ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal31p15
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_482160.1| Oryza sativa (japonica cultivar-group), mRNA 182 9e-43
2dbj|AK058827.1| Oryza sativa (japonica cultivar-group) cDNA clon... 182 9e-43
3dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 135 2e-28
4dbj|AP004689.3| Oryza sativa (japonica cultivar-group) genomic D... 135 2e-28
5emb|AL158070.11| Human DNA sequence from clone RP11-235C23 on ch... 50 0.009
6dbj|AB038490.1| Homo sapiens gene for fukutin, complete cds 50 0.009
7emb|AL935046.6| Zebrafish DNA sequence from clone CH211-171K3, c... 46 0.14
8gb|AC102248.19| Mus musculus chromosome 18, clone RP24-158I9, co... 44 0.53
9emb|BX324164.15| Zebrafish DNA sequence from clone DKEY-14D8 in ... 44 0.53
10gb|AC093430.3| Homo sapiens chromosome 1 clone RP11-171B15, comp... 44 0.53
11ref|XM_681341.1| PREDICTED: Danio rerio similar to vascular endo... 44 0.53
12ref|XM_744953.1| Aspergillus fumigatus Af293 hypothetical protei... 42 2.1
13gb|AC146854.19| Medicago truncatula clone mth2-10i14, complete s... 42 2.1
14emb|AL391883.17| Human DNA sequence from clone RP11-91K11 on chr... 42 2.1
15gb|AC093601.4| Homo sapiens BAC clone RP11-338P22 from 4, comple... 42 2.1
16gb|AC009466.17|AC009466 Homo sapiens chromosome 11, clone RP11-8... 42 2.1
17gb|AC117440.5| Homo sapiens 3 BAC RP11-575C1 (Roswell Park Cance... 42 2.1
18dbj|AP002840.3| Homo sapiens genomic DNA, chromosome 11 clone:RP... 42 2.1
19dbj|AK027161.1| Homo sapiens cDNA: FLJ23508 fis, clone LNG03158 42 2.1
20dbj|AP000880.4| Homo sapiens genomic DNA, chromosome 11q, clone:... 42 2.1
21gb|AC151762.1| Ornithorhynchus anatinus chromosome UNK clone OAB... 40 8.3
22gb|AC111071.8| Mus musculus chromosome 15, clone RP24-298N6, com... 40 8.3
23gb|AC108853.7| Mus musculus chromosome 8, clone RP24-87L12, comp... 40 8.3
24gb|AY253316.1| HIV-1 isolate 01TZA387 from Tanzania gag protein ... 40 8.3
25ref|NM_001007701.1| Rattus norvegicus translocation associated m... 40 8.3
26gb|AC146037.1| Pan troglodytes BAC clone RP43-44A5 from 7, compl... 40 8.3
27gb|AC137511.3| Mus musculus BAC clone RP24-313I8 from chromosome... 40 8.3
28emb|AL731765.5| Human DNA sequence from clone RP11-268L7 on chro... 40 8.3
29emb|AL008639.15|HS9E21 Human DNA sequence from clone RP1-9E21 on... 40 8.3
30gb|AC090132.3| Homo sapiens chromosome 8, clone RP11-813B8, comp... 40 8.3
31gb|U80843.2| Caenorhabditis elegans cosmid C32B5, complete sequence 40 8.3
32ref|NM_001009467.1| Ovis aries 6-phosphogluconate dehydrogenase ... 40 8.3
33gb|AC016766.6| Homo sapiens BAC clone RP11-558I6 from 2, complet... 40 8.3
34gb|AC149286.4| Pan troglodytes BAC clone CH251-514L10 from chrom... 40 8.3
35gb|AC157654.2| Mus musculus BAC clone RP24-286J10 from chromosom... 40 8.3
36gb|AC084624.1|CBRG45A12 Caenorhabditis briggsae cosmid G45A12, c... 40 8.3
37gb|AC019159.8| Homo sapiens BAC clone RP11-56O18 from 2, complet... 40 8.3
38emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple... 40 8.3
39gb|BC083851.1| Rattus norvegicus translocation associated membra... 40 8.3
40gb|AC133169.3| Mus musculus BAC clone RP24-259I15 from 9, comple... 40 8.3
41emb|X60195.1|OA6PDGH Ovine 6-pgdh mRNA for 6-phosphogluconate de... 40 8.3
42emb|AL672307.9| Mouse DNA sequence from clone RP23-141N2 on chro... 40 8.3
43emb|AL837521.6| Mouse DNA sequence from clone RP23-28I8 on chrom... 40 8.3
44gb|AC125613.2| Homo sapiens 3 BAC RP11-379M20 (Roswell Park Canc... 40 8.3

>ref|XM_482160.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1345

 Score =  182 bits (92), Expect = 9e-43
 Identities = 182/212 (85%)
 Strand = Plus / Minus

                                                                       
Query: 401 gtttctccctttcttctgtctccttgagtagaaagtccacccagagatctgcaaaggact 460
           |||| ||||||||||| ||||| ||||| || ||||||||||| ||||| ||||| ||||
Sbjct: 903 gtttttccctttcttccgtctctttgagcaggaagtccacccatagatccgcaaatgact 844

                                                                       
Query: 461 ggttatcctggggtgtatgtgtagatttgcctgctgaatttccaccaacaattcctccaa 520
           |||| ||||| | ||  || |||| |||||||||||||||||| |||||||| |||||||
Sbjct: 843 ggttgtcctgagatgcttgagtaggtttgcctgctgaatttccgccaacaatgcctccaa 784

                                                                       
Query: 521 ctaggcgcccaggaagacccaaaacaccgcggacaacaaccttaccaacattgctctgtg 580
           ||| ||| || ||||||||||||||||| ||||||||| |||| ||| |||| || ||||
Sbjct: 783 ctaagcgtcctggaagacccaaaacaccccggacaacacccttgccagcattactttgtg 724

                                           
Query: 581 cagaaccgattctttgcttgtcctcctcagag 612
           || |||| || ||||||||||| |||||||||
Sbjct: 723 caaaaccaatcctttgcttgtcttcctcagag 692



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 105  acattgtcaacaaatgaaataaatagct 132
            |||||||||||||||||||  |||||||
Sbjct: 1216 acattgtcaacaaatgaaacgaatagct 1189



to top

>dbj|AK058827.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-003-H08, full
           insert sequence
          Length = 1346

 Score =  182 bits (92), Expect = 9e-43
 Identities = 182/212 (85%)
 Strand = Plus / Minus

                                                                       
Query: 401 gtttctccctttcttctgtctccttgagtagaaagtccacccagagatctgcaaaggact 460
           |||| ||||||||||| ||||| ||||| || ||||||||||| ||||| ||||| ||||
Sbjct: 903 gtttttccctttcttccgtctctttgagcaggaagtccacccatagatccgcaaatgact 844

                                                                       
Query: 461 ggttatcctggggtgtatgtgtagatttgcctgctgaatttccaccaacaattcctccaa 520
           |||| ||||| | ||  || |||| |||||||||||||||||| |||||||| |||||||
Sbjct: 843 ggttgtcctgagatgcttgagtaggtttgcctgctgaatttccgccaacaatgcctccaa 784

                                                                       
Query: 521 ctaggcgcccaggaagacccaaaacaccgcggacaacaaccttaccaacattgctctgtg 580
           ||| ||| || ||||||||||||||||| ||||||||| |||| ||| |||| || ||||
Sbjct: 783 ctaagcgtcctggaagacccaaaacaccccggacaacacccttgccagcattactttgtg 724

                                           
Query: 581 cagaaccgattctttgcttgtcctcctcagag 612
           || |||| || ||||||||||| |||||||||
Sbjct: 723 caaaaccaatcctttgcttgtcttcctcagag 692



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 105  acattgtcaacaaatgaaataaatagct 132
            |||||||||||||||||||  |||||||
Sbjct: 1216 acattgtcaacaaatgaaacgaatagct 1189



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score =  135 bits (68), Expect = 2e-28
 Identities = 116/132 (87%)
 Strand = Plus / Minus

                                                                            
Query: 481      gtagatttgcctgctgaatttccaccaacaattcctccaactaggcgcccaggaagaccc 540
                |||| |||||||||||||||||| |||||||| |||||||||| ||| || |||||||||
Sbjct: 18261481 gtaggtttgcctgctgaatttccgccaacaatgcctccaactaagcgtcctggaagaccc 18261422

                                                                            
Query: 541      aaaacaccgcggacaacaaccttaccaacattgctctgtgcagaaccgattctttgcttg 600
                |||||||| ||||||||| |||| ||| |||| || |||||| |||| || |||||||||
Sbjct: 18261421 aaaacaccccggacaacacccttgccagcattactttgtgcaaaaccaatcctttgcttg 18261362

                            
Query: 601      tcctcctcagag 612
                || |||||||||
Sbjct: 18261361 tcttcctcagag 18261350



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                            
Query: 401      gtttctccctttcttctgtctccttgagtagaaagtccacccagagatctgcaaaggact 460
                |||| ||||||||||| ||||| ||||| || ||||||||||| ||||| ||||| ||||
Sbjct: 18261758 gtttttccctttcttccgtctctttgagcaggaagtccacccatagatccgcaaatgact 18261699

                 
Query: 461      g 461
                |
Sbjct: 18261698 g 18261698



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 105      acattgtcaacaaatgaaataaatagct 132
                |||||||||||||||||||  |||||||
Sbjct: 18262071 acattgtcaacaaatgaaacgaatagct 18262044



to top

>dbj|AP004689.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0434E03
          Length = 142414

 Score =  135 bits (68), Expect = 2e-28
 Identities = 116/132 (87%)
 Strand = Plus / Minus

                                                                         
Query: 481   gtagatttgcctgctgaatttccaccaacaattcctccaactaggcgcccaggaagaccc 540
             |||| |||||||||||||||||| |||||||| |||||||||| ||| || |||||||||
Sbjct: 83793 gtaggtttgcctgctgaatttccgccaacaatgcctccaactaagcgtcctggaagaccc 83734

                                                                         
Query: 541   aaaacaccgcggacaacaaccttaccaacattgctctgtgcagaaccgattctttgcttg 600
             |||||||| ||||||||| |||| ||| |||| || |||||| |||| || |||||||||
Sbjct: 83733 aaaacaccccggacaacacccttgccagcattactttgtgcaaaaccaatcctttgcttg 83674

                         
Query: 601   tcctcctcagag 612
             || |||||||||
Sbjct: 83673 tcttcctcagag 83662



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                         
Query: 401   gtttctccctttcttctgtctccttgagtagaaagtccacccagagatctgcaaaggact 460
             |||| ||||||||||| ||||| ||||| || ||||||||||| ||||| ||||| ||||
Sbjct: 84070 gtttttccctttcttccgtctctttgagcaggaagtccacccatagatccgcaaatgact 84011

              
Query: 461   g 461
             |
Sbjct: 84010 g 84010



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 105   acattgtcaacaaatgaaataaatagct 132
             |||||||||||||||||||  |||||||
Sbjct: 84383 acattgtcaacaaatgaaacgaatagct 84356



to top

>emb|AL158070.11| Human DNA sequence from clone RP11-235C23 on chromosome 9q31.1-31.3
             Contains part of a pseudogene similar to KIAA1272,
             KIAA0884, Drosophila CG5521 and rat Tulip 1 and 2
             proteins, the 3' end of the CSDUFD1 gene for cystatin and
             DUF19 domain containing 1, a novel gene, the FCMD gene for
             Fukuyama type congenital muscular dystrophy protein, the
             TAL2 gene for T-cell acute lymphocytic leukemia 2 protein
             and two CpG islands, complete sequence
          Length = 167005

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 163   aaaaaagtcatccagcaatatatac 187
             |||||||||||||||||||||||||
Sbjct: 33147 aaaaaagtcatccagcaatatatac 33171



to top

>dbj|AB038490.1| Homo sapiens gene for fukutin, complete cds
          Length = 131892

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 163   aaaaaagtcatccagcaatatatac 187
             |||||||||||||||||||||||||
Sbjct: 29719 aaaaaagtcatccagcaatatatac 29743



to top

>emb|AL935046.6| Zebrafish DNA sequence from clone CH211-171K3, complete sequence
          Length = 162239

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 401    gtttctccctttcttctgtctcc 423
              |||||||||||||||||||||||
Sbjct: 112548 gtttctccctttcttctgtctcc 112526



to top

>gb|AC102248.19| Mus musculus chromosome 18, clone RP24-158I9, complete sequence
          Length = 206000

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 460   tggttatcctggggtgtatgtg 481
             ||||||||||||||||||||||
Sbjct: 97795 tggttatcctggggtgtatgtg 97774



to top

>emb|BX324164.15| Zebrafish DNA sequence from clone DKEY-14D8 in linkage group 4 Contains
             the gene for a novel protein similar to vertebrate
             selenoprotein family, the gene for a novel protein similar
             to vertebrate vascular endothelial growth factor (VEGF),
             the gene for a novel protein similar to vertebrate
             mitogen-activated protein kinase family, the gene for a
             novel protein similar to vertebrate mitogen-activated
             protein kinase family, the gene for a novel protein
             similar to vertebrate scavenger receptor protein, two
             genes for novel proteins similar to vertebrate protein
             deleted in malignant brain tumors 1, fifteen novel genes
             and three CpG islands, complete sequence
          Length = 264155

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 490   cctgctgaatttccaccaacaattcc 515
             ||||||||||||||||||||| ||||
Sbjct: 28276 cctgctgaatttccaccaacatttcc 28251



to top

>gb|AC093430.3| Homo sapiens chromosome 1 clone RP11-171B15, complete sequence
          Length = 153414

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 121   aaataaatagctcaaggccaggcaca 146
             ||||||||| ||||||||||||||||
Sbjct: 92495 aaataaatacctcaaggccaggcaca 92470



to top

>ref|XM_681341.1| PREDICTED: Danio rerio similar to vascular endothelial growth
           factor (LOC558154), mRNA
          Length = 1675

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 490 cctgctgaatttccaccaacaattcc 515
           ||||||||||||||||||||| ||||
Sbjct: 860 cctgctgaatttccaccaacatttcc 835



to top

>ref|XM_744953.1| Aspergillus fumigatus Af293 hypothetical protein (Afu1g02960)
           partial mRNA
          Length = 636

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 569 cattgctctgtgcagaaccga 589
           |||||||||||||||||||||
Sbjct: 39  cattgctctgtgcagaaccga 59



to top

>gb|AC146854.19| Medicago truncatula clone mth2-10i14, complete sequence
          Length = 116179

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 502   ccaccaacaattcctccaact 522
             |||||||||||||||||||||
Sbjct: 11476 ccaccaacaattcctccaact 11456



to top

>emb|AL391883.17| Human DNA sequence from clone RP11-91K11 on chromosome 1 Contains the
             5' end of the gene for a novel protein (LOC255104), the
             gene for a novel protein (FLJ20225), a novel gene and the
             5' end of the gene for a novel protein (KIAA0459),
             complete sequence
          Length = 126371

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 406   tccctttcttctgtctccttg 426
             |||||||||||||||||||||
Sbjct: 37945 tccctttcttctgtctccttg 37925



to top

>gb|AC093601.4| Homo sapiens BAC clone RP11-338P22 from 4, complete sequence
          Length = 118129

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 405    ctccctttcttctgtctcctt 425
              |||||||||||||||||||||
Sbjct: 105913 ctccctttcttctgtctcctt 105893



to top

>gb|AC009466.17|AC009466 Homo sapiens chromosome 11, clone RP11-87N22, complete sequence
          Length = 193279

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 155    ttaaaaggaaaaaagtcatccagca 179
              ||||||||||| |||||||||||||
Sbjct: 175601 ttaaaaggaaataagtcatccagca 175577



to top

>gb|AC117440.5| Homo sapiens 3 BAC RP11-575C1 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 199386

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 148   gtaagacttaaaaggaaaaaa 168
             |||||||||||||||||||||
Sbjct: 53486 gtaagacttaaaaggaaaaaa 53466



to top

>dbj|AP002840.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-159N11, complete
            sequence
          Length = 177031

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 155  ttaaaaggaaaaaagtcatccagca 179
            ||||||||||| |||||||||||||
Sbjct: 6813 ttaaaaggaaataagtcatccagca 6789



to top

>dbj|AK027161.1| Homo sapiens cDNA: FLJ23508 fis, clone LNG03158
          Length = 1797

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 155 ttaaaaggaaaaaagtcatccagca 179
           ||||||||||| |||||||||||||
Sbjct: 713 ttaaaaggaaataagtcatccagca 689



to top

>dbj|AP000880.4| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-839D17, complete
              sequence
          Length = 171853

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 155    ttaaaaggaaaaaagtcatccagca 179
              ||||||||||| |||||||||||||
Sbjct: 158997 ttaaaaggaaataagtcatccagca 158973



to top

>gb|AC151762.1| Ornithorhynchus anatinus chromosome UNK clone OABb-451A1, complete
              sequence
          Length = 160077

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     catttacatatttccttaga 53
              ||||||||||||||||||||
Sbjct: 122950 catttacatatttccttaga 122969



to top

>gb|AC111071.8| Mus musculus chromosome 15, clone RP24-298N6, complete sequence
          Length = 157812

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 403   ttctccctttcttctgtctc 422
             ||||||||||||||||||||
Sbjct: 87236 ttctccctttcttctgtctc 87255



to top

>gb|AC108853.7| Mus musculus chromosome 8, clone RP24-87L12, complete sequence
          Length = 171410

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 404   tctccctttcttctgtctcc 423
             ||||||||||||||||||||
Sbjct: 91653 tctccctttcttctgtctcc 91634



to top

>gb|AY253316.1| HIV-1 isolate 01TZA387 from Tanzania gag protein (gag) and pol
            protein (pol) genes, partial cds; and vif protein (vif),
            vpr protein (vpr), tat protein (tat), rev protein (rev),
            vpu protein (vpu), envelope glycoprotein (env), and nef
            protein (nef) genes, complete cds
          Length = 8771

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 498  atttccaccaacaattcctc 517
            ||||||||||||||||||||
Sbjct: 5462 atttccaccaacaattcctc 5443



to top

>ref|NM_001007701.1| Rattus norvegicus translocation associated membrane protein 1
            (Tram1), mRNA
          Length = 2778

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 327  tgcttgtaaatttgatgcac 346
            ||||||||||||||||||||
Sbjct: 2095 tgcttgtaaatttgatgcac 2114



to top

>gb|AC146037.1| Pan troglodytes BAC clone RP43-44A5 from 7, complete sequence
          Length = 177637

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 127   atagctcaaggccaggcaca 146
             ||||||||||||||||||||
Sbjct: 95922 atagctcaaggccaggcaca 95903



to top

>gb|AC137511.3| Mus musculus BAC clone RP24-313I8 from chromosome 5, complete sequence
          Length = 168197

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 467    cctggggtgtatgtgtagat 486
              ||||||||||||||||||||
Sbjct: 103205 cctggggtgtatgtgtagat 103186



to top

>emb|AL731765.5| Human DNA sequence from clone RP11-268L7 on chromosome X, complete
             sequence
          Length = 64790

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   gtctgtgtggatgtatatat 230
             ||||||||||||||||||||
Sbjct: 38127 gtctgtgtggatgtatatat 38108



to top

>emb|AL008639.15|HS9E21 Human DNA sequence from clone RP1-9E21 on chromosome 1q24-25 Contains
             the 3' end of a pseudogene similar to flavin-containing
             monooxygenase proteins, a calponin 2 (CNN2) pseudogene,
             the POGK gene for pogo transposable element with KRAB
             domain, the 3' end of the gene for SPT3-associated factor
             42 (STAF42) and a CpG island, complete sequence
          Length = 106977

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 137   gccaggcacatgtaagacttaaaa 160
             |||||||||||| |||||||||||
Sbjct: 44132 gccaggcacatgcaagacttaaaa 44109



to top

>gb|AC090132.3| Homo sapiens chromosome 8, clone RP11-813B8, complete sequence
          Length = 205004

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 105    acattgtcaacaaatgaaataaat 128
              ||||| ||||||||||||||||||
Sbjct: 181596 acattatcaacaaatgaaataaat 181619



to top

>gb|U80843.2| Caenorhabditis elegans cosmid C32B5, complete sequence
          Length = 42645

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 495  tgaatttccaccaacaattc 514
            ||||||||||||||||||||
Sbjct: 9267 tgaatttccaccaacaattc 9286



to top

>ref|NM_001009467.1| Ovis aries 6-phosphogluconate dehydrogenase (decarboxylating)
            (6-PGDH), mRNA
          Length = 1918

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 163  aaaaaagtcatccagcaata 182
            ||||||||||||||||||||
Sbjct: 1255 aaaaaagtcatccagcaata 1236



to top

>gb|AC016766.6| Homo sapiens BAC clone RP11-558I6 from 2, complete sequence
          Length = 194374

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 162   gaaaaaagtcatccagcaatatat 185
             ||||||| ||||||||||||||||
Sbjct: 36140 gaaaaaactcatccagcaatatat 36117



to top

>gb|AC149286.4| Pan troglodytes BAC clone CH251-514L10 from chromosome 7, complete
              sequence
          Length = 180713

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 127    atagctcaaggccaggcaca 146
              ||||||||||||||||||||
Sbjct: 129983 atagctcaaggccaggcaca 130002



to top

>gb|AC157654.2| Mus musculus BAC clone RP24-286J10 from chromosome 13, complete
             sequence
          Length = 152221

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 102   accacattgtcaacaaatga 121
             ||||||||||||||||||||
Sbjct: 89665 accacattgtcaacaaatga 89646



to top

>gb|AC084624.1|CBRG45A12 Caenorhabditis briggsae cosmid G45A12, complete sequence
          Length = 37586

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 74    gaccaaaaactttgaatgga 93
             ||||||||||||||||||||
Sbjct: 14859 gaccaaaaactttgaatgga 14840



to top

>gb|AC019159.8| Homo sapiens BAC clone RP11-56O18 from 2, complete sequence
          Length = 163085

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 296    tggaaaggccaggatttgca 315
              ||||||||||||||||||||
Sbjct: 132921 tggaaaggccaggatttgca 132902



to top

>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence
          Length = 3716413

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 536     gacccaaaacaccgcggaca 555
               ||||||||||||||||||||
Sbjct: 1108370 gacccaaaacaccgcggaca 1108351



to top

>gb|BC083851.1| Rattus norvegicus translocation associated membrane protein 1, mRNA
            (cDNA clone MGC:95042 IMAGE:7123274), complete cds
          Length = 2778

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 327  tgcttgtaaatttgatgcac 346
            ||||||||||||||||||||
Sbjct: 2095 tgcttgtaaatttgatgcac 2114



to top

>gb|AC133169.3| Mus musculus BAC clone RP24-259I15 from 9, complete sequence
          Length = 163930

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 405   ctccctttcttctgtctcct 424
             ||||||||||||||||||||
Sbjct: 84464 ctccctttcttctgtctcct 84483



to top

>emb|X60195.1|OA6PDGH Ovine 6-pgdh mRNA for 6-phosphogluconate dehydrogenase
          Length = 1953

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 163  aaaaaagtcatccagcaata 182
            ||||||||||||||||||||
Sbjct: 1255 aaaaaagtcatccagcaata 1236



to top

>emb|AL672307.9| Mouse DNA sequence from clone RP23-141N2 on chromosome 2, complete
              sequence
          Length = 206168

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 406    tccctttcttctgtctccttgagt 429
              ||||| ||||||||||||||||||
Sbjct: 140229 tccctctcttctgtctccttgagt 140206



to top

>emb|AL837521.6| Mouse DNA sequence from clone RP23-28I8 on chromosome 4, complete
              sequence
          Length = 230493

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 207    atgcgtctgtgtggatgtat 226
              ||||||||||||||||||||
Sbjct: 139049 atgcgtctgtgtggatgtat 139068



to top

>gb|AC125613.2| Homo sapiens 3 BAC RP11-379M20 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 78087

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 395   ctttttgtttctccctttcttctgtctc 422
             |||||| ||||| |||||||||||||||
Sbjct: 21374 ctttttctttcttcctttcttctgtctc 21347


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7,519,436
Number of Sequences: 3902068
Number of extensions: 7519436
Number of successful extensions: 158936
Number of sequences better than 10.0: 44
Number of HSP's better than 10.0 without gapping: 44
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 158774
Number of HSP's gapped (non-prelim): 162
length of query: 613
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 590
effective length of database: 17,143,297,704
effective search space: 10114545645360
effective search space used: 10114545645360
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top