo sapiens chromosome 17, clone hRPK.112_J_9, complete sequence
          Length = 179651

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 124    catccatcactgcttccctc 143
              ||||||||||||||||||||
Sbjct: 169920 catccatcactgcttccctc 169939

---

>emb|AL845274.17| Mouse DNA sequence from clone RP23-146F24 on chromosome 2, complete
              sequence
          Length = 230151

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 411    gaatcaaatgtcaccccgga 430
              ||||||||||||||||||||
Sbjct: 181874 gaatcaaatgtcaccccgga 181855

---

>gb|AE009442.1| Xylella fastidiosa Temecula1, complete genome
          Length = 2519802

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 485     ggccttggcttcatccttga 504
               ||||||||||||||||||||
Sbjct: 2460940 ggccttggcttcatccttga 2460959

---

>gb|AF064672.1|AF064672 HIV-1 patient 26 clone 26-P7 from Australia, nef protein (nef)
           gene, complete cds
          Length = 621

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 339 acccacttcctcttcttctt 358
           ||||||||||||||||||||
Sbjct: 201 acccacttcctcttcttctt 182

---

>gb|AF064671.1|AF064671 HIV-1 patient 26 clone 26-P6 from Australia, nef protein (nef)
           gene, complete cds
          Length = 621

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 339 acccacttcctcttcttctt 358
           ||||||||||||||||||||
Sbjct: 201 acccacttcctcttcttctt 182

---

>gb|AF064670.1|AF064670 HIV-1 patient 26 clone 26-P4 from Australia, nef protein (nef)
           gene, complete cds
          Length = 621

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 339 acccacttcctcttcttctt 358
           ||||||||||||||||||||
Sbjct: 201 acccacttcctcttcttctt 182

---

>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica
          Length = 4224103

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 343     acttcctcttcttcttcggc 362
               ||||||||||||||||||||
Sbjct: 2535120 acttcctcttcttcttcggc 2535101

---

>gb|AF462775.1| HIV-1 isolate 93KBH7 from South Korea nef-like gene, complete
           sequence; and long terminal repeat, partial sequence
          Length = 798

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 339 acccacttcctcttcttctt 358
           ||||||||||||||||||||
Sbjct: 189 acccacttcctcttcttctt 170

---

>gb|U31867.1|RNU31867 Rattus norvegicus Tclone15 mRNA
          Length = 393

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 476 cttcctgggggccttggctt 495
           ||||||||||||||||||||
Sbjct: 255 cttcctgggggccttggctt 274

---

>gb|M18981.1|HUMCACYA Human prolactin receptor-associated protein (PRA) gene, complete
           cds
          Length = 470

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 476 cttcctgggggccttggctt 495
           ||||||||||||||||||||
Sbjct: 327 cttcctgggggccttggctt 346

---

>gb|J02763.1|HUMCACY Human calcyclin gene, complete cds
          Length = 3671

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 476  cttcctgggggccttggctt 495
            ||||||||||||||||||||
Sbjct: 2620 cttcctgggggccttggctt 2639

---

>gb|M37761.1|MUSCALC23 Mouse calcyclin mRNA, complete cds
          Length = 428

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 476 cttcctgggggccttggctt 495
           ||||||||||||||||||||
Sbjct: 291 cttcctgggggccttggctt 310

---

>gb|M14300.1|HUMGFI2A9 Human growth factor-inducible 2A9 gene, complete cds
          Length = 434

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 476 cttcctgggggccttggctt 495
           ||||||||||||||||||||
Sbjct: 290 cttcctgggggccttggctt 309

---

>dbj|D14030.1|APFHENE2 Avian parainfluenza virus type2 RNA for hemagglutinin-neuraminidase
          Length = 1899

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 254 caagtcacaagatcaagttg 273
           ||||||||||||||||||||
Sbjct: 56  caagtcacaagatcaagttg 37

---

>gb|U04815.1|HSU04815 Human protein kinase PITSLRE alpha 1 mRNA, complete cds
          Length = 1805

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 476 cttcctgggggccttggctt 495
           ||||||||||||||||||||
Sbjct: 125 cttcctgggggccttggctt 106


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,826,534
Number of Sequences: 3902068
Number of extensions: 5826534
Number of successful extensions: 127633
Number of sequences better than 10.0: 76
Number of HSP's better than 10.0 without gapping: 76
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 127317
Number of HSP's gapped (non-prelim): 316
length of query: 555
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 532
effective length of database: 17,143,297,704
effective search space: 9120234378528
effective search space used: 9120234378528
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---