| Clone Name | rbaal31l10 |
|---|---|
| Clone Library Name | barley_pub |
>emb|AL137128.4|CNS01DWD Human chromosome 14 DNA sequence BAC R-951P22 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 228652 Score = 42.1 bits (21), Expect = 0.58 Identities = 21/21 (100%) Strand = Plus / Minus Query: 49 tctaattctagatacagttaa 69 ||||||||||||||||||||| Sbjct: 866 tctaattctagatacagttaa 846
>emb|AL163011.3|CNS01RI8 Human chromosome 14 DNA sequence BAC C-2324M15 of library CalTech-D from chromosome 14 of Homo sapiens (Human), complete sequence Length = 100791 Score = 42.1 bits (21), Expect = 0.58 Identities = 21/21 (100%) Strand = Plus / Plus Query: 49 tctaattctagatacagttaa 69 ||||||||||||||||||||| Sbjct: 20203 tctaattctagatacagttaa 20223
>dbj|AP001982.4| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-344F5, complete sequence Length = 137996 Score = 40.1 bits (20), Expect = 2.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 85 tgcatgccatttacaaatgt 104 |||||||||||||||||||| Sbjct: 6593 tgcatgccatttacaaatgt 6612
>dbj|AP001977.4| Homo sapiens genomic DNA, chromosome 11q clone:RP11-248G21, complete sequences Length = 156957 Score = 40.1 bits (20), Expect = 2.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 85 tgcatgccatttacaaatgt 104 |||||||||||||||||||| Sbjct: 155647 tgcatgccatttacaaatgt 155666
>gb|AC158641.12| Mus musculus 10 BAC RP23-461E22 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 186390 Score = 38.2 bits (19), Expect = 9.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 134 gtgatttcaaaaagcttct 152 ||||||||||||||||||| Sbjct: 173887 gtgatttcaaaaagcttct 173869
>gb|DQ164216.1| Inducible shuttle vector pPW578, complete sequence Length = 9482 Score = 38.2 bits (19), Expect = 9.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 130 tgatgtgatttcaaaaagcttct 152 |||||||| |||||||||||||| Sbjct: 1094 tgatgtgaattcaaaaagcttct 1072
>gb|DQ164215.1| Shuttle vector pPW380, complete sequence Length = 9219 Score = 38.2 bits (19), Expect = 9.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 130 tgatgtgatttcaaaaagcttct 152 |||||||| |||||||||||||| Sbjct: 1094 tgatgtgaattcaaaaagcttct 1072
>gb|AC093292.2| Homo sapiens chromosome 5 clone RP11-503D12, complete sequence Length = 186278 Score = 38.2 bits (19), Expect = 9.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 12 tgtgaatacactgtgagca 30 ||||||||||||||||||| Sbjct: 98636 tgtgaatacactgtgagca 98618
>ref|XM_760148.1| Theileria parva strain Muguga hypothetical protein (TP02_0675) partial mRNA Length = 3027 Score = 38.2 bits (19), Expect = 9.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 98 caaatgtactcctacatgc 116 ||||||||||||||||||| Sbjct: 2983 caaatgtactcctacatgc 2965
>emb|BX936363.13| Zebrafish DNA sequence from clone CH211-112P19 in linkage group 11, complete sequence Length = 184849 Score = 38.2 bits (19), Expect = 9.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 tgtcctttgtgaatacact 23 ||||||||||||||||||| Sbjct: 92305 tgtcctttgtgaatacact 92287
>emb|AL109618.1|HSJ775C13 Human DNA sequence from clone RP4-775C13 on chromosome 20p12.1-13 Contains an NS1-associated protein 1 (NSAP1) pseudogene, complete sequence Length = 103819 Score = 38.2 bits (19), Expect = 9.1 Identities = 21/22 (95%) Strand = Plus / Minus Query: 66 ttaaaccaccntggttttctgc 87 |||||||||| ||||||||||| Sbjct: 83824 ttaaaccaccatggttttctgc 83803
>emb|AL034549.19|HS1125A11 Human DNA sequence from clone RP5-1125A11 on chromosome 20q11.1-11.23 Contains the TPM5P gene for tropomyosin 5 pseudogene, a novel gene, the 3' end of a novel gene, the 5' end of the RALY gene for RNA binding protein (autoantigenic, hnRNP-associated with lethal yellow), a Down syndrome critical region gene 5 (DSCR5) pseudogene and two CpG islands, complete sequence Length = 155567 Score = 38.2 bits (19), Expect = 9.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 83 tctgcatgccatttacaaa 101 ||||||||||||||||||| Sbjct: 81549 tctgcatgccatttacaaa 81531
>emb|AL593845.5| Zebrafish DNA sequence from clone BUSM1-142B24 in linkage group 17 Contains a novel gene for a protein similar to human FLJ11186, a novel gene similar to human KIAA1316 and fly CG2747, a novel gene for a protein with a HECT-domain (ubiquitin-transferase) and a CpG island, complete sequence Length = 89159 Score = 38.2 bits (19), Expect = 9.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 88 atgccatttacaaatgtac 106 ||||||||||||||||||| Sbjct: 77110 atgccatttacaaatgtac 77092
>emb|CR628365.6| Zebrafish DNA sequence from clone CH211-137O16 in linkage group 11, complete sequence Length = 191036 Score = 38.2 bits (19), Expect = 9.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 tgtcctttgtgaatacact 23 ||||||||||||||||||| Sbjct: 108960 tgtcctttgtgaatacact 108942
>emb|CR550304.13| Zebrafish DNA sequence from clone CH211-150I13 in linkage group 13, complete sequence Length = 118999 Score = 38.2 bits (19), Expect = 9.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 145 aagcttctatgctgcttat 163 ||||||||||||||||||| Sbjct: 40770 aagcttctatgctgcttat 40752
>emb|BX465838.15| Zebrafish DNA sequence from clone DKEY-11J8 in linkage group 17, complete sequence Length = 229940 Score = 38.2 bits (19), Expect = 9.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 88 atgccatttacaaatgtac 106 ||||||||||||||||||| Sbjct: 179494 atgccatttacaaatgtac 179512
>emb|BX890597.13| Zebrafish DNA sequence from clone DKEY-65F8, complete sequence Length = 244779 Score = 38.2 bits (19), Expect = 9.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 145 aagcttctatgctgcttat 163 ||||||||||||||||||| Sbjct: 229277 aagcttctatgctgcttat 229295
>gb|AC117379.3| Homo sapiens 3 BAC RP11-392C7 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 181191 Score = 38.2 bits (19), Expect = 9.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 153 atgctgcttatgcttcatt 171 ||||||||||||||||||| Sbjct: 74937 atgctgcttatgcttcatt 74955
>gb|AC158601.5| Mus musculus 10 BAC RP23-119L9 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 249420 Score = 38.2 bits (19), Expect = 9.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 134 gtgatttcaaaaagcttct 152 ||||||||||||||||||| Sbjct: 142673 gtgatttcaaaaagcttct 142691
>gb|AC079402.5| Homo sapiens BAC clone RP11-597E15 from 2, complete sequence Length = 86973 Score = 38.2 bits (19), Expect = 9.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 129 gtgatgtgatttcaaaaagcttc 151 ||||| ||||||||||||||||| Sbjct: 44547 gtgatctgatttcaaaaagcttc 44569
>emb|CT737180.5| M.truncatula DNA sequence from clone MTH2-117L19 on chromosome 3, complete sequence Length = 130239 Score = 38.2 bits (19), Expect = 9.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 134 gtgatttcaaaaagcttct 152 ||||||||||||||||||| Sbjct: 40041 gtgatttcaaaaagcttct 40059
>emb|AL626775.11| Mouse DNA sequence from clone RP23-325M14 on chromosome 4, complete sequence Length = 190641 Score = 38.2 bits (19), Expect = 9.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 92 catttacaaatgtactcct 110 ||||||||||||||||||| Sbjct: 14167 catttacaaatgtactcct 14185
>emb|AL805967.7| Mouse DNA sequence from clone RP23-450K9 on chromosome X, complete sequence Length = 189710 Score = 38.2 bits (19), Expect = 9.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 88 atgccatttacaaatgtac 106 ||||||||||||||||||| Sbjct: 4176 atgccatttacaaatgtac 4194 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,528,198 Number of Sequences: 3902068 Number of extensions: 1528198 Number of successful extensions: 100763 Number of sequences better than 10.0: 23 Number of HSP's better than 10.0 without gapping: 23 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 100713 Number of HSP's gapped (non-prelim): 50 length of query: 184 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 162 effective length of database: 17,147,199,772 effective search space: 2777846363064 effective search space used: 2777846363064 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)