>emb|AL590080.25| Human DNA sequence from clone RP11-469M1 on chromosome 10 Contains the
              HHEX gene for hematopoietically expressed homeobox, the 5'
              end of the gene for SEC15 (S. cerevisiae)-like (SEC15L), a
              eukaryotic translation initiation factor 2 subunit 2
              (eIF-2-beta) pseudogene and four CpG islands, complete
              sequence
          Length = 190144

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 78     cttgacatctacatgtaaac 97
              ||||||||||||||||||||
Sbjct: 112015 cttgacatctacatgtaaac 111996

>gb|AC018478.4| Drosophila melanogaster, chromosome 4, region 101F-102F, BAC clone
             BACH57F14, complete sequence
          Length = 103809

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 65    cttatagagcaaacttgaca 84
             ||||||||||||||||||||
Sbjct: 86851 cttatagagcaaacttgaca 86832

>gb|AC010668.7| Drosophila melanogaster, chromosome 4, region 101F-102F, BAC clone
             BACR44L03, complete sequence
          Length = 172190

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 65    cttatagagcaaacttgaca 84
             ||||||||||||||||||||
Sbjct: 26641 cttatagagcaaacttgaca 26622

>gb|AE003843.5| Drosophila melanogaster chromosome 4, section 3 of 5 of the complete
             sequence
          Length = 328561

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 65    cttatagagcaaacttgaca 84
             ||||||||||||||||||||
Sbjct: 72970 cttatagagcaaacttgaca 72951

>emb|AL590449.1|CNS07EGG chromosome X of strain GB-M1 of Encephalitozoon cuniculi (Microspora)
          Length = 262797

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 100    gacctctctcttgtgtgtgctata 123
              |||||||||||||| |||||||||
Sbjct: 224803 gacctctctcttgtatgtgctata 224780

>gb|AC148919.1| Gallus gallus BAC clone CH261-43B19 from chromosome unknown, complete
              sequence
          Length = 163278

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 20     ttgtttatgatatttgagct 39
              ||||||||||||||||||||
Sbjct: 135889 ttgtttatgatatttgagct 135870


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,416,270
Number of Sequences: 3902068
Number of extensions: 1416270
Number of successful extensions: 23024
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 23017
Number of HSP's gapped (non-prelim): 7
length of query: 229
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 207
effective length of database: 17,147,199,772
effective search space: 3549470352804
effective search space used: 3549470352804
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)