| Clone Name | rbaal33a17 |
|---|---|
| Clone Library Name | barley_pub |
>gb|BT018920.1| Zea mays clone Contig21.F mRNA sequence Length = 931 Score = 54.0 bits (27), Expect = 5e-04 Identities = 30/31 (96%) Strand = Plus / Plus Query: 300 cgcagcctgcttgcgacgcagtcagggcttc 330 |||||||||||||||| |||||||||||||| Sbjct: 438 cgcagcctgcttgcgatgcagtcagggcttc 468
>ref|XM_600052.2| PREDICTED: Bos taurus similar to transmembrane protein 16F (LOC521784), mRNA Length = 3405 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 120 gccacatccatcactgcttccctca 144 ||||||||||||||||||||||||| Sbjct: 2176 gccacatccatcactgcttccctca 2200
>dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005 Length = 4429080 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 167 acaaccaacaaacccaaaacacacc 191 ||||||||||||||||||||||||| Sbjct: 3680040 acaaccaacaaacccaaaacacacc 3680064
>ref|XM_462221.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0G16676g) partial mRNA Length = 3801 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 341 ccacttcctcttcttcttcggctcc 365 ||||||| ||||||||||||||||| Sbjct: 76 ccacttcttcttcttcttcggctcc 52
>gb|AY659174.1| Synthetic construct Peudomonas aeruginosa clone FLH036934.01F PA0536 gene, partial cds Length = 1026 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 348 ctcttcttcttcggctccggc 368 ||||||||||||||||||||| Sbjct: 620 ctcttcttcttcggctccggc 600
>gb|BT012702.1| Lycopersicon esculentum clone 113577R, mRNA sequence Length = 1952 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 449 cttgcagaccacatcagcagt 469 ||||||||||||||||||||| Sbjct: 1041 cttgcagaccacatcagcagt 1021
>emb|CR382139.1| Debaryomyces hansenii chromosome G of strain CBS767 of Debaryomyces hansenii Length = 2051428 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 341 ccacttcctcttcttcttcggctcc 365 ||||||| ||||||||||||||||| Sbjct: 1277411 ccacttcttcttcttcttcggctcc 1277387
>gb|AC128039.4| Rattus norvegicus BAC CH230-394A24 (Children's Hospital Oakland Research Institute Rat (BN/SsNHsd/MCW) BAC library) complete sequence Length = 164278 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 167 acaaccaacaaacccaaaaca 187 ||||||||||||||||||||| Sbjct: 121583 acaaccaacaaacccaaaaca 121563
>gb|AE004490.1| Pseudomonas aeruginosa PAO1, section 51 of 529 of the complete genome Length = 11445 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 348 ctcttcttcttcggctccggc 368 ||||||||||||||||||||| Sbjct: 4823 ctcttcttcttcggctccggc 4843
>gb|AF484513.1| HIV-1 isolate 98UG57146 from Uganda, partial genome Length = 8768 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 339 acccacttcctcttcttcttc 359 ||||||||||||||||||||| Sbjct: 8162 acccacttcctcttcttcttc 8142
>dbj|AP006545.1| Homo sapiens genomic DNA, chromosome 8p11.21, clone: KB1836B05, complete sequence Length = 156888 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 339 acccacttcctcttcttcttc 359 ||||||||||||||||||||| Sbjct: 110842 acccacttcctcttcttcttc 110822
>gb|AC155338.1| Brassica rapa subsp. pekinensis chromosome Cytogenetic chromosome 1 clone KBrH138P04, complete sequence Length = 137697 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 339 acccacttcctcttcttcttc 359 ||||||||||||||||||||| Sbjct: 95960 acccacttcctcttcttcttc 95940
>gb|AC160552.13| Mus musculus chromosome 3, clone RP23-326D6, complete sequence Length = 210051 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 476 cttcctgggggccttggctt 495 |||||||||||||||||||| Sbjct: 173957 cttcctgggggccttggctt 173976
>ref|XM_483028.1| Oryza sativa (japonica cultivar-group), mRNA Length = 948 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 ccacttcctcttcttcttcg 360 |||||||||||||||||||| Sbjct: 469 ccacttcctcttcttcttcg 450
>ref|NM_053485.2| Rattus norvegicus S100 calcium binding protein A6 (calcyclin) (S100a6), mRNA Length = 402 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 476 cttcctgggggccttggctt 495 |||||||||||||||||||| Sbjct: 264 cttcctgggggccttggctt 283
>gb|AF140232.1| Rattus norvegicus calcium binding protein (S100A6) mRNA, complete cds Length = 402 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 476 cttcctgggggccttggctt 495 |||||||||||||||||||| Sbjct: 264 cttcctgggggccttggctt 283
>gb|AY159316.1| Homo sapiens lung cancer oncogene 7 mRNA, complete cds Length = 1616 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 476 cttcctgggggccttggctt 495 |||||||||||||||||||| Sbjct: 221 cttcctgggggccttggctt 202
>gb|BC009017.1| Homo sapiens S100 calcium binding protein A6 (calcyclin), mRNA (cDNA clone MGC:18233 IMAGE:4157026), complete cds Length = 679 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 476 cttcctgggggccttggctt 495 |||||||||||||||||||| Sbjct: 520 cttcctgggggccttggctt 539
>gb|AC168064.3| Mus musculus BAC clone RP23-182K16 from chromosome 14, complete sequence Length = 220900 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 173 aacaaacccaaaacacacca 192 |||||||||||||||||||| Sbjct: 34257 aacaaacccaaaacacacca 34276
>gb|AC128270.3| Rattus norvegicus 12 BAC CH230-48A22 (Children's Hospital Oakland Research Institute Rat (BN/SsNHsd/MCW) BAC library) complete sequence Length = 236843 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 124 catccatcactgcttccctc 143 |||||||||||||||||||| Sbjct: 154444 catccatcactgcttccctc 154425 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 124 catccatcactgcttccctc 143 |||||||||||||||||||| Sbjct: 154064 catccatcactgcttccctc 154045 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 124 catccatcactgcttccctc 143 |||||||||||||||||||| Sbjct: 153980 catccatcactgcttccctc 153961 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 124 catccatcactgcttccctc 143 |||||||||||||||||||| Sbjct: 153896 catccatcactgcttccctc 153877 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 124 catccatcactgcttccctc 143 |||||||||||||||||||| Sbjct: 153608 catccatcactgcttccctc 153589
>gb|BC001431.2| Homo sapiens S100 calcium binding protein A6 (calcyclin), mRNA (cDNA clone MGC:2187 IMAGE:3138609), complete cds Length = 506 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 476 cttcctgggggccttggctt 495 |||||||||||||||||||| Sbjct: 344 cttcctgggggccttggctt 363
>gb|BC010774.1| Mus musculus S100 calcium binding protein A6 (calcyclin), mRNA (cDNA clone MGC:18644 IMAGE:4219642), complete cds Length = 470 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 476 cttcctgggggccttggctt 495 |||||||||||||||||||| Sbjct: 307 cttcctgggggccttggctt 326
>ref|NM_011313.1| Mus musculus S100 calcium binding protein A6 (calcyclin) (S100a6), mRNA Length = 551 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 476 cttcctgggggccttggctt 495 |||||||||||||||||||| Sbjct: 384 cttcctgggggccttggctt 403
>gb|BC003832.1| Mus musculus S100 calcium binding protein A6 (calcyclin), mRNA (cDNA clone MGC:6260 IMAGE:3490662), complete cds Length = 499 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 476 cttcctgggggccttggctt 495 |||||||||||||||||||| Sbjct: 345 cttcctgggggccttggctt 364
>emb|CR848682.9| Zebrafish DNA sequence from clone CH211-286K10 in linkage group 9, complete sequence Length = 84943 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 173 aacaaacccaaaacacacca 192 |||||||||||||||||||| Sbjct: 52508 aacaaacccaaaacacacca 52527
>emb|CR538727.16| Zebrafish DNA sequence from clone DKEY-9G20 in linkage group 9, complete sequence Length = 155321 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 173 aacaaacccaaaacacacca 192 |||||||||||||||||||| Sbjct: 38534 aacaaacccaaaacacacca 38553
>gb|AC132330.5| Mus musculus BAC clone RP24-213O22 from chromosome 14, complete sequence Length = 178081 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 173 aacaaacccaaaacacacca 192 |||||||||||||||||||| Sbjct: 85124 aacaaacccaaaacacacca 85105
>gb|AF549497.1| Mus musculus MC3T3-E1 calcyclin mRNA, complete cds Length = 445 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 476 cttcctgggggccttggctt 495 |||||||||||||||||||| Sbjct: 290 cttcctgggggccttggctt 309
>emb|BX470102.12| Human DNA sequence from clone RP11-49N14 on chromosome 1 Contains the S100A6 gene for S100 calcium binding protein A6 (calcyclin), a novel gene, the S100A5 gene for S100 calcium binding protein A5, the S100A4 gene for S100 calcium binding protein A4 (calcium protein, calvasculin, metastasin, murine placental homolog), the S100A3 gene for S100 calcium binding protein A3, the S100A2 gene for S100 calcium binding protein A2, the S100A16 gene for S100 calcium binding protein A16, the S100A14 gene for S100 calcium binding protein A14, and the 3' end of the S100A13 gene for S100 calcium binding protein A13, complete sequence Length = 100590 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 476 cttcctgggggccttggctt 495 |||||||||||||||||||| Sbjct: 8842 cttcctgggggccttggctt 8823
>emb|AL592063.10| Human DNA sequence from clone RP11-575F9 on chromosome 1, complete sequence Length = 160396 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 393 tcctggtgacattccagaga 412 |||||||||||||||||||| Sbjct: 82964 tcctggtgacattccagaga 82983
>ref|XM_504224.1| Yarrowia lipolytica CLIB122, YALI0E21307g predicted mRNA Length = 1482 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 343 acttcctcttcttcttcggc 362 |||||||||||||||||||| Sbjct: 260 acttcctcttcttcttcggc 241
>ref|NM_014624.3| Homo sapiens S100 calcium binding protein A6 (calcyclin) (S100A6), mRNA Length = 683 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 476 cttcctgggggccttggctt 495 |||||||||||||||||||| Sbjct: 539 cttcctgggggccttggctt 558
>emb|X52278.1|MM5B10 Mouse 5B10 mRNA for calcyclin Length = 434 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 476 cttcctgggggccttggctt 495 |||||||||||||||||||| Sbjct: 300 cttcctgggggccttggctt 319
>emb|X66449.1|MMCALC M.musculus mRNA for calcyclin Length = 551 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 476 cttcctgggggccttggctt 495 |||||||||||||||||||| Sbjct: 384 cttcctgggggccttggctt 403
>emb|AJ132717.1|RNO132717 Rattus norvegicus mRNA for calcyclin Length = 291 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 476 cttcctgggggccttggctt 495 |||||||||||||||||||| Sbjct: 237 cttcctgggggccttggctt 256
>gb|BT007814.1| Synthetic construct Homo sapiens S100 calcium binding protein A6 (calcyclin) mRNA, partial cds Length = 273 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 476 cttcctgggggccttggctt 495 |||||||||||||||||||| Sbjct: 225 cttcctgggggccttggctt 244
>gb|BT006965.1| Homo sapiens S100 calcium binding protein A6 (calcyclin) mRNA, complete cds Length = 273 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 476 cttcctgggggccttggctt 495 |||||||||||||||||||| Sbjct: 225 cttcctgggggccttggctt 244
>emb|AL645844.18| Mouse DNA sequence from clone RP23-82B4 on chromosome 11 Contains a heat shock protein Hsp90 family pseudogene, complete sequence Length = 146832 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 85 ccacaacaaaatgatagcaa 104 |||||||||||||||||||| Sbjct: 17212 ccacaacaaaatgatagcaa 17193
>emb|BX548160.13| Zebrafish DNA sequence from clone DKEY-25G11 in linkage group 11, complete sequence Length = 237930 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 177 aacccaaaacacaccaccaa 196 |||||||||||||||||||| Sbjct: 236729 aacccaaaacacaccaccaa 236710
>gb|AC105350.2| Drosophila melanogaster X BAC RP98-30C13 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 184334 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 344 cttcctcttcttcttcggct 363 |||||||||||||||||||| Sbjct: 36788 cttcctcttcttcttcggct 36807
>gb|AC148584.23| Gasterosteus aculeatus clone ch213-278g3, complete sequence Length = 169579 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 127 ccatcactgcttccctcaat 146 |||||||||||||||||||| Sbjct: 71009 ccatcactgcttccctcaat 70990
>gb|AC015724.9| Homo sapiens chromosome 17, clone RP11-45J24, complete sequence Length = 189055 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 124 catccatcactgcttccctc 143 |||||||||||||||||||| Sbjct: 85299 catccatcactgcttccctc 85318
>dbj|AK151587.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830031P06 product:S100 calcium binding protein A6 (calcyclin), full insert sequence Length = 429 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 476 cttcctgggggccttggctt 495 |||||||||||||||||||| Sbjct: 293 cttcctgggggccttggctt 312
>dbj|AK150408.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830006O04 product:S100 calcium binding protein A6 (calcyclin), full insert sequence Length = 430 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 476 cttcctgggggccttggctt 495 |||||||||||||||||||| Sbjct: 293 cttcctgggggccttggctt 312
>dbj|AK151144.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830026A04 product:S100 calcium binding protein A6 (calcyclin), full insert sequence Length = 430 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 476 cttcctgggggccttggctt 495 |||||||||||||||||||| Sbjct: 293 cttcctgggggccttggctt 312
>gb|AF422844.1|AF422844 Yucaipa virus F protein and HN protein genes, complete cds Length = 3615 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 254 caagtcacaagatcaagttg 273 |||||||||||||||||||| Sbjct: 1772 caagtcacaagatcaagttg 1753
>dbj|AK008941.1| Mus musculus adult male stomach cDNA, RIKEN full-length enriched library, clone:2210415I10 product:S100 calcium binding protein A6 (calcyclin), full insert sequence Length = 430 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 476 cttcctgggggccttggctt 495 |||||||||||||||||||| Sbjct: 293 cttcctgggggccttggctt 312
>gb|AY034480.1| Homo sapiens S100 calcium-binding protein A6 gene, complete cds Length = 274 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 476 cttcctgggggccttggctt 495 |||||||||||||||||||| Sbjct: 225 cttcctgggggccttggctt 244
>dbj|AK008241.1| Mus musculus adult male small intestine cDNA, RIKEN full-length enriched library, clone:2010015A02 product:S100 calcium binding protein A6 (calcyclin), full insert sequence Length = 430 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 476 cttcctgggggccttggctt 495 |||||||||||||||||||| Sbjct: 293 cttcctgggggccttggctt 312
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 ccacttcctcttcttcttcg 360 |||||||||||||||||||| Sbjct: 23944994 ccacttcctcttcttcttcg 23944975
>gb|AC010890.9| Homo sapiens BAC clone RP11-449L24 from 2, complete sequence Length = 62764 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 111 accacaccagccacatccatcact 134 |||||||||||| ||||||||||| Sbjct: 4224 accacaccagcctcatccatcact 4247
>gb|AF252955.1|AF252955 HIV-1 isolate 07c02 from USA nef protein (nef) gene, complete cds Length = 621 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 339 acccacttcctcttcttctt 358 |||||||||||||||||||| Sbjct: 201 acccacttcctcttcttctt 182
>emb|BX088527.5| Zebrafish DNA sequence from clone DKEY-200F8 in linkage group 1, complete sequence Length = 148904 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 1 catttttgataaatagacaa 20 |||||||||||||||||||| Sbjct: 125180 catttttgataaatagacaa 125199
>gb|AY891800.1| Synthetic construct Homo sapiens clone FLH110757.01L S100 calcium binding protein A6 (S100A6) mRNA, partial cds Length = 273 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 476 cttcctgggggccttggctt 495 |||||||||||||||||||| Sbjct: 225 cttcctgggggccttggctt 244
>gb|AY891799.1| Synthetic construct Homo sapiens clone FLH110756.01L S100 calcium binding protein A6 (S100A6) mRNA, partial cds Length = 273 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 476 cttcctgggggccttggctt 495 |||||||||||||||||||| Sbjct: 225 cttcctgggggccttggctt 244
>gb|AY889312.1| Synthetic construct Homo sapiens clone FLH110761.01X S100 calcium binding protein A6 (S100A6) mRNA, complete cds Length = 273 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 476 cttcctgggggccttggctt 495 |||||||||||||||||||| Sbjct: 225 cttcctgggggccttggctt 244
>gb|AY889311.1| Synthetic construct Homo sapiens clone FLH110760.01X S100 calcium binding protein A6 (S100A6) mRNA, complete cds Length = 273 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 476 cttcctgggggccttggctt 495 |||||||||||||||||||| Sbjct: 225 cttcctgggggccttggctt 244
>emb|AL929559.12| Zebrafish DNA sequence from clone CH211-106G5 in linkage group 1, complete sequence Length = 163933 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 178 acccaaaacacaccaccaac 197 |||||||||||||||||||| Sbjct: 66997 acccaaaacacaccaccaac 66978
>dbj|AP005918.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0419H09 Length = 143533 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 ccacttcctcttcttcttcg 360 |||||||||||||||||||| Sbjct: 78145 ccacttcctcttcttcttcg 78126
>gb|AF484515.1| HIV-1 isolate 99UGE13613 from Uganda, partial genome Length = 8774 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 339 acccacttcctcttcttctt 358 |||||||||||||||||||| Sbjct: 8171 acccacttcctcttcttctt 8152
>gb|AE003446.4| Drosophila melanogaster chromosome X, section 30 of 74 of the complete sequence Length = 290970 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 344 cttcctcttcttcttcggct 363 |||||||||||||||||||| Sbjct: 286933 cttcctcttcttcttcggct 286914
>gb|AC005553.1|AC005553 Homo sapiens chromosome 17, clone hRPK.112_J_9, complete sequence Length = 179651 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 124 catccatcactgcttccctc 143 |||||||||||||||||||| Sbjct: 169920 catccatcactgcttccctc 169939
>emb|AL845274.17| Mouse DNA sequence from clone RP23-146F24 on chromosome 2, complete sequence Length = 230151 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 411 gaatcaaatgtcaccccgga 430 |||||||||||||||||||| Sbjct: 181874 gaatcaaatgtcaccccgga 181855
>gb|AE009442.1| Xylella fastidiosa Temecula1, complete genome Length = 2519802 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 485 ggccttggcttcatccttga 504 |||||||||||||||||||| Sbjct: 2460940 ggccttggcttcatccttga 2460959
>gb|AF064672.1|AF064672 HIV-1 patient 26 clone 26-P7 from Australia, nef protein (nef) gene, complete cds Length = 621 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 339 acccacttcctcttcttctt 358 |||||||||||||||||||| Sbjct: 201 acccacttcctcttcttctt 182
>gb|AF064671.1|AF064671 HIV-1 patient 26 clone 26-P6 from Australia, nef protein (nef) gene, complete cds Length = 621 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 339 acccacttcctcttcttctt 358 |||||||||||||||||||| Sbjct: 201 acccacttcctcttcttctt 182
>gb|AF064670.1|AF064670 HIV-1 patient 26 clone 26-P4 from Australia, nef protein (nef) gene, complete cds Length = 621 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 339 acccacttcctcttcttctt 358 |||||||||||||||||||| Sbjct: 201 acccacttcctcttcttctt 182
>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica Length = 4224103 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 343 acttcctcttcttcttcggc 362 |||||||||||||||||||| Sbjct: 2535120 acttcctcttcttcttcggc 2535101
>gb|AF462775.1| HIV-1 isolate 93KBH7 from South Korea nef-like gene, complete sequence; and long terminal repeat, partial sequence Length = 798 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 339 acccacttcctcttcttctt 358 |||||||||||||||||||| Sbjct: 189 acccacttcctcttcttctt 170
>gb|U31867.1|RNU31867 Rattus norvegicus Tclone15 mRNA Length = 393 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 476 cttcctgggggccttggctt 495 |||||||||||||||||||| Sbjct: 255 cttcctgggggccttggctt 274
>gb|M18981.1|HUMCACYA Human prolactin receptor-associated protein (PRA) gene, complete cds Length = 470 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 476 cttcctgggggccttggctt 495 |||||||||||||||||||| Sbjct: 327 cttcctgggggccttggctt 346
>gb|J02763.1|HUMCACY Human calcyclin gene, complete cds Length = 3671 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 476 cttcctgggggccttggctt 495 |||||||||||||||||||| Sbjct: 2620 cttcctgggggccttggctt 2639
>gb|M37761.1|MUSCALC23 Mouse calcyclin mRNA, complete cds Length = 428 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 476 cttcctgggggccttggctt 495 |||||||||||||||||||| Sbjct: 291 cttcctgggggccttggctt 310
>gb|M14300.1|HUMGFI2A9 Human growth factor-inducible 2A9 gene, complete cds Length = 434 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 476 cttcctgggggccttggctt 495 |||||||||||||||||||| Sbjct: 290 cttcctgggggccttggctt 309
>dbj|D14030.1|APFHENE2 Avian parainfluenza virus type2 RNA for hemagglutinin-neuraminidase Length = 1899 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 254 caagtcacaagatcaagttg 273 |||||||||||||||||||| Sbjct: 56 caagtcacaagatcaagttg 37
>gb|U04815.1|HSU04815 Human protein kinase PITSLRE alpha 1 mRNA, complete cds Length = 1805 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 476 cttcctgggggccttggctt 495 |||||||||||||||||||| Sbjct: 125 cttcctgggggccttggctt 106 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,826,534 Number of Sequences: 3902068 Number of extensions: 5826534 Number of successful extensions: 127633 Number of sequences better than 10.0: 76 Number of HSP's better than 10.0 without gapping: 76 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 127317 Number of HSP's gapped (non-prelim): 316 length of query: 555 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 532 effective length of database: 17,143,297,704 effective search space: 9120234378528 effective search space used: 9120234378528 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)