ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal7n21
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_755992.1| Ustilago maydis 521 hypothetical protein (UM049... 70 9e-09
2gb|AC162890.4| Mus musculus chromosome 3, clone RP23-362E13, com... 56 1e-04
3emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ... 56 1e-04
4gb|AC125349.3| Mus musculus BAC clone RP23-394P9 from chromosome... 56 1e-04
5emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos... 56 1e-04
6gb|AE011779.1| Xanthomonas axonopodis pv. citri str. 306, secti... 56 1e-04
7gb|AC093049.1| Drosophila melanogaster, chromosome 2R, region 45... 56 1e-04
8gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, comp... 56 1e-04
9gb|AE003835.4| Drosophila melanogaster chromosome 2R, section 15... 56 1e-04
10gb|AC006074.1|AC006074 Drosophila melanogaster, chromosome 2R, r... 56 1e-04
11gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, com... 56 1e-04
12ref|NM_192898.1| Oryza sativa (japonica cultivar-group), predic... 54 5e-04
13gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com... 54 5e-04
14dbj|AP008232.1| Sodalis glossinidius str. 'morsitans' DNA, compl... 54 5e-04
15gb|AC023721.3| Drosophila melanogaster X BAC RP98-5L4 (Roswell P... 54 5e-04
16gb|AC023687.3| Drosophila melanogaster X BAC RP98-36C7 (Roswell ... 54 5e-04
17dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 54 5e-04
18dbj|AP002744.2| Oryza sativa (japonica cultivar-group) genomic D... 54 5e-04
19dbj|AP002839.1| Oryza sativa (japonica cultivar-group) genomic D... 54 5e-04
20dbj|AK074025.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 5e-04
21gb|AE003489.2| Drosophila melanogaster chromosome X, section 41 ... 54 5e-04
22ref|XM_640089.1| Dictyostelium discoideum hypothetical protein (... 52 0.002
23gb|AC115607.2| Dictyostelium discoideum chromosome 2 map 4559693... 52 0.002
24ref|XM_797773.1| Trypanosoma cruzi strain CL Brener clathrin hea... 52 0.002
25gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, compl... 52 0.002
26gb|AE011982.1| Xanthomonas axonopodis pv. citri str. 306, secti... 52 0.002
27gb|AC084463.1|AC084463 Caenorhabditis briggsae cosmid CB037F21, ... 52 0.002
28gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, co... 50 0.009
29ref|XM_389444.1| Gibberella zeae PH-1 chromosome 4 hypothetical ... 50 0.009
30gb|CP000271.1| Burkholderia xenovorans LB400 chromosome 2, compl... 50 0.009
31emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromos... 50 0.009
32gb|AC092228.1|AC092228 Drosophila melanogaster, chromosome 2L, r... 50 0.009
33gb|AF204951.2|AF204951 Ectocarpus siliculosus virus, complete ge... 50 0.009
34dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 50 0.009
35gb|AE003644.4| Drosophila melanogaster chromosome 2L, section 53... 50 0.009
36ref|XM_804685.1| Trypanosoma cruzi strain CL Brener clathrin hea... 48 0.034
37gb|U46675.1| Caenorhabditis elegans cosmid F35A5, complete sequence 48 0.034
38ref|XM_660895.1| Cryptosporidium hominis TU502 hypothetical prot... 48 0.034
39emb|AJ849782.1| Drosophila subobscura partial abd-A gene for abd... 48 0.034
40emb|AJ849781.1| Drosophila subobscura partial abd-A gene for abd... 48 0.034
41emb|AJ849780.1| Drosophila subobscura partial abd-A gene for abd... 48 0.034
42emb|AJ849776.1| Drosophila subobscura partial abd-A gene for abd... 48 0.034
43emb|AJ849774.1| Drosophila subobscura partial abd-A gene for abd... 48 0.034
44emb|AJ849770.1| Drosophila subobscura partial abd-A gene for abd... 48 0.034
45tpg|BK002374.1| TPA: TPA_inf: Drosophila melanogaster HDC12296 (... 48 0.034
46gb|AE011687.1| Xanthomonas axonopodis pv. citri str. 306, secti... 48 0.034
47ref|NM_076257.1| Caenorhabditis elegans F35A5.5 (F35A5.5) mRNA, ... 48 0.034
48gb|AC008226.10|AC008226 Drosophila melanogaster, chromosome 3R, ... 48 0.034
49gb|AC008312.4|AC008312 Drosophila melanogaster, chromosome 3R, r... 48 0.034
50gb|AE003671.4| Drosophila melanogaster chromosome 3R, section 13... 48 0.034
51gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, co... 48 0.034
52gb|U39852.1| Caenorhabditis elegans cosmid K10C2, complete sequence 46 0.13
53ref|XM_324182.1| Neurospora crassa OR74A hypothetical protein (N... 46 0.13
54ref|XM_955292.1| Neurospora crassa OR74A hypothetical protein (N... 46 0.13
55gb|AY728266.1| Trypanosoma cruzi voucher Dm28c zinc finger prote... 46 0.13
56ref|XM_754298.1| Ustilago maydis 521 hypothetical protein (UM032... 46 0.13
57ref|XM_724971.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 46 0.13
58emb|AL939120.1|SCO939120 Streptomyces coelicolor A3(2) complete ... 46 0.13
59emb|AL596170.1| Listeria innocua Clip11262 complete genome, segm... 46 0.13
60emb|AJ849790.1| Drosophila subobscura partial abd-A gene for abd... 46 0.13
61emb|AJ849787.1| Drosophila subobscura partial abd-A gene for abd... 46 0.13
62emb|AJ849786.1| Drosophila subobscura partial abd-A gene for abd... 46 0.13
63emb|AJ849775.1| Drosophila subobscura partial abd-A gene for abd... 46 0.13
64emb|AJ849773.1| Drosophila subobscura partial abd-A gene for abd... 46 0.13
65emb|AJ849772.1| Drosophila subobscura partial abd-A gene for abd... 46 0.13
66gb|AC132166.1| Drosophila pseudoobscura FOSMID DPSF1-548A16 (Ch... 46 0.13
67gb|AE012148.1| Xanthomonas campestris pv. campestris str. ATCC 3... 46 0.13
68gb|AC007754.4|AC007754 Drosophila melanogaster, chromosome 3R, r... 46 0.13
69gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 46 0.13
70ref|NM_076683.1| Caenorhabditis elegans GRound-Like (grd related... 46 0.13
71gb|AC091501.1|AC091501 Drosophila melanogaster, chromosome 2R, r... 46 0.13
72dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.13
73gb|AC009211.5|AC009211 Drosophila melanogaster, chromosome 3R, r... 46 0.13
74dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 46 0.13
75gb|AY190945.1| Drosophila pseudoobscura clone DPSF01_10_G08 (D14... 46 0.13
76dbj|AP003633.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.13
77dbj|AP003628.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.13
78emb|AJ011617.1|ZMA011617 Zea mays mRNA for SBP-domain protein 4 46 0.13
79gb|AY111449.1| Zea mays CL1438_-1 mRNA sequence 46 0.13
80gb|AE003699.3| Drosophila melanogaster chromosome 3R, section 37... 46 0.13
81gb|AE003806.3| Drosophila melanogaster chromosome 2R, section 44... 46 0.13
82dbj|AB088224.1| Streptomyces rochei plasmid pSLA2-L DNA, complet... 46 0.13
83gb|AC004287.1|AC004287 Drosophila melanogaster DNA sequence (P1 ... 46 0.13
84dbj|AP004533.1| Lotus japonicus genomic DNA, chromosome 3, clone... 46 0.13
85gb|CP000081.1| Leishmania major chromosome 35, complete sequence 44 0.53
86gb|AC007146.15| Drosophila melanogaster clone BACR02J20, complet... 44 0.53
87gb|AC008138.5| Drosophila melanogaster clone BACR27A15, complete... 44 0.53
88ref|XM_360655.1| Magnaporthe grisea 70-15 hypothetical protein (... 44 0.53
89ref|XM_957117.1| Neurospora crassa OR74A hypothetical protein (N... 44 0.53
90ref|XM_324567.1| Neurospora crassa OR74A hypothetical protein (N... 44 0.53
91emb|BX071122.1|CNS09R1I Single read from an extremity of a full-... 44 0.53
92emb|AL627444.10| Mouse DNA sequence from clone RP23-307A1 on chr... 44 0.53
93gb|AC010571.8| Drosophila melanogaster 3L BAC RP98-22O3 (Roswell... 44 0.53
94gb|AE011937.1| Xanthomonas axonopodis pv. citri str. 306, secti... 44 0.53
95tpg|BK003377.1| TPA: TPA_inf: Drosophila melanogaster HDC02041 (... 44 0.53
96ref|NM_080362.2| Drosophila melanogaster SAM-motif ubiquitously ... 44 0.53
97ref|XM_693167.1| PREDICTED: Danio rerio similar to CG32045-PC, i... 44 0.53
98ref|XM_688982.1| PREDICTED: Danio rerio similar to chromosome 13... 44 0.53
99gb|AC092226.1|AC092226 Drosophila melanogaster, chromosome 2L, r... 44 0.53
100emb|CR377711.1| Pinus pinaster SSR, clone PPA3A03r 44 0.53
101emb|CR377710.1| Pinus pinaster SSR, clone PPA3A03 44 0.53
102emb|CR354459.1| Pinus pinaster SSR, clone PPA3D07 44 0.53
103dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.53
104gb|AC009376.7| Drosophila melanogaster 3 BAC RPCI98-1D4 (Roswell... 44 0.53
105emb|BX470223.14| Zebrafish DNA sequence from clone DKEY-45P9 in ... 44 0.53
106dbj|AP005124.5| Oryza sativa (japonica cultivar-group) genomic D... 44 0.53
107dbj|AP003743.4| Oryza sativa (japonica cultivar-group) genomic D... 44 0.53
108ref|XM_319527.2| Anopheles gambiae str. PEST ENSANGP00000017913 ... 44 0.53
109ref|XM_314191.2| Anopheles gambiae str. PEST ENSANGP00000014541 ... 44 0.53
110emb|CT572999.10| Mouse DNA sequence from clone RP23-6C18 on chro... 44 0.53
111emb|AJ001030.1|SCTAK1 Saccharomyces cerevisiae TAK1 gene 44 0.53
112gb|AE003632.4| Drosophila melanogaster chromosome 2L, section 41... 44 0.53
113gb|AE003630.2| Drosophila melanogaster chromosome 2L, section 39... 44 0.53
114gb|AE003595.3| Drosophila melanogaster chromosome 3L, section 76... 44 0.53
115gb|AE003516.4| Drosophila melanogaster chromosome 3L, section 69... 44 0.53
116gb|AC005117.1|AC005117 Drosophila melanogaster, chromosome 2L, r... 44 0.53
117gb|U83459.1|SCU83459 Saccharomyces cerevisiae protein kinase Rim... 44 0.53
118dbj|D50617.1|YSCCHRVIN Saccharomyces cerevisiae chromosome VI co... 44 0.53
119ref|NM_130034.1| Arabidopsis thaliana unknown protein AT2G44700 ... 42 2.1
120gb|AY773871.1| Arabidopsis thaliana clone pENTR221-At2g44700 hyp... 42 2.1
121gb|AC118289.2| Oryza sativa (japonica cultivar-group) chromosome... 42 2.1
122gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 42 2.1
123ref|XM_755045.1| Ustilago maydis 521 hypothetical protein (UM039... 42 2.1
124ref|XM_756693.1| Ustilago maydis 521 hypothetical protein (UM056... 42 2.1
125gb|AY247818.1| Arabidopsis thaliana hypothetical protein (At2g44... 42 2.1
126gb|AC092075.7| Oryza sativa chromosome 3 BAC OSJNBa0017N12 genom... 42 2.1
127gb|AC113301.7| Mus musculus chromosome 8, clone RP23-430G7, comp... 42 2.1
128emb|Z99571.2|HS388N15 Human DNA sequence from clone RP3-388N15 o... 42 2.1
129emb|Z82190.1|HS180M12 Human DNA sequence from clone RP1-180M12 o... 42 2.1
130emb|AL138751.18| Human DNA sequence from clone RP11-346E17 on ch... 42 2.1
131emb|BX294147.1| Pirellula sp. strain 1 complete genome; segment ... 42 2.1
132emb|AJ849795.1| Drosophila subobscura partial abd-A gene for abd... 42 2.1
133emb|AJ849777.1| Drosophila subobscura partial abd-A gene for abd... 42 2.1
134emb|AJ849771.1| Drosophila subobscura partial abd-A gene for abd... 42 2.1
135gb|AC159242.2| Mus musculus BAC clone RP24-325A23 from chromosom... 42 2.1
136gb|AC104628.6| Drosophila melanogaster X BAC RP98-18C18 (Roswell... 42 2.1
137gb|AC023705.4| Drosophila melanogaster X BAC RP98-7L6 (Roswell P... 42 2.1
138gb|AC023694.4| Drosophila melanogaster X BAC RP98-18B11 (Roswell... 42 2.1
139tpg|BK003053.1| TPA: TPA_inf: Drosophila melanogaster HDC17702 (... 42 2.1
140gb|AE012111.1| Xanthomonas campestris pv. campestris str. ATCC 3... 42 2.1
141gb|AC023708.4| Drosophila melanogaster X BAC RP98-12B22 (Roswell... 42 2.1
142dbj|AP007167.1| Aspergillus oryzae RIB40 genomic DNA, SC020 42 2.1
143gb|AC003672.3| Arabidopsis thaliana chromosome 2 clone F16B22 ma... 42 2.1
144ref|NM_132379.1| Drosophila melanogaster CG12645-RA (CG12645), mRNA 42 2.1
145gb|BT023049.1| Drosophila melanogaster IP04019 full insert cDNA 42 2.1
146gb|BT023004.1| Drosophila melanogaster IP04119 full insert cDNA 42 2.1
147dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.1
148dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.1
149dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.1
150gb|AC010984.7| Homo sapiens BAC clone RP11-510C1 from 2, complet... 42 2.1
151gb|AC140481.3| Homo sapiens BAC clone RP11-1216L17 from 2, compl... 42 2.1
152gb|AC092602.2| Homo sapiens BAC clone RP11-134G21 from 2, comple... 42 2.1
153dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 42 2.1
154dbj|AK119817.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.1
155dbj|AK110472.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.1
156ref|XM_306539.2| Anopheles gambiae str. PEST ENSANGP00000000078 ... 42 2.1
157dbj|AK071491.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.1
158gb|AC156581.4| Pan troglodytes BAC clone CH251-372H22 from chrom... 42 2.1
159gb|AE003449.2| Drosophila melanogaster chromosome X, section 33 ... 42 2.1
160gb|AE003437.3| Drosophila melanogaster chromosome X, section 21 ... 42 2.1
161dbj|AP002498.3| Homo sapiens genomic DNA, chromosome 11q, clone:... 42 2.1
162gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 42 2.1
163emb|AL732381.3|CNS08C94 Oryza sativa chromosome 12, . BAC OJ1112... 42 2.1
164gb|AF518567.2| Escherichia coli insertion sequence ISEcp1 disrup... 40 8.2
165ref|XM_635980.1| Dictyostelium discoideum putative CAM kinase (D... 40 8.2
166gb|AC007772.6| Drosophila melanogaster clone BACR19P12, complete... 40 8.2
167ref|NM_178399.2| Mus musculus RIKEN cDNA 3110035E14 gene (311003... 40 8.2
168gb|AC006467.13| Drosophila melanogaster clone BACR03L08, complet... 40 8.2
169gb|AC092224.2| Drosophila melanogaster clone BACR17M04, complete... 40 8.2
170gb|AC008097.5| Drosophila melanogaster clone BACR20D06, complete... 40 8.2
171gb|AC010919.11| Drosophila melanogaster clone BACR32K23, complet... 40 8.2
172ref|XM_364993.1| Magnaporthe grisea 70-15 hypothetical protein (... 40 8.2
173gb|AC150553.1| Drosophila melanogaster clone BACR09H20, complete... 40 8.2
174gb|AY661659.1| Sorghum bicolor clone BAC 75D9, complete sequence 40 8.2
175ref|XM_950872.1| Neurospora crassa OR74A hypothetical protein (N... 40 8.2
176ref|XM_327881.1| Neurospora crassa OR74A hypothetical protein (N... 40 8.2
177gb|AC147035.3| Pan troglodytes BAC clone RP43-104N19 from 7, com... 40 8.2
178ref|XM_653113.1| Aspergillus nidulans FGSC A4 hypothetical prote... 40 8.2
179ref|XM_454853.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E20031g ... 40 8.2
180ref|XM_754958.1| Ustilago maydis 521 hypothetical protein (UM039... 40 8.2
181gb|AC117702.10| Mus musculus chromosome 10, clone RP23-464I2, co... 40 8.2
182ref|XM_449886.1| Candida glabrata CBS138 hypothetical protein (C... 40 8.2
183ref|XM_449887.1| Candida glabrata CBS138 hypothetical protein (C... 40 8.2
184gb|AC124408.4| Mus musculus BAC clone RP24-262E22 from chromosom... 40 8.2
185ref|XM_812765.1| Trypanosoma cruzi strain CL Brener mucin-associ... 40 8.2
186ref|XM_814918.1| Trypanosoma cruzi strain CL Brener mucin-associ... 40 8.2
187ref|XM_814932.1| Trypanosoma cruzi strain CL Brener mucin-associ... 40 8.2
188gb|AC007035.3| Homo sapiens BAC clone RP11-104I19 from 7, comple... 40 8.2
189emb|BX957269.5| Zebrafish DNA sequence from clone CH211-12C22 in... 40 8.2
190emb|AL591046.4| Human DNA sequence from clone RP11-96O10 on chro... 40 8.2
191emb|AL356503.18| Human DNA sequence from clone RP13-159A24 on ch... 40 8.2
192emb|X15867.1|MLUVRA Micrococcus luteus homolog of the E.coli uvr... 40 8.2
193emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 40 8.2
194emb|CR380959.1| Candida glabrata strain CBS138 chromosome M comp... 40 8.2
195gb|AC158790.5| Mus musculus chromosome 1, clone RP23-223M9, comp... 40 8.2
196gb|AC103620.12| Mus musculus chromosome 1, clone RP24-219C22, co... 40 8.2
197emb|BX538352.1| Cryptosporidium parvum chromosome 6, complete se... 40 8.2
198emb|BX294023.1|NCB20D17 Neurospora crassa DNA linkage group V BA... 40 8.2
199emb|AL939125.1|SCO939125 Streptomyces coelicolor A3(2) complete ... 40 8.2
200emb|AL627383.5| Zebrafish DNA sequence from clone RP71-1O18 in l... 40 8.2
201emb|AL021086.1|DMC86E4 Drosophila melanogaster cosmid clone 86E4 40 8.2
202emb|AJ849796.1| Drosophila subobscura partial abd-A gene for abd... 40 8.2
203emb|AJ849794.1| Drosophila subobscura partial abd-A gene for abd... 40 8.2
204emb|AJ849793.1| Drosophila subobscura partial abd-A gene for abd... 40 8.2
205emb|AJ849791.1| Drosophila subobscura partial abd-A gene for abd... 40 8.2
206emb|AJ849789.1| Drosophila subobscura partial abd-A gene for abd... 40 8.2
207emb|AJ849788.1| Drosophila subobscura partial abd-A gene for abd... 40 8.2
208emb|AJ849785.1| Drosophila subobscura partial abd-A gene for abd... 40 8.2
209emb|AJ849784.1| Drosophila subobscura partial abd-A gene for abd... 40 8.2
210emb|AJ849783.1| Drosophila subobscura partial abd-A gene for abd... 40 8.2
211emb|AJ849779.1| Drosophila subobscura partial abd-A gene for abd... 40 8.2
212emb|AJ849769.1| Drosophila subobscura partial abd-A gene for abd... 40 8.2
213gb|AC093454.3| Drosophila melanogaster 3L BAC RP98-23K2 (Roswell... 40 8.2
214emb|BX005430.14| Zebrafish DNA sequence from clone DKEY-19E4 in ... 40 8.2
215dbj|AB229973.1| Aspergillus oryzae cDNA, contig sequence: AoEST6859 40 8.2
216ref|NM_168654.1| Drosophila melanogaster CG13073-RA, transcript ... 40 8.2
217dbj|AP007155.1| Aspergillus oryzae RIB40 genomic DNA, SC003 40 8.2
218ref|NM_140588.1| Drosophila melanogaster CG13073-RB, transcript ... 40 8.2
219ref|XM_686765.1| PREDICTED: Danio rerio similar to mKIAA0777 pro... 40 8.2
220gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, comple... 40 8.2
221gb|CP000249.1| Frankia sp. CcI3, complete genome 40 8.2
222ref|XM_627731.1| Cryptosporidium parvum Iowa II hypothetical pro... 40 8.2
223ref|XM_628599.1| Cryptosporidium parvum Iowa II hypothetical pro... 40 8.2
224dbj|AK014123.1| Mus musculus 13 days embryo head cDNA, RIKEN ful... 40 8.2
225gb|AC093103.1| Drosophila melanogaster, chromosome 2L, region 35... 40 8.2
226dbj|AK043759.1| Mus musculus 10 days neonate cortex cDNA, RIKEN ... 40 8.2
227dbj|AK043576.1| Mus musculus 10 days neonate cortex cDNA, RIKEN ... 40 8.2
228emb|CR377733.1| Pinus pinaster SSR, clone PPA3D05r 40 8.2
229emb|CR377574.1| Pinus pinaster SSR, clone PPA7E08r 40 8.2
230gb|AC009203.5|AC009203 Drosophila melanogaster, chromosome 2L, r... 40 8.2
231gb|AC007771.7|AC007771 Drosophila melanogaster, chromosome 3R, r... 40 8.2
232emb|Z54148.1|BABP26GEN B.abortus bp26 gene 40 8.2
233dbj|AK111199.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.2
234gb|BC066997.1| Mus musculus RIKEN cDNA 3110035E14 gene, mRNA (cD... 40 8.2
235emb|CT806423.2| Pan troglodytes chromosome X clone CH251-25B01 m... 40 8.2
236gb|AC008369.1|AC008369 Drosophila melanogaster, chromosome 2R, r... 40 8.2
237gb|AE003732.3| Drosophila melanogaster chromosome 3R, section 70... 40 8.2
238gb|AE003660.2| Drosophila melanogaster chromosome 2L, section 69... 40 8.2
239gb|AE003645.4| Drosophila melanogaster chromosome 2L, section 54... 40 8.2
240gb|AE003810.3| Drosophila melanogaster chromosome 2R, section 40... 40 8.2
241gb|AE003793.3| Drosophila melanogaster chromosome 2R, section 57... 40 8.2
242gb|AE003781.5| Drosophila melanogaster chromosome 2L, section 80... 40 8.2
243gb|AE003528.3| Drosophila melanogaster chromosome 3L, section 57... 40 8.2
244gb|AE003500.4| Drosophila melanogaster chromosome X, section 52 ... 40 8.2
245emb|BX001002.4| Zebrafish DNA sequence from clone CH211-51G4 in ... 40 8.2
246gb|AC164120.2| Mus musculus BAC clone RP24-289J17 from chromosom... 40 8.2
247gb|AC147598.2| Gallus gallus BAC clone CH261-121K14 from chromos... 40 8.2
248gb|AE017262.2| Listeria monocytogenes str. 4b F2365, complete ge... 40 8.2
249dbj|AB070517.1| Sus scrofa CHRNE, MINK genes for AchR epsilon su... 40 8.2

>ref|XM_755992.1| Ustilago maydis 521 hypothetical protein (UM04938.1) partial mRNA
          Length = 2241

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                          
Query: 399 agaattagcatcggaattggcattggcatcggcatcggcatcggcat 445
           |||||||||||||| || ||||| |||||||||||||||||||||||
Sbjct: 402 agaattagcatcggcatcggcatcggcatcggcatcggcatcggcat 448



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 406 gcatcggaattggcattggcatcggcatcggcatcggcat 445
           ||||||| || ||||| |||||||||||||||||||||||
Sbjct: 415 gcatcggcatcggcatcggcatcggcatcggcatcggcat 454



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 406 gcatcggaattggcattggcatcggcatcggcatc 440
           ||||||| || ||||| ||||||||||||||||||
Sbjct: 421 gcatcggcatcggcatcggcatcggcatcggcatc 455



to top

>gb|AC162890.4| Mus musculus chromosome 3, clone RP23-362E13, complete sequence
          Length = 113095

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                     
Query: 406   gcatcggaattggcattggcatcggcatcggcatcggcat 445
             ||||||| || ||||| |||||||||||||||||||||||
Sbjct: 10202 gcatcggcatcggcatcggcatcggcatcggcatcggcat 10163



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 417   ggcattggcatcggcatcggcatcggcat 445
             ||||| |||||||||||||||||||||||
Sbjct: 10203 ggcatcggcatcggcatcggcatcggcat 10175



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                 
Query: 406   gcatcggaattggcattggcatcggcatcggcatcg 441
             ||||||| || ||||| |||||||||||||||||||
Sbjct: 10196 gcatcggcatcggcatcggcatcggcatcggcatcg 10161



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                     
Query: 406   gcatcggaattggcattggcatcggcatcggcatcggcat 445
             ||||||| || ||||| ||||||||||||| |||||||||
Sbjct: 10190 gcatcggcatcggcatcggcatcggcatcgacatcggcat 10151



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                     
Query: 406   gcatcggaattggcattggcatcggcatcggcatcggcat 445
             ||||||| || ||||| ||||||| |||||||||||||||
Sbjct: 10184 gcatcggcatcggcatcggcatcgacatcggcatcggcat 10145



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                 
Query: 406   gcatcggaattggcattggcatcggcatcggcatcg 441
             ||||||| || ||||| | |||||||||||||||||
Sbjct: 10178 gcatcggcatcggcatcgacatcggcatcggcatcg 10143



to top

>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome
          Length = 5178466

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                       
Query: 406     gcatcggaattggcattggcatcggcatcggcatcggcat 445
               ||||||| || ||||| |||||||||||||||||||||||
Sbjct: 3514991 gcatcggcatcggcatcggcatcggcatcggcatcggcat 3514952



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                       
Query: 406     gcatcggaattggcattggcatcggcatcggcatcggcat 445
               ||||||| || ||||| |||||||||||||||||||||||
Sbjct: 3514985 gcatcggcatcggcatcggcatcggcatcggcatcggcat 3514946



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                     
Query: 406     gcatcggaattggcattggcatcggcatcggcatcggc 443
               ||||||| || ||||| |||||||||||||||||||||
Sbjct: 3514979 gcatcggcatcggcatcggcatcggcatcggcatcggc 3514942



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                            
Query: 417     ggcattggcatcggcatcggcatcggcat 445
               ||||| |||||||||||||||||||||||
Sbjct: 4951002 ggcatcggcatcggcatcggcatcggcat 4951030



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                            
Query: 417     ggcattggcatcggcatcggcatcggcat 445
               ||||| |||||||||||||||||||||||
Sbjct: 3514992 ggcatcggcatcggcatcggcatcggcat 3514964



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 417     ggcattggcatcggcatcggcatcg 441
               ||||| |||||||||||||||||||
Sbjct: 4951008 ggcatcggcatcggcatcggcatcg 4951032



to top

>gb|AC125349.3| Mus musculus BAC clone RP23-394P9 from chromosome 3, complete sequence
          Length = 194060

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                     
Query: 406   gcatcggaattggcattggcatcggcatcggcatcggcat 445
             ||||||| || ||||| |||||||||||||||||||||||
Sbjct: 69559 gcatcggcatcggcatcggcatcggcatcggcatcggcat 69598



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                          
Query: 417   ggcattggcatcggcatcggcatcggcat 445
             ||||| |||||||||||||||||||||||
Sbjct: 69558 ggcatcggcatcggcatcggcatcggcat 69586



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                     
Query: 406   gcatcggaattggcattggcatcggcatcggcatcggcat 445
             ||||||| || ||||| ||||||| |||||||||||||||
Sbjct: 69577 gcatcggcatcggcatcggcatcgacatcggcatcggcat 69616



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                     
Query: 406   gcatcggaattggcattggcatcggcatcggcatcggcat 445
             ||||||| || ||||| ||||||||||||| |||||||||
Sbjct: 69571 gcatcggcatcggcatcggcatcggcatcgacatcggcat 69610



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                 
Query: 406   gcatcggaattggcattggcatcggcatcggcatcg 441
             ||||||| || ||||| |||||||||||||||||||
Sbjct: 69565 gcatcggcatcggcatcggcatcggcatcggcatcg 69600



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 406   gcatcggaattggcattggcatcggcatcggcatcg 441
             ||||||| || ||||| | |||||||||||||||||
Sbjct: 69583 gcatcggcatcggcatcgacatcggcatcggcatcg 69618



to top

>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence
          Length = 4074542

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                       
Query: 406     gcatcggaattggcattggcatcggcatcggcatcggcat 445
               ||||||| || ||||| |||||||||||||||||||||||
Sbjct: 1789323 gcatcggcatcggcatcggcatcggcatcggcatcggcat 1789362



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                       
Query: 406     gcatcggaattggcattggcatcggcatcggcatcggcat 445
               ||||||| || ||||| |||||||||||||||||||||||
Sbjct: 1789317 gcatcggcatcggcatcggcatcggcatcggcatcggcat 1789356



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                      
Query: 406    gcatcggaattggcattggcatcggcatcggcatcggcat 445
              ||||||| || ||||| |||||||||||||||||||||||
Sbjct: 470870 gcatcggcatcggcatcggcatcggcatcggcatcggcat 470831



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                              
Query: 415     ttggcattggcatcggcatcggcatcggcat 445
               ||||||| |||||||||||||||||||||||
Sbjct: 1789314 ttggcatcggcatcggcatcggcatcggcat 1789344



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                     
Query: 406    gcatcggaattggcattggcatcggcatcggcatcggca 444
              ||||||| || ||||| ||||||||||||||||||||||
Sbjct: 470864 gcatcggcatcggcatcggcatcggcatcggcatcggca 470826



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                     
Query: 406     gcatcggaattggcattggcatcggcatcggcatcggc 443
               ||||||| || ||||| |||||||||||||||||||||
Sbjct: 1789329 gcatcggcatcggcatcggcatcggcatcggcatcggc 1789366



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 417    ggcattggcatcggcatcggcatcggcat 445
              ||||| |||||||||||||||||||||||
Sbjct: 470871 ggcatcggcatcggcatcggcatcggcat 470843



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                       
Query: 406     gcatcggaattggcattggcatcggcatcggcatcggcat 445
               ||||||| |||||||||||||| ||||| ||||| |||||
Sbjct: 2570945 gcatcggcattggcattggcattggcattggcattggcat 2570906



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                              
Query: 415     ttggcattggcatcggcatcggcatcggcat 445
               ||||||| ||| |||||||||||||||||||
Sbjct: 2570966 ttggcatcggcgtcggcatcggcatcggcat 2570936



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                             
Query: 414     attggcattggcatcggcatcggcatcggc 443
               |||||||||||||| ||||| |||||||||
Sbjct: 2570931 attggcattggcattggcattggcatcggc 2570902



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                             
Query: 414     attggcattggcatcggcatcggcatcggc 443
               |||||||||||||| ||||||||| |||||
Sbjct: 2570925 attggcattggcattggcatcggcgtcggc 2570896



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                             
Query: 414     attggcattggcatcggcatcggcatcggc 443
               |||||||||||||||||| ||||| |||||
Sbjct: 2570919 attggcattggcatcggcgtcggcgtcggc 2570890



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                       
Query: 406     gcatcggaattggcattggcatcggcatcggcatcggcat 445
               ||||||| || ||||||||||| ||||| ||||| |||||
Sbjct: 2570951 gcatcggcatcggcattggcattggcattggcattggcat 2570912



to top

>gb|AE011779.1| Xanthomonas axonopodis pv. citri str. 306,  section 157 of 469 of the
            complete genome
          Length = 10887

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                    
Query: 406  gcatcggaattggcattggcatcggcatcggcatcggcat 445
            ||||||| || ||||| |||||||||||||||||||||||
Sbjct: 8704 gcatcggcatcggcatcggcatcggcatcggcatcggcat 8743



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                         
Query: 417  ggcattggcatcggcatcggcatcggcat 445
            ||||| |||||||||||||||||||||||
Sbjct: 8703 ggcatcggcatcggcatcggcatcggcat 8731



to top

>gb|AC093049.1| Drosophila melanogaster, chromosome 2R, region 45A-45A, BAC clone
              BACR08E17, complete sequence
          Length = 178262

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                          
Query: 418    gcattggcatcggcatcggcatcggcat 445
              ||||||||||||||||||||||||||||
Sbjct: 143705 gcattggcatcggcatcggcatcggcat 143732



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 414    attggcattggcatcggcatcggcatc 440
              |||||||| ||||||||||||||||||
Sbjct: 143707 attggcatcggcatcggcatcggcatc 143733



to top

>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence
          Length = 2325379

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                       
Query: 406     gcatcggaattggcattggcatcggcatcggcatcggcat 445
               ||||||| || ||||| |||||||||||||||||||||||
Sbjct: 2075631 gcatcggcatcggcatcggcatcggcatcggcatcggcat 2075670



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                     
Query: 406     gcatcggaattggcattggcatcggcatcggcatcggc 443
               ||||||| || ||||| |||||||||||||||||||||
Sbjct: 2075637 gcatcggcatcggcatcggcatcggcatcggcatcggc 2075674



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 423     ggcatcggcatcggcatcggcat 445
               |||||||||||||||||||||||
Sbjct: 1824708 ggcatcggcatcggcatcggcat 1824730



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 424     gcatcggcatcggcatcggca 444
               |||||||||||||||||||||
Sbjct: 2028070 gcatcggcatcggcatcggca 2028090



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 425     catcggcatcggcatcggcat 445
               |||||||||||||||||||||
Sbjct: 1824704 catcggcatcggcatcggcat 1824724



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 417     ggcattggcatcggcatcggcatc 440
               ||||| ||||||||||||||||||
Sbjct: 1824708 ggcatcggcatcggcatcggcatc 1824731



to top

>gb|AE003835.4| Drosophila melanogaster chromosome 2R, section 15 of 73 of the complete
              sequence
          Length = 271696

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                          
Query: 418    gcattggcatcggcatcggcatcggcat 445
              ||||||||||||||||||||||||||||
Sbjct: 184823 gcattggcatcggcatcggcatcggcat 184796



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 414    attggcattggcatcggcatcggcatc 440
              |||||||| ||||||||||||||||||
Sbjct: 184821 attggcatcggcatcggcatcggcatc 184795



to top

>gb|AC006074.1|AC006074 Drosophila melanogaster, chromosome 2R, region 44F12-45A4, P1 clones
              DS05998, DS07727, DS05175, and DS01885, complete sequence
          Length = 204617

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                          
Query: 418    gcattggcatcggcatcggcatcggcat 445
              ||||||||||||||||||||||||||||
Sbjct: 135526 gcattggcatcggcatcggcatcggcat 135553



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 414    attggcattggcatcggcatcggcatc 440
              |||||||| ||||||||||||||||||
Sbjct: 135528 attggcatcggcatcggcatcggcatc 135554



to top

>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence
          Length = 3809201

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                      
Query: 406    gcatcggaattggcattggcatcggcatcggcatcggcat 445
              ||||||| || ||||| |||||||||||||||||||||||
Sbjct: 728070 gcatcggcatcggcatcggcatcggcatcggcatcggcat 728109



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                      
Query: 406    gcatcggaattggcattggcatcggcatcggcatcggcat 445
              ||||||| || ||||| |||||||||||||||||||||||
Sbjct: 728064 gcatcggcatcggcatcggcatcggcatcggcatcggcat 728103



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                    
Query: 406    gcatcggaattggcattggcatcggcatcggcatcggc 443
              ||||||| || ||||| |||||||||||||||||||||
Sbjct: 728076 gcatcggcatcggcatcggcatcggcatcggcatcggc 728113



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                           
Query: 417    ggcattggcatcggcatcggcatcggcat 445
              ||||| |||||||||||||||||||||||
Sbjct: 728063 ggcatcggcatcggcatcggcatcggcat 728091



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                      
Query: 406    gcatcggaattggcattggcatcggcatcggcatcggcat 445
              ||||||| || ||||| ||| |||||||||||||||||||
Sbjct: 728094 gcatcggcatcggcatcggcgtcggcatcggcatcggcat 728133



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                      
Query: 406    gcatcggaattggcattggcatcggcatcggcatcggcat 445
              ||||||| || ||||| ||||||||| |||||||||||||
Sbjct: 728088 gcatcggcatcggcatcggcatcggcgtcggcatcggcat 728127



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                      
Query: 406    gcatcggaattggcattggcatcggcatcggcatcggcat 445
              ||||||| || ||||| ||||||||||||||| |||||||
Sbjct: 728082 gcatcggcatcggcatcggcatcggcatcggcgtcggcat 728121



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                   
Query: 406    gcatcggaattggcattggcatcggcatcggcatcgg 442
              ||||||| || ||| | ||||||||||||||||||||
Sbjct: 728100 gcatcggcatcggcgtcggcatcggcatcggcatcgg 728136



to top

>ref|NM_192898.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1635

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 406 gcatcggaattggcattggcatcggcatcggcatcggca 444
           ||||||| || ||||| ||||||||||||||||||||||
Sbjct: 5   gcatcggcatcggcatcggcatcggcatcggcatcggca 43



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 417 ggcattggcatcggcatcggcatcggcat 445
           ||||| |||||||||||||||||||||||
Sbjct: 10  ggcatcggcatcggcatcggcatcggcat 38



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 417 ggcattggcatcggcatcggcatcggcat 445
           ||||| |||||||||||||||||||||||
Sbjct: 4   ggcatcggcatcggcatcggcatcggcat 32



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 406 gcatcggaattggcattggcatcggcatcggcatcggca 444
           ||||||| || ||||| |||||||||||||||| |||||
Sbjct: 11  gcatcggcatcggcatcggcatcggcatcggcaccggca 49



to top

>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                              
Query: 415     ttggcattggcatcggcatcggcatcggcat 445
               ||||||| |||||||||||||||||||||||
Sbjct: 2840789 ttggcatcggcatcggcatcggcatcggcat 2840759



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 421     ttggcatcggcatcggcatcggc 443
               |||||||||||||||||||||||
Sbjct: 2592786 ttggcatcggcatcggcatcggc 2592764



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                 
Query: 406     gcatcggaattggcattggcatcggcatcggcat 439
               ||||||| |||||||||||||| ||||| |||||
Sbjct: 2840768 gcatcggcattggcattggcattggcattggcat 2840735



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 423    ggcatcggcatcggcatcggca 444
              ||||||||||||||||||||||
Sbjct: 662242 ggcatcggcatcggcatcggca 662221



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 417     ggcattggcatcggcatcggcatcggcat 445
               ||||| ||||||||||||||||| |||||
Sbjct: 2840781 ggcatcggcatcggcatcggcattggcat 2840753



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                       
Query: 406     gcatcggaattggcattggcatcggcatcggcatcggcat 445
               ||||||| || ||||| ||||||||||| ||||| |||||
Sbjct: 2840786 gcatcggcatcggcatcggcatcggcattggcattggcat 2840747



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                       
Query: 406     gcatcggaattggcattggcatcggcatcggcatcggcat 445
               ||||||| || ||||||||||| ||||| ||||| |||||
Sbjct: 2840774 gcatcggcatcggcattggcattggcattggcattggcat 2840735



to top

>dbj|AP008232.1| Sodalis glossinidius str. 'morsitans' DNA, complete genome
          Length = 4171146

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                      
Query: 406     gcatcggaattggcattggcatcggcatcggcatcggca 444
               ||||||| || ||||| ||||||||||||||||||||||
Sbjct: 1455478 gcatcggcatcggcatcggcatcggcatcggcatcggca 1455516



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                            
Query: 417     ggcattggcatcggcatcggcatcggcat 445
               ||||| |||||||||||||||||||||||
Sbjct: 1455483 ggcatcggcatcggcatcggcatcggcat 1455511



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                            
Query: 417     ggcattggcatcggcatcggcatcggcat 445
               ||||| |||||||||||||||||||||||
Sbjct: 1455477 ggcatcggcatcggcatcggcatcggcat 1455505



to top

>gb|AC023721.3| Drosophila melanogaster X BAC RP98-5L4 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 166902

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 419   cattggcatcggcatcggcatcggcat 445
             |||||||||||||||||||||||||||
Sbjct: 38221 cattggcatcggcatcggcatcggcat 38195



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 414   attggcattggcatcggcatcggcatcggcat 445
             |||||||| ||||||||||||||||| |||||
Sbjct: 38220 attggcatcggcatcggcatcggcattggcat 38189



to top

>gb|AC023687.3| Drosophila melanogaster X BAC RP98-36C7 (Roswell Park Cancer
           Institute Drosophila BAC Library) complete sequence
          Length = 185848

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 419 cattggcatcggcatcggcatcggcat 445
           |||||||||||||||||||||||||||
Sbjct: 282 cattggcatcggcatcggcatcggcat 308



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 414 attggcattggcatcggcatcggcatcggcat 445
           |||||||| ||||||||||||||||| |||||
Sbjct: 283 attggcatcggcatcggcatcggcattggcat 314



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                       
Query: 406      gcatcggaattggcattggcatcggcatcggcatcggca 444
                ||||||| || ||||| ||||||||||||||||||||||
Sbjct: 25036949 gcatcggcatcggcatcggcatcggcatcggcatcggca 25036987



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                             
Query: 417      ggcattggcatcggcatcggcatcggcat 445
                ||||| |||||||||||||||||||||||
Sbjct: 25036954 ggcatcggcatcggcatcggcatcggcat 25036982



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                             
Query: 417      ggcattggcatcggcatcggcatcggcat 445
                ||||| |||||||||||||||||||||||
Sbjct: 25036948 ggcatcggcatcggcatcggcatcggcat 25036976



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                       
Query: 406      gcatcggaattggcattggcatcggcatcggcatcggca 444
                ||||||| || ||||| |||||||||||||||| |||||
Sbjct: 25036955 gcatcggcatcggcatcggcatcggcatcggcaccggca 25036993



to top

>dbj|AP002744.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0006C01
          Length = 153865

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                     
Query: 406    gcatcggaattggcattggcatcggcatcggcatcggca 444
              ||||||| || ||||| ||||||||||||||||||||||
Sbjct: 109472 gcatcggcatcggcatcggcatcggcatcggcatcggca 109510



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                           
Query: 417    ggcattggcatcggcatcggcatcggcat 445
              ||||| |||||||||||||||||||||||
Sbjct: 109477 ggcatcggcatcggcatcggcatcggcat 109505



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                           
Query: 417    ggcattggcatcggcatcggcatcggcat 445
              ||||| |||||||||||||||||||||||
Sbjct: 109471 ggcatcggcatcggcatcggcatcggcat 109499



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                     
Query: 406    gcatcggaattggcattggcatcggcatcggcatcggca 444
              ||||||| || ||||| |||||||||||||||| |||||
Sbjct: 109478 gcatcggcatcggcatcggcatcggcatcggcaccggca 109516



to top

>dbj|AP002839.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0688A04
          Length = 143969

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                    
Query: 406   gcatcggaattggcattggcatcggcatcggcatcggca 444
             ||||||| || ||||| ||||||||||||||||||||||
Sbjct: 36557 gcatcggcatcggcatcggcatcggcatcggcatcggca 36595



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                          
Query: 417   ggcattggcatcggcatcggcatcggcat 445
             ||||| |||||||||||||||||||||||
Sbjct: 36562 ggcatcggcatcggcatcggcatcggcat 36590



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                          
Query: 417   ggcattggcatcggcatcggcatcggcat 445
             ||||| |||||||||||||||||||||||
Sbjct: 36556 ggcatcggcatcggcatcggcatcggcat 36584



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                    
Query: 406   gcatcggaattggcattggcatcggcatcggcatcggca 444
             ||||||| || ||||| |||||||||||||||| |||||
Sbjct: 36563 gcatcggcatcggcatcggcatcggcatcggcaccggca 36601



to top

>dbj|AK074025.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033076L02, full
           insert sequence
          Length = 1901

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 406 gcatcggaattggcattggcatcggcatcggcatcggca 444
           ||||||| || ||||| ||||||||||||||||||||||
Sbjct: 71  gcatcggcatcggcatcggcatcggcatcggcatcggca 109



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 417 ggcattggcatcggcatcggcatcggcat 445
           ||||| |||||||||||||||||||||||
Sbjct: 76  ggcatcggcatcggcatcggcatcggcat 104



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 417 ggcattggcatcggcatcggcatcggcat 445
           ||||| |||||||||||||||||||||||
Sbjct: 70  ggcatcggcatcggcatcggcatcggcat 98



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 406 gcatcggaattggcattggcatcggcatcggcatcggca 444
           ||||||| || ||||| |||||||||||||||| |||||
Sbjct: 77  gcatcggcatcggcatcggcatcggcatcggcaccggca 115



to top

>gb|AE003489.2| Drosophila melanogaster chromosome X, section 41 of 74 of the complete
             sequence
          Length = 291799

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 419   cattggcatcggcatcggcatcggcat 445
             |||||||||||||||||||||||||||
Sbjct: 34782 cattggcatcggcatcggcatcggcat 34756



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 414   attggcattggcatcggcatcggcatcggcat 445
             |||||||| ||||||||||||||||| |||||
Sbjct: 34781 attggcatcggcatcggcatcggcattggcat 34750



to top

>ref|XM_640089.1| Dictyostelium discoideum hypothetical protein (DDB0168699), partial
           mRNA
          Length = 1497

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 420 attggcatcggcatcggcatcggcat 445
           ||||||||||||||||||||||||||
Sbjct: 825 attggcatcggcatcggcatcggcat 800



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 414 attggcattggcatcggcatcggcatc 440
           |||||||| ||||||||||||||||||
Sbjct: 825 attggcatcggcatcggcatcggcatc 799



to top

>gb|AC115607.2| Dictyostelium discoideum chromosome 2 map 4559693-4624405 strain AX4,
            complete sequence
          Length = 64707

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 420  attggcatcggcatcggcatcggcat 445
            ||||||||||||||||||||||||||
Sbjct: 8573 attggcatcggcatcggcatcggcat 8548



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 414  attggcattggcatcggcatcggcatc 440
            |||||||| ||||||||||||||||||
Sbjct: 8573 attggcatcggcatcggcatcggcatc 8547



to top

>ref|XM_797773.1| Trypanosoma cruzi strain CL Brener clathrin heavy chain
            (Tc00.1047053507785.10) partial mRNA
          Length = 1242

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                          
Query: 406  gcatcggaattggcattggcatcggcatcg 435
            ||||||| ||||||||||||||||||||||
Sbjct: 1165 gcatcggcattggcattggcatcggcatcg 1136



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                
Query: 406  gcatcggaattggcattggcatcggcatcggcatcg 441
            ||||||| || ||||||||||| |||||||||||||
Sbjct: 1171 gcatcggcatcggcattggcattggcatcggcatcg 1136



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 419  cattggcatcggcatcggcatcggcat 445
            ||||||||||||||||||||| |||||
Sbjct: 1176 cattggcatcggcatcggcattggcat 1150



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 414  attggcattggcatcggcatcggcatcggcat 445
            |||||||| ||||||||||| ||||| |||||
Sbjct: 1175 attggcatcggcatcggcattggcattggcat 1144



to top

>gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, complete sequence
          Length = 4895836

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                                 
Query: 412     gaattggcattggcatcggcatcggcatcggcat 445
               |||| ||||| |||||||||||||||||||||||
Sbjct: 1879238 gaatcggcatcggcatcggcatcggcatcggcat 1879205



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                   
Query: 408     atcggaattggcattggcatcggcatcggcatcggc 443
               ||||| || ||||| |||||||||||||||||||||
Sbjct: 1879236 atcggcatcggcatcggcatcggcatcggcatcggc 1879201



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                       
Query: 406     gcatcggaattggcattggcatcggcatcggcatcggcat 445
               ||||||| || ||||| ||||||||| |||||||||||||
Sbjct: 1478920 gcatcggcatcggcatcggcatcggcgtcggcatcggcat 1478881



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 423     ggcatcggcatcggcatcggcat 445
               |||||||||||||||||||||||
Sbjct: 1478921 ggcatcggcatcggcatcggcat 1478899



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                          
Query: 417     ggcattggcatcggcatcggcatcggc 443
               ||||| |||||||||||||||||||||
Sbjct: 1478921 ggcatcggcatcggcatcggcatcggc 1478895



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                     
Query: 406     gcatcggaattggcattggcatcggcatcggcatcggc 443
               ||||||| || ||||| ||| |||||||||||||||||
Sbjct: 1478914 gcatcggcatcggcatcggcgtcggcatcggcatcggc 1478877



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                               
Query: 406     gcatcggaattggcattggcatcggcatcggc 437
               ||||||| || ||||| |||||||||||||||
Sbjct: 1879232 gcatcggcatcggcatcggcatcggcatcggc 1879201



to top

>gb|AE011982.1| Xanthomonas axonopodis pv. citri str. 306,  section 360 of 469 of the
             complete genome
          Length = 13732

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                   
Query: 406   gcatcggaattggcattggcatcggcatcggcatcggc 443
             ||||||| || ||||| |||||||||||||||||||||
Sbjct: 13502 gcatcggcatcggcatcggcatcggcatcggcatcggc 13539



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                   
Query: 408   atcggaattggcattggcatcggcatcggcatcggcat 445
             ||||| || ||||| |||||||||||||||||||||||
Sbjct: 13498 atcggcatcggcatcggcatcggcatcggcatcggcat 13535



to top

>gb|AC084463.1|AC084463 Caenorhabditis briggsae cosmid CB037F21, complete sequence
          Length = 85644

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                           
Query: 416   tggcattggcatcggcatcggcatcggcat 445
             |||||| |||||||||||||||||||||||
Sbjct: 63956 tggcatcggcatcggcatcggcatcggcat 63985



to top

>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence
          Length = 3181762

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                           
Query: 417    ggcattggcatcggcatcggcatcggcat 445
              ||||| |||||||||||||||||||||||
Sbjct: 958326 ggcatcggcatcggcatcggcatcggcat 958354



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                               
Query: 414     attggcattggcatcggcatcggcatcggcat 445
               |||||||||||||||||||  |||||||||||
Sbjct: 2134745 attggcattggcatcggcactggcatcggcat 2134714



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                          
Query: 418     gcattggcatcggcatcggcatcggca 444
               |||| ||||||||||||||||||||||
Sbjct: 2134783 gcatcggcatcggcatcggcatcggca 2134757



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                      
Query: 406     gcatcggaattggcattggcatcggcatcggcatcggca 444
               ||||||| | |||||||||||| ||||| ||||||||||
Sbjct: 2134765 gcatcggcactggcattggcattggcattggcatcggca 2134727



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 424     gcatcggcatcggcatcggcat 445
               ||||||||||||||||||||||
Sbjct: 2134783 gcatcggcatcggcatcggcat 2134762



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 424     gcatcggcatcggcatcggcat 445
               ||||||||||||||||||||||
Sbjct: 2087760 gcatcggcatcggcatcggcat 2087739



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 418     gcattggcatcggcatcggcatcggc 443
               |||| |||||||||||||||||||||
Sbjct: 2087760 gcatcggcatcggcatcggcatcggc 2087735



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                
Query: 407    catcggaattggcattggcatcggcatcggcatc 440
              |||||| || ||||| ||||||||||||||||||
Sbjct: 958322 catcggcatcggcatcggcatcggcatcggcatc 958355



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 423     ggcatcggcatcggcatcggc 443
               |||||||||||||||||||||
Sbjct: 1937984 ggcatcggcatcggcatcggc 1938004



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                            
Query: 417     ggcattggcatcggcatcggcatcggcat 445
               ||||| ||| |||||||||||||||||||
Sbjct: 1937972 ggcatcggcgtcggcatcggcatcggcat 1938000



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 425    catcggcatcggcatcggcat 445
              |||||||||||||||||||||
Sbjct: 958322 catcggcatcggcatcggcat 958342



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 423     ggcatcggcatcggcatcgg 442
               ||||||||||||||||||||
Sbjct: 3157287 ggcatcggcatcggcatcgg 3157306



to top

>ref|XM_389444.1| Gibberella zeae PH-1 chromosome 4 hypothetical protein (FG09268.1)
           partial mRNA
          Length = 768

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 417 ggcattggcatcggcatcggcatcggcat 445
           ||||| |||||||||||||||||||||||
Sbjct: 458 ggcatcggcatcggcatcggcatcggcat 430



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 407 catcggaattggcattggcatcggcatcggcatc 440
           |||||| || ||||| ||||||||||||||||||
Sbjct: 462 catcggcatcggcatcggcatcggcatcggcatc 429



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 425 catcggcatcggcatcggcat 445
           |||||||||||||||||||||
Sbjct: 462 catcggcatcggcatcggcat 442



to top

>gb|CP000271.1| Burkholderia xenovorans LB400 chromosome 2, complete sequence
          Length = 3363523

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                            
Query: 417     ggcattggcatcggcatcggcatcggcat 445
               ||||| |||||||||||||||||||||||
Sbjct: 2197202 ggcatcggcatcggcatcggcatcggcat 2197174



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 417   ggcattggcatcggcatcggcatcggc 443
             ||||| |||||||||||||||||||||
Sbjct: 89015 ggcatcggcatcggcatcggcatcggc 89041



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 423   ggcatcggcatcggcatcggcat 445
             |||||||||||||||||||||||
Sbjct: 89015 ggcatcggcatcggcatcggcat 89037



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 417     ggcattggcatcggcatcggcatcg 441
               ||||| |||||||||||||||||||
Sbjct: 2197196 ggcatcggcatcggcatcggcatcg 2197172



to top

>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence
          Length = 3173005

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                            
Query: 417     ggcattggcatcggcatcggcatcggcat 445
               ||||| |||||||||||||||||||||||
Sbjct: 2277033 ggcatcggcatcggcatcggcatcggcat 2277061



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                 
Query: 407     catcggaattggcattggcatcggcatcggcatc 440
               |||||| || ||||| ||||||||||||||||||
Sbjct: 2277029 catcggcatcggcatcggcatcggcatcggcatc 2277062



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 424    gcatcggcatcggcatcggcat 445
              ||||||||||||||||||||||
Sbjct: 249355 gcatcggcatcggcatcggcat 249334



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 418    gcattggcatcggcatcggcatcggc 443
              |||| |||||||||||||||||||||
Sbjct: 249355 gcatcggcatcggcatcggcatcggc 249330



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 425     catcggcatcggcatcggcat 445
               |||||||||||||||||||||
Sbjct: 2277029 catcggcatcggcatcggcat 2277049



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 424    gcatcggcatcggcatcggca 444
              |||||||||||||||||||||
Sbjct: 296560 gcatcggcatcggcatcggca 296540



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                               
Query: 414     attggcattggcatcggcatcggcatcggcat 445
               |||||||||||||| ||||| ||| |||||||
Sbjct: 2532949 attggcattggcattggcattggcttcggcat 2532980



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                      
Query: 406    gcatcggaattggcattggcatcggcatcggcatcggcat 445
              ||||||| || |||| |||||||||||  |||||||||||
Sbjct: 296554 gcatcggcatcggcactggcatcggcactggcatcggcat 296515



to top

>gb|AC092228.1|AC092228 Drosophila melanogaster, chromosome 2L, region 35X-35X, BAC clone
              BACR21J17, complete sequence
          Length = 174974

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 415    ttggcattggcatcggcatcggcat 439
              |||||||||||||||||||||||||
Sbjct: 123940 ttggcattggcatcggcatcggcat 123964



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 421    ttggcatcggcatcggcatcggcat 445
              ||||||| |||||||||||||||||
Sbjct: 123940 ttggcattggcatcggcatcggcat 123964



to top

>gb|AF204951.2|AF204951 Ectocarpus siliculosus virus, complete genome
          Length = 335593

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 417    ggcattggcatcggcatcggcatcggcat 445
              ||||| |||||||||||||||||||||||
Sbjct: 224640 ggcatcggcatcggcatcggcatcggcat 224612



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                 
Query: 408    atcggaattggcattggcatcggcatcggcatcgg 442
              ||||| || ||||| ||||||||||||||||||||
Sbjct: 224643 atcggcatcggcatcggcatcggcatcggcatcgg 224609



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 418    gcattggcatcggcatcggcatcggca 444
              |||| ||||||||||||||||||||||
Sbjct: 224519 gcatcggcatcggcatcggcatcggca 224493



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 424    gcatcggcatcggcatcggcat 445
              ||||||||||||||||||||||
Sbjct: 224519 gcatcggcatcggcatcggcat 224498



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 426    atcggcatcggcatcggcat 445
              ||||||||||||||||||||
Sbjct: 224643 atcggcatcggcatcggcat 224624



to top

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                            
Query: 417     ggcattggcatcggcatcggcatcggcat 445
               ||||| |||||||||||||||||||||||
Sbjct: 5195545 ggcatcggcatcggcatcggcatcggcat 5195573



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                          
Query: 417     ggcattggcatcggcatcggcatcggc 443
               ||||| |||||||||||||||||||||
Sbjct: 5195551 ggcatcggcatcggcatcggcatcggc 5195577



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 423     ggcatcggcatcggcatcggca 444
               ||||||||||||||||||||||
Sbjct: 1125228 ggcatcggcatcggcatcggca 1125207



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 417     ggcattggcatcggcatcggcatcggcat 445
               ||||| |||||||||||||||| ||||||
Sbjct: 1125228 ggcatcggcatcggcatcggcaccggcat 1125200



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                               
Query: 406     gcatcggaattggcattggcatcggcatcggc 437
               ||||||| || ||||| |||||||||||||||
Sbjct: 5195546 gcatcggcatcggcatcggcatcggcatcggc 5195577



to top

>gb|AE003644.4| Drosophila melanogaster chromosome 2L, section 53 of 83 of the complete
             sequence
          Length = 263306

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 415   ttggcattggcatcggcatcggcat 439
             |||||||||||||||||||||||||
Sbjct: 15780 ttggcattggcatcggcatcggcat 15804



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 421   ttggcatcggcatcggcatcggcat 445
             ||||||| |||||||||||||||||
Sbjct: 15780 ttggcattggcatcggcatcggcat 15804



to top

>ref|XM_804685.1| Trypanosoma cruzi strain CL Brener clathrin heavy chain
            (Tc00.1047053506167.50) partial mRNA
          Length = 5115

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                
Query: 406  gcatcggaattggcattggcatcggcatcggcatcg 441
            ||||||| |||||||||||||| ||||| |||||||
Sbjct: 5044 gcatcggcattggcattggcattggcattggcatcg 5009



to top

>gb|U46675.1| Caenorhabditis elegans cosmid F35A5, complete sequence
          Length = 22898

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                            
Query: 416  tggcattggcatcggcatcggcatcggcatag 447
            |||||| ||||||||||||||||| |||||||
Sbjct: 5527 tggcataggcatcggcatcggcataggcatag 5558



to top

>ref|XM_660895.1| Cryptosporidium hominis TU502 hypothetical protein (Chro.80245)
           partial mRNA
          Length = 1818

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 414 attggcattggcatcggcatcggcatcggcat 445
           ||||||||||||||  ||||||||||||||||
Sbjct: 953 attggcattggcatttgcatcggcatcggcat 922



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 414 attggcattggcatcggcatcggcatcggca 444
           ||||||||| |||||||||||||||| ||||
Sbjct: 947 attggcatttgcatcggcatcggcattggca 917



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 414 attggcattggcatcggcatcggcatcggcat 445
           |||||||||||||| |||||  ||||||||||
Sbjct: 959 attggcattggcattggcatttgcatcggcat 928



to top

>emb|AJ849782.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
            line P2-Ost-14
          Length = 2115

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                            
Query: 414  attggcattggcatcggcatcggcatcggcat 445
            |||||||||||||||||||||  |||||||||
Sbjct: 1496 attggcattggcatcggcatcaacatcggcat 1527



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 414  attggcattggcatcggcatcggcatcggcat 445
            |||||||| ||||||  |||||||||||||||
Sbjct: 1502 attggcatcggcatcaacatcggcatcggcat 1533



to top

>emb|AJ849781.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
            line P2-Ost-13
          Length = 2126

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                            
Query: 414  attggcattggcatcggcatcggcatcggcat 445
            |||||||||||||||||||||  |||||||||
Sbjct: 1505 attggcattggcatcggcatcaacatcggcat 1536



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 414  attggcattggcatcggcatcggcatcggcat 445
            |||||||| ||||||  |||||||||||||||
Sbjct: 1511 attggcatcggcatcaacatcggcatcggcat 1542



to top

>emb|AJ849780.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
            line P2-Ost-12
          Length = 2096

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                            
Query: 414  attggcattggcatcggcatcggcatcggcat 445
            |||||||||||||||||||||  |||||||||
Sbjct: 1496 attggcattggcatcggcatcaacatcggcat 1527



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 414  attggcattggcatcggcatcggcatcggcat 445
            |||||||| ||||||  |||||||||||||||
Sbjct: 1502 attggcatcggcatcaacatcggcatcggcat 1533



to top

>emb|AJ849776.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
            line P2-Ost-08
          Length = 2112

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                            
Query: 414  attggcattggcatcggcatcggcatcggcat 445
            |||||||||||||||||||||  |||||||||
Sbjct: 1501 attggcattggcatcggcatcaacatcggcat 1532



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 414  attggcattggcatcggcatcggcatcggcat 445
            |||||||| ||||||  |||||||||||||||
Sbjct: 1507 attggcatcggcatcaacatcggcatcggcat 1538



to top

>emb|AJ849774.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
            line P2-Ost-06
          Length = 2114

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                            
Query: 414  attggcattggcatcggcatcggcatcggcat 445
            |||||||||||||||||||||  |||||||||
Sbjct: 1498 attggcattggcatcggcatcaacatcggcat 1529



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 414  attggcattggcatcggcatcggcatcggcat 445
            |||||||| ||||||  |||||||||||||||
Sbjct: 1504 attggcatcggcatcaacatcggcatcggcat 1535



to top

>emb|AJ849770.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
            line P2-Ost-02
          Length = 2111

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                            
Query: 414  attggcattggcatcggcatcggcatcggcat 445
            |||||||||||||||||||||  |||||||||
Sbjct: 1492 attggcattggcatcggcatcaacatcggcat 1523



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 414  attggcattggcatcggcatcggcatcggcat 445
            |||||||| ||||||  |||||||||||||||
Sbjct: 1498 attggcatcggcatcaacatcggcatcggcat 1529



to top

>tpg|BK002374.1| TPA: TPA_inf: Drosophila melanogaster HDC12296 (HDC12296) gene,
           complete cds
          Length = 3215

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 417 ggcattggcatcggcatcggcatc 440
           ||||||||||||||||||||||||
Sbjct: 276 ggcattggcatcggcatcggcatc 299



to top

>gb|AE011687.1| Xanthomonas axonopodis pv. citri str. 306,  section 65 of 469 of the
            complete genome
          Length = 10029

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 417  ggcattggcatcggcatcggcatcggca 444
            ||||| ||||||||||||||||||||||
Sbjct: 1177 ggcataggcatcggcatcggcatcggca 1150



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 407  catcggaattggcattggcatcggcatcggca 438
            |||||| || ||||| ||||||||||||||||
Sbjct: 1181 catcggcataggcatcggcatcggcatcggca 1150



to top

>ref|NM_076257.1| Caenorhabditis elegans F35A5.5 (F35A5.5) mRNA, complete cds
          Length = 378

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 416 tggcattggcatcggcatcggcatcggcatag 447
           ||||| |||||| |||||||||||||||||||
Sbjct: 120 tggcactggcataggcatcggcatcggcatag 89



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 416 tggcattggcatcggcatcggcatcggcatag 447
           |||||| ||||||||||||||||| |||||||
Sbjct: 114 tggcataggcatcggcatcggcataggcatag 83



to top

>gb|AC008226.10|AC008226 Drosophila melanogaster, chromosome 3R, region 84D-84D, BAC clone
              BACR02B19, complete sequence
          Length = 171286

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 417    ggcattggcatcggcatcggcatc 440
              ||||||||||||||||||||||||
Sbjct: 164649 ggcattggcatcggcatcggcatc 164672



to top

>gb|AC008312.4|AC008312 Drosophila melanogaster, chromosome 3R, region 84D-84D, BAC clone
             BACR06G09, complete sequence
          Length = 188459

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 417   ggcattggcatcggcatcggcatc 440
             ||||||||||||||||||||||||
Sbjct: 82168 ggcattggcatcggcatcggcatc 82191



to top

>gb|AE003671.4| Drosophila melanogaster chromosome 3R, section 13 of 118 of the
             complete sequence
          Length = 315844

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 417   ggcattggcatcggcatcggcatc 440
             ||||||||||||||||||||||||
Sbjct: 61110 ggcattggcatcggcatcggcatc 61133



to top

>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence
          Length = 2914771

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                           
Query: 418     gcattggcatcggcatcggcatcggcat 445
               |||| |||||||||||||||||||||||
Sbjct: 1939955 gcatcggcatcggcatcggcatcggcat 1939928



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 417     ggcattggcatcggcatcggcatcg 441
               ||||| |||||||||||||||||||
Sbjct: 1939950 ggcatcggcatcggcatcggcatcg 1939926



to top

>gb|U39852.1| Caenorhabditis elegans cosmid K10C2, complete sequence
          Length = 34349

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 416   tggcattggcatcggcatcggcatcgg 442
             |||||||||||||||||| ||||||||
Sbjct: 32149 tggcattggcatcggcattggcatcgg 32175



to top

>ref|XM_324182.1| Neurospora crassa OR74A hypothetical protein (NCU04826.1) partial
           mRNA
          Length = 4269

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 423 ggcatcggcatcggcatcggcat 445
           |||||||||||||||||||||||
Sbjct: 210 ggcatcggcatcggcatcggcat 188



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 417 ggcattggcatcggcatcggcatcggcat 445
           ||||| ||||||||||||||||| |||||
Sbjct: 210 ggcatcggcatcggcatcggcattggcat 182



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 406 gcatcggaattggcattggcatcggcatcggcatcggcat 445
           ||||||| |||||||||||||||  |||| ||||| ||||
Sbjct: 197 gcatcggcattggcattggcatcctcatccgcatccgcat 158



to top

>ref|XM_955292.1| Neurospora crassa OR74A hypothetical protein (NCU04826.1) partial
           mRNA
          Length = 4269

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 423 ggcatcggcatcggcatcggcat 445
           |||||||||||||||||||||||
Sbjct: 210 ggcatcggcatcggcatcggcat 188



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 417 ggcattggcatcggcatcggcatcggcat 445
           ||||| ||||||||||||||||| |||||
Sbjct: 210 ggcatcggcatcggcatcggcattggcat 182



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 406 gcatcggaattggcattggcatcggcatcggcatcggcat 445
           ||||||| |||||||||||||||  |||| ||||| ||||
Sbjct: 197 gcatcggcattggcattggcatcctcatccgcatccgcat 158



to top

>gb|AY728266.1| Trypanosoma cruzi voucher Dm28c zinc finger protein 7 (zinc7) gene,
             partial cds; and zinc finger protein 8 (zinc8), heavy
             chain clathrin (claH), and alpha6 proteasome subunit
             (pr29A) genes, complete cds
          Length = 14737

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 419   cattggcatcggcatcggcatcggcat 445
             ||||||||||||||||||||| |||||
Sbjct: 11904 cattggcatcggcatcggcattggcat 11878



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 414   attggcattggcatcggcatcggcatcggcat 445
             |||||||| ||||||||||| ||||| |||||
Sbjct: 11903 attggcatcggcatcggcattggcattggcat 11872



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 406   gcatcggaattggcattggcatcg 429
             ||||||| ||||||||||||||||
Sbjct: 11893 gcatcggcattggcattggcatcg 11870



to top

>ref|XM_754298.1| Ustilago maydis 521 hypothetical protein (UM03244.1) partial mRNA
          Length = 2199

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 423 ggcatcggcatcggcatcggcat 445
           |||||||||||||||||||||||
Sbjct: 312 ggcatcggcatcggcatcggcat 290



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 417 ggcattggcatcggcatcggcatc 440
           ||||| ||||||||||||||||||
Sbjct: 312 ggcatcggcatcggcatcggcatc 289



to top

>ref|XM_724971.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY02196)
            partial mRNA
          Length = 4080

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 405  agcatcggaattggcattggcatcggcatcggcat 439
            |||||||| |||||||||||||| ||||| |||||
Sbjct: 4078 agcatcggcattggcattggcattggcattggcat 4044



to top

>emb|AL939120.1|SCO939120 Streptomyces coelicolor A3(2) complete genome; segment 17/29
          Length = 248550

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 423   ggcatcggcatcggcatcggcat 445
             |||||||||||||||||||||||
Sbjct: 51390 ggcatcggcatcggcatcggcat 51368



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 417   ggcattggcatcggcatcggcatcggc 443
             ||||| |||||||||||||||||||||
Sbjct: 51390 ggcatcggcatcggcatcggcatcggc 51364



to top

>emb|AL596170.1| Listeria innocua Clip11262 complete genome, segment 8/12
          Length = 313450

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 423    ggcatcggcatcggcatcggcat 445
              |||||||||||||||||||||||
Sbjct: 134711 ggcatcggcatcggcatcggcat 134733



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 417    ggcattggcatcggcatcggcatcggcat 445
              ||||| |||||||||||||||||| ||||
Sbjct: 134711 ggcatcggcatcggcatcggcatctgcat 134739



to top

>emb|AJ849790.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
            line P2-O3+4-28
          Length = 2110

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 418  gcattggcatcggcatcggcatc 440
            |||||||||||||||||||||||
Sbjct: 1486 gcattggcatcggcatcggcatc 1508



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 414  attggcattggcatcggcatcggcatcggcat 445
            |||||||| ||||||||||||  |||||||||
Sbjct: 1488 attggcatcggcatcggcatcaacatcggcat 1519



to top

>emb|AJ849787.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
            line P2-O3+4-25
          Length = 2105

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 418  gcattggcatcggcatcggcatc 440
            |||||||||||||||||||||||
Sbjct: 1487 gcattggcatcggcatcggcatc 1509



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 414  attggcattggcatcggcatcggcatcggcat 445
            |||||||| ||||||||||||  |||||||||
Sbjct: 1489 attggcatcggcatcggcatcaacatcggcat 1520



to top

>emb|AJ849786.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
            line P2-O3+4-24
          Length = 2094

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 418  gcattggcatcggcatcggcatc 440
            |||||||||||||||||||||||
Sbjct: 1479 gcattggcatcggcatcggcatc 1501



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 414  attggcattggcatcggcatcggcatcggcat 445
            |||||||| ||||||||||||  |||||||||
Sbjct: 1481 attggcatcggcatcggcatcaacatcggcat 1512



to top

>emb|AJ849775.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
            line P2-Ost-07
          Length = 2106

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 418  gcattggcatcggcatcggcatc 440
            |||||||||||||||||||||||
Sbjct: 1500 gcattggcatcggcatcggcatc 1522



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 414  attggcattggcatcggcatcggcatcggcat 445
            |||||||| ||||||||||||  |||||||||
Sbjct: 1502 attggcatcggcatcggcatcaacatcggcat 1533



to top

>emb|AJ849773.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
            line P2-Ost-05
          Length = 2123

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 418  gcattggcatcggcatcggcatc 440
            |||||||||||||||||||||||
Sbjct: 1498 gcattggcatcggcatcggcatc 1520



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 414  attggcattggcatcggcatcggcatcggcat 445
            |||||||| ||||||||||||  |||||||||
Sbjct: 1500 attggcatcggcatcggcatcaacatcggcat 1531



to top

>emb|AJ849772.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
            line P2-Ost-04
          Length = 2133

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 418  gcattggcatcggcatcggcatc 440
            |||||||||||||||||||||||
Sbjct: 1504 gcattggcatcggcatcggcatc 1526



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 425  catcggcatcggcatcggcat 445
            |||||||||||||||||||||
Sbjct: 1529 catcggcatcggcatcggcat 1549



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 423  ggcatcggcatcggcatcgg 442
            ||||||||||||||||||||
Sbjct: 1533 ggcatcggcatcggcatcgg 1552



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 414  attggcattggcatcggcatcggcatcggcat 445
            |||||||| ||||||||||||  |||||||||
Sbjct: 1506 attggcatcggcatcggcatcaacatcggcat 1537



to top

>gb|AC132166.1| Drosophila pseudoobscura  FOSMID DPSF1-548A16 (Children's Hospital
             Oakland Research Institute Drosophila pseudoobscura FOSMID
             Library) complete sequence
          Length = 40715

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 423   ggcatcggcatcggcatcggcat 445
             |||||||||||||||||||||||
Sbjct: 28895 ggcatcggcatcggcatcggcat 28873



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 425   catcggcatcggcatcggcat 445
             |||||||||||||||||||||
Sbjct: 28899 catcggcatcggcatcggcat 28879



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 417   ggcattggcatcggcatcggcatcggcat 445
             ||||| ||||||||||||||||| |||||
Sbjct: 28895 ggcatcggcatcggcatcggcatgggcat 28867



to top

>gb|AE012148.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 56 of
            460 of the complete genome
          Length = 10978

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 423  ggcatcggcatcggcatcggcat 445
            |||||||||||||||||||||||
Sbjct: 5937 ggcatcggcatcggcatcggcat 5915



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 425  catcggcatcggcatcggcat 445
            |||||||||||||||||||||
Sbjct: 5941 catcggcatcggcatcggcat 5921



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 417  ggcattggcatcggcatcggcatc 440
            ||||| ||||||||||||||||||
Sbjct: 5937 ggcatcggcatcggcatcggcatc 5914



to top

>gb|AC007754.4|AC007754 Drosophila melanogaster, chromosome 3R, region 87E-87E, BAC clone
            BACR05K08, complete sequence
          Length = 188967

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 423  ggcatcggcatcggcatcggcat 445
            |||||||||||||||||||||||
Sbjct: 4003 ggcatcggcatcggcatcggcat 4025



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 417  ggcattggcatcggcatcggcatc 440
            ||||| ||||||||||||||||||
Sbjct: 4003 ggcatcggcatcggcatcggcatc 4026



to top

>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome
          Length = 5148708

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 423    ggcatcggcatcggcatcggcat 445
              |||||||||||||||||||||||
Sbjct: 617931 ggcatcggcatcggcatcggcat 617909



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 425    catcggcatcggcatcggcat 445
              |||||||||||||||||||||
Sbjct: 617935 catcggcatcggcatcggcat 617915



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 415    ttggcattggcatcggcatcggcat 439
              ||||| |||||||||||||||||||
Sbjct: 207895 ttggcgttggcatcggcatcggcat 207871



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 417    ggcattggcatcggcatcggcatc 440
              ||||| ||||||||||||||||||
Sbjct: 617931 ggcatcggcatcggcatcggcatc 617908



to top

>ref|NM_076683.1| Caenorhabditis elegans GRound-Like (grd related) family member
           (grl-6) (grl-6) mRNA, complete cds
          Length = 723

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 416 tggcattggcatcggcatcggcatcgg 442
           |||||||||||||||||| ||||||||
Sbjct: 156 tggcattggcatcggcattggcatcgg 130



to top

>gb|AC091501.1|AC091501 Drosophila melanogaster, chromosome 2R, region 53D-53E, BAC clone
             BACR36P23, complete sequence
          Length = 198390

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 423   ggcatcggcatcggcatcggcat 445
             |||||||||||||||||||||||
Sbjct: 81264 ggcatcggcatcggcatcggcat 81286



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 417   ggcattggcatcggcatcggcatc 440
             ||||| ||||||||||||||||||
Sbjct: 81264 ggcatcggcatcggcatcggcatc 81287



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 423      ggcatcggcatcggcatcggcat 445
                |||||||||||||||||||||||
Sbjct: 27162457 ggcatcggcatcggcatcggcat 27162435



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                           
Query: 417      ggcattggcatcggcatcggcatcggc 443
                ||||| |||||||||||||||||||||
Sbjct: 27162457 ggcatcggcatcggcatcggcatcggc 27162431



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 425      catcggcatcggcatcggcat 445
                |||||||||||||||||||||
Sbjct: 27162461 catcggcatcggcatcggcat 27162441



to top

>gb|AC009211.5|AC009211 Drosophila melanogaster, chromosome 3R, region 87D11-87E3, BAC clone
              BACR48D15, complete sequence
          Length = 184272

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 423    ggcatcggcatcggcatcggcat 445
              |||||||||||||||||||||||
Sbjct: 150339 ggcatcggcatcggcatcggcat 150361



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 417    ggcattggcatcggcatcggcatc 440
              ||||| ||||||||||||||||||
Sbjct: 150339 ggcatcggcatcggcatcggcatc 150362



to top

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                          
Query: 417     ggcattggcatcggcatcggcatcggc 443
               ||||| |||||||||||||||||||||
Sbjct: 2415138 ggcatcggcatcggcatcggcatcggc 2415164



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 423     ggcatcggcatcggcatcggcat 445
               |||||||||||||||||||||||
Sbjct: 2415138 ggcatcggcatcggcatcggcat 2415160



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                          
Query: 417     ggcattggcatcggcatcggcatcggc 443
               ||||| |||||||||||||||||||||
Sbjct: 2415075 ggcatcggcatcggcatcggcatcggc 2415101



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 423     ggcatcggcatcggcatcggcat 445
               |||||||||||||||||||||||
Sbjct: 2415075 ggcatcggcatcggcatcggcat 2415097



to top

>gb|AY190945.1| Drosophila pseudoobscura clone DPSF01_10_G08 (D1416) genomic sequence
          Length = 38050

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 417  ggcattggcatcggcatcggcatcggc 443
            ||||| |||||||||||||||||||||
Sbjct: 7922 ggcataggcatcggcatcggcatcggc 7896



to top

>dbj|AP003633.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0637D03
          Length = 180159

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 423   ggcatcggcatcggcatcggcat 445
             |||||||||||||||||||||||
Sbjct: 19473 ggcatcggcatcggcatcggcat 19451



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 417   ggcattggcatcggcatcggcatcggc 443
             ||||| |||||||||||||||||||||
Sbjct: 19473 ggcatcggcatcggcatcggcatcggc 19447



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 425   catcggcatcggcatcggcat 445
             |||||||||||||||||||||
Sbjct: 19477 catcggcatcggcatcggcat 19457



to top

>dbj|AP003628.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0473H04
          Length = 155204

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 423    ggcatcggcatcggcatcggcat 445
              |||||||||||||||||||||||
Sbjct: 131267 ggcatcggcatcggcatcggcat 131245



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 417    ggcattggcatcggcatcggcatcggc 443
              ||||| |||||||||||||||||||||
Sbjct: 131267 ggcatcggcatcggcatcggcatcggc 131241



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 425    catcggcatcggcatcggcat 445
              |||||||||||||||||||||
Sbjct: 131271 catcggcatcggcatcggcat 131251



to top

>emb|AJ011617.1|ZMA011617 Zea mays mRNA for SBP-domain protein 4
          Length = 1975

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 423 ggcatcggcatcggcatcggcat 445
           |||||||||||||||||||||||
Sbjct: 445 ggcatcggcatcggcatcggcat 423



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 417 ggcattggcatcggcatcggcatcg 441
           ||||| |||||||||||||||||||
Sbjct: 445 ggcatcggcatcggcatcggcatcg 421



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 418 gcattggcatcggcatcggcatcggcat 445
           |||| |||| ||||||||||||||||||
Sbjct: 456 gcatcggcagcggcatcggcatcggcat 429



to top

>gb|AY111449.1| Zea mays CL1438_-1 mRNA sequence
          Length = 1955

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 423 ggcatcggcatcggcatcggcat 445
           |||||||||||||||||||||||
Sbjct: 445 ggcatcggcatcggcatcggcat 423



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 417 ggcattggcatcggcatcggcatcg 441
           ||||| |||||||||||||||||||
Sbjct: 445 ggcatcggcatcggcatcggcatcg 421



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 418 gcattggcatcggcatcggcatcggcat 445
           |||| |||| ||||||||||||||||||
Sbjct: 456 gcatcggcagcggcatcggcatcggcat 429



to top

>gb|AE003699.3| Drosophila melanogaster chromosome 3R, section 37 of 118 of the
             complete sequence
          Length = 208424

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 423   ggcatcggcatcggcatcggcat 445
             |||||||||||||||||||||||
Sbjct: 20589 ggcatcggcatcggcatcggcat 20611



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 417   ggcattggcatcggcatcggcatc 440
             ||||| ||||||||||||||||||
Sbjct: 20589 ggcatcggcatcggcatcggcatc 20612



to top

>gb|AE003806.3| Drosophila melanogaster chromosome 2R, section 44 of 73 of the complete
              sequence
          Length = 271179

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 423    ggcatcggcatcggcatcggcat 445
              |||||||||||||||||||||||
Sbjct: 176808 ggcatcggcatcggcatcggcat 176830



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 417    ggcattggcatcggcatcggcatc 440
              ||||| ||||||||||||||||||
Sbjct: 176808 ggcatcggcatcggcatcggcatc 176831



to top

>dbj|AB088224.1| Streptomyces rochei plasmid pSLA2-L DNA, complete sequence
          Length = 210614

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 423    ggcatcggcatcggcatcggcat 445
              |||||||||||||||||||||||
Sbjct: 161458 ggcatcggcatcggcatcggcat 161436



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 417    ggcattggcatcggcatcggcatcggc 443
              ||||| |||||||||||||||||||||
Sbjct: 161458 ggcatcggcatcggcatcggcatcggc 161432



to top

>gb|AC004287.1|AC004287 Drosophila melanogaster DNA sequence (P1 DS02309 (D166)), complete
             sequence
          Length = 70841

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 423   ggcatcggcatcggcatcggcat 445
             |||||||||||||||||||||||
Sbjct: 53780 ggcatcggcatcggcatcggcat 53802



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 417   ggcattggcatcggcatcggcatc 440
             ||||| ||||||||||||||||||
Sbjct: 53780 ggcatcggcatcggcatcggcatc 53803



to top

>dbj|AP004533.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT14G02, TM0080,
            complete sequence
          Length = 76730

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 423  ggcatcggcatcggcatcggcat 445
            |||||||||||||||||||||||
Sbjct: 4563 ggcatcggcatcggcatcggcat 4541



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 417  ggcattggcatcggcatcggcatcggc 443
            ||||| |||||||||||||||||||||
Sbjct: 4563 ggcatcggcatcggcatcggcatcggc 4537



to top

>gb|CP000081.1| Leishmania major chromosome 35, complete sequence
          Length = 2090491

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 423    ggcatcggcatcggcatcggca 444
              ||||||||||||||||||||||
Sbjct: 448849 ggcatcggcatcggcatcggca 448870



to top

>gb|AC007146.15| Drosophila melanogaster clone BACR02J20, complete sequence
          Length = 164907

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 416   tggcattggcatcggcatcggcatcggcat 445
             |||||| |||||| ||||||||||||||||
Sbjct: 40223 tggcatgggcatctgcatcggcatcggcat 40194



to top

>gb|AC008138.5| Drosophila melanogaster clone BACR27A15, complete sequence
          Length = 178208

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 416    tggcattggcatcggcatcggcatcggcat 445
              |||||| |||||| ||||||||||||||||
Sbjct: 111511 tggcatgggcatctgcatcggcatcggcat 111482



to top

>ref|XM_360655.1| Magnaporthe grisea 70-15 hypothetical protein (MG03198.4) partial
           mRNA
          Length = 2037

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 424 gcatcggcatcggcatcggcat 445
           ||||||||||||||||||||||
Sbjct: 437 gcatcggcatcggcatcggcat 416



to top

>ref|XM_957117.1| Neurospora crassa OR74A hypothetical protein (NCU05211.1) partial
           mRNA
          Length = 4686

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 407 catcggaattggcattggcatcggca 432
           |||||| |||||||||||||||||||
Sbjct: 784 catcggcattggcattggcatcggca 759



to top

>ref|XM_324567.1| Neurospora crassa OR74A hypothetical protein (NCU05211.1) partial
           mRNA
          Length = 4686

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 407 catcggaattggcattggcatcggca 432
           |||||| |||||||||||||||||||
Sbjct: 784 catcggcattggcattggcatcggca 759



to top

>emb|BX071122.1|CNS09R1I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 759

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 418 gcattggcatcggcatcggcatcggc 443
           ||||||||||| ||||||||||||||
Sbjct: 386 gcattggcatctgcatcggcatcggc 361



to top

>emb|AL627444.10| Mouse DNA sequence from clone RP23-307A1 on chromosome 11 Contains the
             5' end of the Gabrb2 gene for subunit beta 2
             gamma-aminobutyric acid (GABA-A) receptor, complete
             sequence
          Length = 176814

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 32    gagcagatgacagtagagttgg 53
             ||||||||||||||||||||||
Sbjct: 92562 gagcagatgacagtagagttgg 92583



to top

>gb|AC010571.8| Drosophila melanogaster 3L BAC RP98-22O3 (Roswell Park Cancer Institute
              Drosophila BAC library) complete sequence
          Length = 169138

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                
Query: 414    attggcattggcatcggcatcggcatcggcatag 447
              |||||||||||||| ||||| ||||| |||||||
Sbjct: 136911 attggcattggcattggcattggcattggcatag 136878



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 414    attggcattggcatcggcatcggcatcggc 443
              |||||||||||||| ||||| |||||||||
Sbjct: 136899 attggcattggcattggcataggcatcggc 136870



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                           
Query: 401    aattagcatcggaattggcattggcatcggcatcggcatcggcat 445
              |||| |||| || |||||||||||||| ||||| ||||| |||||
Sbjct: 136930 aattcgcattggcattggcattggcattggcattggcattggcat 136886



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 414    attggcattggcatcggcatcggcatcggcat 445
              |||||||||||||| ||||| ||||| |||||
Sbjct: 136905 attggcattggcattggcattggcataggcat 136874



to top

>gb|AE011937.1| Xanthomonas axonopodis pv. citri str. 306,  section 315 of 469 of the
            complete genome
          Length = 10372

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 417  ggcattggcatcggcatcggca 438
            ||||||||||||||||||||||
Sbjct: 1448 ggcattggcatcggcatcggca 1427



to top

>tpg|BK003377.1| TPA: TPA_inf: Drosophila melanogaster HDC02041 (HDC02041) gene,
           complete cds
          Length = 811

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 416 tggcattggcatcggcatcggcatcggcat 445
           |||||| |||||| ||||||||||||||||
Sbjct: 523 tggcatgggcatctgcatcggcatcggcat 494



to top

>ref|NM_080362.2| Drosophila melanogaster SAM-motif ubiquitously expressed punctatedly
            localized protein CG31868-RA (Samuel), mRNA
          Length = 4167

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 424  gcatcggcatcggcatcggcat 445
            ||||||||||||||||||||||
Sbjct: 2097 gcatcggcatcggcatcggcat 2118



to top

>ref|XM_693167.1| PREDICTED: Danio rerio similar to CG32045-PC, isoform C (LOC569761),
            mRNA
          Length = 3606

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 424  gcatcggcatcggcatcggcat 445
            ||||||||||||||||||||||
Sbjct: 2054 gcatcggcatcggcatcggcat 2075



to top

>ref|XM_688982.1| PREDICTED: Danio rerio similar to chromosome 13 open reading frame 14
            (LOC565712), mRNA
          Length = 7449

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 424  gcatcggcatcggcatcggcat 445
            ||||||||||||||||||||||
Sbjct: 5897 gcatcggcatcggcatcggcat 5918



to top

>gb|AC092226.1|AC092226 Drosophila melanogaster, chromosome 2L, region 32A-32B, BAC clone
             BACR20O15, complete sequence
          Length = 169210

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 424   gcatcggcatcggcatcggcat 445
             ||||||||||||||||||||||
Sbjct: 69298 gcatcggcatcggcatcggcat 69277



to top

>emb|CR377711.1| Pinus pinaster SSR, clone PPA3A03r
          Length = 697

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 414 attggcattggcatcggcatcg 435
           ||||||||||||||||||||||
Sbjct: 547 attggcattggcatcggcatcg 526



to top

>emb|CR377710.1| Pinus pinaster SSR, clone PPA3A03
          Length = 503

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 414 attggcattggcatcggcatcg 435
           ||||||||||||||||||||||
Sbjct: 116 attggcattggcatcggcatcg 137



to top

>emb|CR354459.1| Pinus pinaster SSR, clone PPA3D07
          Length = 151

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 414 attggcattggcatcggcatcg 435
           ||||||||||||||||||||||
Sbjct: 110 attggcattggcatcggcatcg 131



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
               sequence
          Length = 29644043

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 422     tggcatcggcatcggcatcggc 443
               ||||||||||||||||||||||
Sbjct: 5099554 tggcatcggcatcggcatcggc 5099575



to top

>gb|AC009376.7| Drosophila melanogaster 3 BAC RPCI98-1D4 (Roswell Park Cancer Institute
             Human PAC library) complete sequence
          Length = 183948

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                               
Query: 406   gcatcggaattggcattggcatcggcatcggcat 439
             |||||||||| ||||||||||| ||||| |||||
Sbjct: 70247 gcatcggaatcggcattggcatgggcatgggcat 70280



to top

>emb|BX470223.14| Zebrafish DNA sequence from clone DKEY-45P9 in linkage group 10, complete
              sequence
          Length = 247644

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 424    gcatcggcatcggcatcggcat 445
              ||||||||||||||||||||||
Sbjct: 108172 gcatcggcatcggcatcggcat 108193



to top

>dbj|AP005124.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OSJNBa0049I08
          Length = 144379

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 422    tggcatcggcatcggcatcggc 443
              ||||||||||||||||||||||
Sbjct: 141243 tggcatcggcatcggcatcggc 141264



to top

>dbj|AP003743.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1118_E12
          Length = 119691

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 422   tggcatcggcatcggcatcggc 443
             ||||||||||||||||||||||
Sbjct: 55721 tggcatcggcatcggcatcggc 55742



to top

>ref|XM_319527.2| Anopheles gambiae str. PEST ENSANGP00000017913
           (ENSANGG00000015424), partial mRNA
          Length = 833

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 418 gcattggcatcggcatcggcatcggc 443
           ||||||||||| ||||||||||||||
Sbjct: 474 gcattggcatctgcatcggcatcggc 449



to top

>ref|XM_314191.2| Anopheles gambiae str. PEST ENSANGP00000014541
           (ENSANGG00000012052), partial mRNA
          Length = 757

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 418 gcattggcatcggcatcggcatcggc 443
           ||||||||||| ||||||||||||||
Sbjct: 386 gcattggcatctgcatcggcatcggc 361



to top

>emb|CT572999.10| Mouse DNA sequence from clone RP23-6C18 on chromosome 12, complete
             sequence
          Length = 176044

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 424   gcatcggcatcggcatcggcat 445
             ||||||||||||||||||||||
Sbjct: 78743 gcatcggcatcggcatcggcat 78764



to top

>emb|AJ001030.1|SCTAK1 Saccharomyces cerevisiae TAK1 gene
          Length = 6313

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 455  atatccggttctccttcaacat 476
            ||||||||||||||||||||||
Sbjct: 4995 atatccggttctccttcaacat 5016



to top

>gb|AE003632.4| Drosophila melanogaster chromosome 2L, section 41 of 83 of the complete
              sequence
          Length = 244231

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 416    tggcattggcatcggcatcggcatcggcat 445
              |||||| |||||| ||||||||||||||||
Sbjct: 224591 tggcatgggcatctgcatcggcatcggcat 224562



to top

>gb|AE003630.2| Drosophila melanogaster chromosome 2L, section 39 of 83 of the complete
              sequence
          Length = 289460

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 424    gcatcggcatcggcatcggcat 445
              ||||||||||||||||||||||
Sbjct: 262896 gcatcggcatcggcatcggcat 262875



to top

>gb|AE003595.3| Drosophila melanogaster chromosome 3L, section 76 of 83 of the complete
              sequence
          Length = 294272

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                
Query: 414    attggcattggcatcggcatcggcatcggcatag 447
              |||||||||||||| ||||| ||||| |||||||
Sbjct: 204630 attggcattggcattggcattggcattggcatag 204597



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 414    attggcattggcatcggcatcggcatcggc 443
              |||||||||||||| ||||| |||||||||
Sbjct: 204618 attggcattggcattggcataggcatcggc 204589



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                           
Query: 401    aattagcatcggaattggcattggcatcggcatcggcatcggcat 445
              |||| |||| || |||||||||||||| ||||| ||||| |||||
Sbjct: 204649 aattcgcattggcattggcattggcattggcattggcattggcat 204605



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 414    attggcattggcatcggcatcggcatcggcat 445
              |||||||||||||| ||||| ||||| |||||
Sbjct: 204624 attggcattggcattggcattggcataggcat 204593



to top

>gb|AE003516.4| Drosophila melanogaster chromosome 3L, section 69 of 83 of the complete
              sequence
          Length = 305312

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                
Query: 406    gcatcggaattggcattggcatcggcatcggcat 439
              |||||||||| ||||||||||| ||||| |||||
Sbjct: 101307 gcatcggaatcggcattggcatgggcatgggcat 101274



to top

>gb|AC005117.1|AC005117 Drosophila melanogaster, chromosome 2L, region 32D1-32D2, P1 clone
            DS04313, complete sequence
          Length = 69019

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 424  gcatcggcatcggcatcggcat 445
            ||||||||||||||||||||||
Sbjct: 4868 gcatcggcatcggcatcggcat 4847



to top

>gb|U83459.1|SCU83459 Saccharomyces cerevisiae protein kinase Rim15p (RIM15) gene, complete
            cds
          Length = 5313

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 455  atatccggttctccttcaacat 476
            ||||||||||||||||||||||
Sbjct: 4495 atatccggttctccttcaacat 4516



to top

>dbj|D50617.1|YSCCHRVIN Saccharomyces cerevisiae chromosome VI complete DNA sequence
          Length = 270148

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 455   atatccggttctccttcaacat 476
             ||||||||||||||||||||||
Sbjct: 69931 atatccggttctccttcaacat 69910



to top

>ref|NM_130034.1| Arabidopsis thaliana unknown protein AT2G44700 mRNA, complete cds
          Length = 1107

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 425 catcggcatcggcatcggcat 445
           |||||||||||||||||||||
Sbjct: 50  catcggcatcggcatcggcat 70



to top

>gb|AY773871.1| Arabidopsis thaliana clone pENTR221-At2g44700 hypothetical protein
           (At2g44700) gene, complete cds
          Length = 1107

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 425 catcggcatcggcatcggcat 445
           |||||||||||||||||||||
Sbjct: 50  catcggcatcggcatcggcat 70



to top

>gb|AC118289.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBb0099O15, complete sequence
          Length = 137357

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 425   catcggcatcggcatcggcat 445
             |||||||||||||||||||||
Sbjct: 12019 catcggcatcggcatcggcat 12039



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 417      ggcattggcatcggcatcggc 437
                |||||||||||||||||||||
Sbjct: 15398652 ggcattggcatcggcatcggc 15398632



to top

>ref|XM_755045.1| Ustilago maydis 521 hypothetical protein (UM03991.1) partial mRNA
          Length = 3696

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 423  ggcatcggcatcggcatcggc 443
            |||||||||||||||||||||
Sbjct: 2748 ggcatcggcatcggcatcggc 2728



to top

>ref|XM_756693.1| Ustilago maydis 521 hypothetical protein (UM05639.1) partial mRNA
          Length = 4944

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 425  catcggcatcggcatcggcat 445
            |||||||||||||||||||||
Sbjct: 4805 catcggcatcggcatcggcat 4825



to top

>gb|AY247818.1| Arabidopsis thaliana hypothetical protein (At2g44700/F16B22.19)
           mRNA, complete cds
          Length = 1526

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 425 catcggcatcggcatcggcat 445
           |||||||||||||||||||||
Sbjct: 280 catcggcatcggcatcggcat 300



to top

>gb|AC092075.7| Oryza sativa chromosome 3 BAC OSJNBa0017N12 genomic sequence, complete
              sequence
          Length = 164705

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 417    ggcattggcatcggcatcggc 437
              |||||||||||||||||||||
Sbjct: 102874 ggcattggcatcggcatcggc 102894



to top

>gb|AC113301.7| Mus musculus chromosome 8, clone RP23-430G7, complete sequence
          Length = 195985

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 336    atcttggcattttctcttccc 356
              |||||||||||||||||||||
Sbjct: 107729 atcttggcattttctcttccc 107709



to top

>emb|Z99571.2|HS388N15 Human DNA sequence from clone RP3-388N15 on chromosome Xq21.1 Contains
             the gene for a novel protein (LOC340562), complete
             sequence
          Length = 104002

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 184   ttataaaaacgctataacttatagc 208
             |||||||||||||| ||||||||||
Sbjct: 65811 ttataaaaacgctaaaacttatagc 65787



to top

>emb|Z82190.1|HS180M12 Human DNA sequence from clone RP1-180M12 on chromosome 22 Contains
            part of the DEPDC5 gene for DEP domain containing 5 and a
            novel pseudogene similar to e(y)2 protein, complete
            sequence
          Length = 59941

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 582  atcaatgagctgtcttagtct 602
            |||||||||||||||||||||
Sbjct: 1531 atcaatgagctgtcttagtct 1551



to top

>emb|AL138751.18| Human DNA sequence from clone RP11-346E17 on chromosome 9 Contains the
             5' end of a novel gene (CGI-67), a novel gene, a novel
             gene (LOC138240) and a CpG island, complete sequence
          Length = 195844

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 403   ttagcatcggaattggcattggcat 427
             ||||||| |||||||||||||||||
Sbjct: 71094 ttagcattggaattggcattggcat 71118



to top

>emb|BX294147.1| Pirellula sp. strain 1 complete genome; segment 15/24
          Length = 314450

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 425    catcggcatcggcatcggcat 445
              |||||||||||||||||||||
Sbjct: 185432 catcggcatcggcatcggcat 185452



to top

>emb|AJ849795.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
            line P2-O3+4-33
          Length = 2105

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 425  catcggcatcggcatcggcat 445
            |||||||||||||||||||||
Sbjct: 1494 catcggcatcggcatcggcat 1514



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 423  ggcatcggcatcggcatcgg 442
            ||||||||||||||||||||
Sbjct: 1498 ggcatcggcatcggcatcgg 1517



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 414  attggcattggcatcggcatcggcatcggcat 445
            |||||||| ||||||  |||||||||||||||
Sbjct: 1477 attggcatcggcatcaacatcggcatcggcat 1508



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 418  gcattggcatcggcatcggcatcggcat 445
            |||||||||||||||||  |||||||||
Sbjct: 1475 gcattggcatcggcatcaacatcggcat 1502



to top

>emb|AJ849777.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
            line P2-Ost-09
          Length = 2103

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 425  catcggcatcggcatcggcat 445
            |||||||||||||||||||||
Sbjct: 1514 catcggcatcggcatcggcat 1534



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 423  ggcatcggcatcggcatcgg 442
            ||||||||||||||||||||
Sbjct: 1518 ggcatcggcatcggcatcgg 1537



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 414  attggcattggcatcggcatcggcatcggcat 445
            |||||||| ||||||  |||||||||||||||
Sbjct: 1497 attggcatcggcatcaacatcggcatcggcat 1528



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 418  gcattggcatcggcatcggcatcggcat 445
            |||||||||||||||||  |||||||||
Sbjct: 1495 gcattggcatcggcatcaacatcggcat 1522



to top

>emb|AJ849771.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
            line P2-Ost-03
          Length = 2115

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 425  catcggcatcggcatcggcat 445
            |||||||||||||||||||||
Sbjct: 1519 catcggcatcggcatcggcat 1539



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 423  ggcatcggcatcggcatcgg 442
            ||||||||||||||||||||
Sbjct: 1523 ggcatcggcatcggcatcgg 1542



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 414  attggcattggcatcggcatcggcatcggcat 445
            |||||||| ||||||  |||||||||||||||
Sbjct: 1502 attggcatcggcatcaacatcggcatcggcat 1533



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 418  gcattggcatcggcatcggcatcggcat 445
            |||||||||||||||||  |||||||||
Sbjct: 1500 gcattggcatcggcatcaacatcggcat 1527



to top

>gb|AC159242.2| Mus musculus BAC clone RP24-325A23 from chromosome 13, complete
             sequence
          Length = 193570

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 267   tacagcacagcacatacctca 287
             |||||||||||||||||||||
Sbjct: 30737 tacagcacagcacatacctca 30717



to top

>gb|AC104628.6| Drosophila melanogaster X BAC RP98-18C18 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 187772

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 425    catcggcatcggcatcggcat 445
              |||||||||||||||||||||
Sbjct: 158451 catcggcatcggcatcggcat 158431



to top

>gb|AC023705.4| Drosophila melanogaster X BAC RP98-7L6 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 184796

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 425   catcggcatcggcatcggcat 445
             |||||||||||||||||||||
Sbjct: 16394 catcggcatcggcatcggcat 16414



to top

>gb|AC023694.4| Drosophila melanogaster X BAC RP98-18B11 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 170301

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 425   catcggcatcggcatcggcat 445
             |||||||||||||||||||||
Sbjct: 16815 catcggcatcggcatcggcat 16795



to top

>tpg|BK003053.1| TPA: TPA_inf: Drosophila melanogaster HDC17702 (HDC17702) gene,
           partial cds
          Length = 1167

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 425 catcggcatcggcatcggcat 445
           |||||||||||||||||||||
Sbjct: 147 catcggcatcggcatcggcat 127



to top

>gb|AE012111.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 19 of
            460 of the complete genome
          Length = 11732

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 415  ttggcattggcatcggcatcggcat 439
            ||||| |||||||||||||||||||
Sbjct: 9405 ttggcgttggcatcggcatcggcat 9381



to top

>gb|AC023708.4| Drosophila melanogaster X BAC RP98-12B22 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 175355

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 425   catcggcatcggcatcggcat 445
             |||||||||||||||||||||
Sbjct: 61403 catcggcatcggcatcggcat 61383



to top

>dbj|AP007167.1| Aspergillus oryzae RIB40 genomic DNA, SC020
          Length = 1824958

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 423     ggcatcggcatcggcatcggc 443
               |||||||||||||||||||||
Sbjct: 1098768 ggcatcggcatcggcatcggc 1098788



to top

>gb|AC003672.3| Arabidopsis thaliana chromosome 2 clone F16B22 map m336, complete
             sequence
          Length = 109375

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 425   catcggcatcggcatcggcat 445
             |||||||||||||||||||||
Sbjct: 51573 catcggcatcggcatcggcat 51593



to top

>ref|NM_132379.1| Drosophila melanogaster CG12645-RA (CG12645), mRNA
          Length = 498

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 425 catcggcatcggcatcggcat 445
           |||||||||||||||||||||
Sbjct: 234 catcggcatcggcatcggcat 214



to top

>gb|BT023049.1| Drosophila melanogaster IP04019 full insert cDNA
          Length = 1122

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 425 catcggcatcggcatcggcat 445
           |||||||||||||||||||||
Sbjct: 230 catcggcatcggcatcggcat 210



to top

>gb|BT023004.1| Drosophila melanogaster IP04119 full insert cDNA
          Length = 1120

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 425 catcggcatcggcatcggcat 445
           |||||||||||||||||||||
Sbjct: 230 catcggcatcggcatcggcat 210



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 423      ggcatcggcatcggcatcggc 443
                |||||||||||||||||||||
Sbjct: 13222780 ggcatcggcatcggcatcggc 13222760



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 425      catcggcatcggcatcggcat 445
                |||||||||||||||||||||
Sbjct: 23622014 catcggcatcggcatcggcat 23622034



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 417      ggcattggcatcggcatcggc 437
                |||||||||||||||||||||
Sbjct: 15393186 ggcattggcatcggcatcggc 15393166



to top

>gb|AC010984.7| Homo sapiens BAC clone RP11-510C1 from 2, complete sequence
          Length = 191540

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 491   tttccttgtatttatcccctt 511
             |||||||||||||||||||||
Sbjct: 51144 tttccttgtatttatcccctt 51124



to top

>gb|AC140481.3| Homo sapiens BAC clone RP11-1216L17 from 2, complete sequence
          Length = 219471

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 491   tttccttgtatttatcccctt 511
             |||||||||||||||||||||
Sbjct: 48966 tttccttgtatttatcccctt 48986



to top

>gb|AC092602.2| Homo sapiens BAC clone RP11-134G21 from 2, complete sequence
          Length = 166299

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 491   tttccttgtatttatcccctt 511
             |||||||||||||||||||||
Sbjct: 58047 tttccttgtatttatcccctt 58067



to top

>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 423     ggcatcggcatcggcatcggc 443
               |||||||||||||||||||||
Sbjct: 2479420 ggcatcggcatcggcatcggc 2479400



to top

>dbj|AK119817.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-177-A12, full
            insert sequence
          Length = 3753

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 417  ggcattggcatcggcatcggcatcggcat 445
            |||||| |||||| |||||||||||||||
Sbjct: 3017 ggcatttgcatcgccatcggcatcggcat 2989



to top

>dbj|AK110472.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-166-H03, full
           insert sequence
          Length = 2452

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 425 catcggcatcggcatcggcat 445
           |||||||||||||||||||||
Sbjct: 494 catcggcatcggcatcggcat 474



to top

>ref|XM_306539.2| Anopheles gambiae str. PEST ENSANGP00000000078
           (ENSANGG00000000076), partial mRNA
          Length = 516

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 428 cggcatcggcatcggcatagctgta 452
           ||||||||||| |||||||||||||
Sbjct: 241 cggcatcggcaacggcatagctgta 217



to top

>dbj|AK071491.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023098J19, full
           insert sequence
          Length = 1289

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 423 ggcatcggcatcggcatcggc 443
           |||||||||||||||||||||
Sbjct: 818 ggcatcggcatcggcatcggc 798



to top

>gb|AC156581.4| Pan troglodytes BAC clone CH251-372H22 from chromosome unknown,
             complete sequence
          Length = 188418

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 582   atcaatgagctgtcttagtct 602
             |||||||||||||||||||||
Sbjct: 62427 atcaatgagctgtcttagtct 62407



to top

>gb|AE003449.2| Drosophila melanogaster chromosome X, section 33 of 74 of the complete
              sequence
          Length = 307201

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 425    catcggcatcggcatcggcat 445
              |||||||||||||||||||||
Sbjct: 206642 catcggcatcggcatcggcat 206622



to top

>gb|AE003437.3| Drosophila melanogaster chromosome X, section 21 of 74 of the complete
              sequence
          Length = 305376

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 425    catcggcatcggcatcggcat 445
              |||||||||||||||||||||
Sbjct: 270447 catcggcatcggcatcggcat 270427



to top

>dbj|AP002498.3| Homo sapiens genomic DNA, chromosome 11q, clone:CTD-2547H18, complete
              sequence
          Length = 124000

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 479    gctgctttgtgatttccttgt 499
              |||||||||||||||||||||
Sbjct: 115155 gctgctttgtgatttccttgt 115175



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 423      ggcatcggcatcggcatcggc 443
                |||||||||||||||||||||
Sbjct: 13177054 ggcatcggcatcggcatcggc 13177034



to top

>emb|AL732381.3|CNS08C94 Oryza sativa chromosome 12, . BAC OJ1112_F01 of library Monsanto from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 193499

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 423    ggcatcggcatcggcatcggc 443
              |||||||||||||||||||||
Sbjct: 107963 ggcatcggcatcggcatcggc 107983



to top

>gb|AF518567.2| Escherichia coli insertion sequence ISEcp1 disrupted tnpA gene,
           partial sequence; insertion sequence IS50-A transposase
           TnpA (tnpA) and beta-lactamase CTX-M-25 (blactx-m-25)
           genes, complete cds; and unknown gene
          Length = 3853

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 425 catcggcatcggcatcggca 444
           ||||||||||||||||||||
Sbjct: 733 catcggcatcggcatcggca 714



to top

>ref|XM_635980.1| Dictyostelium discoideum putative CAM kinase (DDB0206066), partial
            mRNA
          Length = 8253

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                    
Query: 400  gaattagcatcggaattggcattggcatcggcatcggcat 439
            |||||| ||| || |||||||||||||| ||||| |||||
Sbjct: 1076 gaattatcattggcattggcattggcattggcattggcat 1037



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 414  attggcattggcatcggcatcggcatcggcat 445
            |||||||||||||| ||||| ||||| |||||
Sbjct: 1068 attggcattggcattggcattggcattggcat 1037



to top

>gb|AC007772.6| Drosophila melanogaster clone BACR19P12, complete sequence
          Length = 186607

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 418   gcattggcatcggcatcggcatcg 441
             ||||| ||||||||||||||||||
Sbjct: 55073 gcatttgcatcggcatcggcatcg 55096



to top

>ref|NM_178399.2| Mus musculus RIKEN cDNA 3110035E14 gene (3110035E14Rik), mRNA
          Length = 3189

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 219  ttgaatttatttaacttaaa 238
            ||||||||||||||||||||
Sbjct: 2986 ttgaatttatttaacttaaa 3005



to top

>gb|AC006467.13| Drosophila melanogaster clone BACR03L08, complete sequence
          Length = 170327

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 409   tcggaattggcattggcatcggca 432
             |||| |||||||||||||||||||
Sbjct: 50226 tcggcattggcattggcatcggca 50249



to top

>gb|AC092224.2| Drosophila melanogaster clone BACR17M04, complete sequence
          Length = 145213

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 416  tggcattggcatcggcatcggcatcggc 443
            ||||| ||||| ||||||||||||||||
Sbjct: 3363 tggcagtggcagcggcatcggcatcggc 3390



to top

>gb|AC008097.5| Drosophila melanogaster clone BACR20D06, complete sequence
          Length = 185670

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 414    attggcattggcatcggcatcggcatcggcat 445
              |||||||| |||||||  ||||||||||||||
Sbjct: 103659 attggcatcggcatcgatatcggcatcggcat 103628



to top

>gb|AC010919.11| Drosophila melanogaster clone BACR32K23, complete sequence
          Length = 198967

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 6      cattatacagaagtactgaataca 29
              ||||||||| ||||||||||||||
Sbjct: 117933 cattatacaaaagtactgaataca 117910



to top

>ref|XM_364993.1| Magnaporthe grisea 70-15 hypothetical protein (MG09838.4) partial
            mRNA
          Length = 2403

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 417  ggcattggcatcggcatcggcatc 440
            ||||||| ||||||||||||||||
Sbjct: 1846 ggcattgccatcggcatcggcatc 1869



to top

>gb|AC150553.1| Drosophila melanogaster clone BACR09H20, complete sequence
          Length = 179099

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 409   tcggaattggcattggcatcggca 432
             |||| |||||||||||||||||||
Sbjct: 98101 tcggcattggcattggcatcggca 98124



to top

>gb|AY661659.1| Sorghum bicolor clone BAC 75D9, complete sequence
          Length = 204120

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 424   gcatcggcatcggcatcggc 443
             ||||||||||||||||||||
Sbjct: 69872 gcatcggcatcggcatcggc 69891



to top

>ref|XM_950872.1| Neurospora crassa OR74A hypothetical protein (NCU01443.1) partial
           mRNA
          Length = 2337

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 422 tggcatcggcatcggcatcg 441
           ||||||||||||||||||||
Sbjct: 494 tggcatcggcatcggcatcg 513



to top

>ref|XM_327881.1| Neurospora crassa OR74A hypothetical protein (NCU01443.1) partial
           mRNA
          Length = 2337

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 422 tggcatcggcatcggcatcg 441
           ||||||||||||||||||||
Sbjct: 494 tggcatcggcatcggcatcg 513



to top

>gb|AC147035.3| Pan troglodytes BAC clone RP43-104N19 from 7, complete sequence
          Length = 177446

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 391   tgtgacaaagaattagcatc 410
             ||||||||||||||||||||
Sbjct: 25454 tgtgacaaagaattagcatc 25473



to top

>ref|XM_653113.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN0601.2), mRNA
          Length = 1920

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 426 atcggcatcggcatcggcat 445
           ||||||||||||||||||||
Sbjct: 153 atcggcatcggcatcggcat 172



to top

>ref|XM_454853.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E20031g predicted mRNA
          Length = 1752

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 409 tcggaattggcattggcatcggcatcgg 436
           ||||||||||||| ||||| ||||||||
Sbjct: 391 tcggaattggcatgggcatgggcatcgg 364



to top

>ref|XM_754958.1| Ustilago maydis 521 hypothetical protein (UM03904.1) partial mRNA
          Length = 2367

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 416 tggcattggcatcggcatcggcatcggc 443
           ||||| |||||||||| |||||||||||
Sbjct: 318 tggcagtggcatcggcttcggcatcggc 345



to top

>gb|AC117702.10| Mus musculus chromosome 10, clone RP23-464I2, complete sequence
          Length = 147559

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 447   gctgtaatatatccggttct 466
             ||||||||||||||||||||
Sbjct: 56703 gctgtaatatatccggttct 56722



to top

>ref|XM_449886.1| Candida glabrata CBS138 hypothetical protein (CAGL0M12496g) partial
           mRNA
          Length = 1584

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 414 attggcattggcatcggcatcggcatcggcat 445
           |||||||||||||| ||||| ||||| |||||
Sbjct: 80  attggcattggcattggcatgggcattggcat 49



to top

>ref|XM_449887.1| Candida glabrata CBS138 hypothetical protein (CAGL0M12507g) partial
           mRNA
          Length = 837

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 414 attggcattggcatcggcatcggcatcggcat 445
           |||||||||||||| ||||| ||||| |||||
Sbjct: 567 attggcattggcattggcatgggcattggcat 536



to top

>gb|AC124408.4| Mus musculus BAC clone RP24-262E22 from chromosome 14, complete
             sequence
          Length = 159082

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 414   attggcattggcatcggcat 433
             ||||||||||||||||||||
Sbjct: 79467 attggcattggcatcggcat 79448



to top

>ref|XM_812765.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein
           (MASP) (Tc00.1047053506499.80) partial mRNA
          Length = 846

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 544 ttccaatgacacttcccttg 563
           ||||||||||||||||||||
Sbjct: 252 ttccaatgacacttcccttg 233



to top

>ref|XM_814918.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein
           (MASP) (Tc00.1047053504239.110) partial mRNA
          Length = 849

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 544 ttccaatgacacttcccttg 563
           ||||||||||||||||||||
Sbjct: 252 ttccaatgacacttcccttg 233



to top

>ref|XM_814932.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein
           (MASP) (Tc00.1047053504239.420) partial mRNA
          Length = 849

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 544 ttccaatgacacttcccttg 563
           ||||||||||||||||||||
Sbjct: 252 ttccaatgacacttcccttg 233



to top

>gb|AC007035.3| Homo sapiens BAC clone RP11-104I19 from 7, complete sequence
          Length = 180397

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 510    ttgttatgtgtcatccatta 529
              ||||||||||||||||||||
Sbjct: 119886 ttgttatgtgtcatccatta 119867



to top

>emb|BX957269.5| Zebrafish DNA sequence from clone CH211-12C22 in linkage group 6,
              complete sequence
          Length = 174814

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 175    taatacagtttataaaaacg 194
              ||||||||||||||||||||
Sbjct: 149889 taatacagtttataaaaacg 149908



to top

>emb|AL591046.4| Human DNA sequence from clone RP11-96O10 on chromosome 6, complete
             sequence
          Length = 194466

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 494   ccttgtatttatccccttgt 513
             ||||||||||||||||||||
Sbjct: 89418 ccttgtatttatccccttgt 89437



to top

>emb|AL356503.18| Human DNA sequence from clone RP13-159A24 on chromosome Xq27.1-28,
              complete sequence
          Length = 147043

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 549    atgacacttcccttgcttcc 568
              ||||||||||||||||||||
Sbjct: 100148 atgacacttcccttgcttcc 100167



to top

>emb|X15867.1|MLUVRA Micrococcus luteus homolog of the E.coli uvrA gene
          Length = 3739

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 459  ccggttctccttcaacatca 478
            ||||||||||||||||||||
Sbjct: 2638 ccggttctccttcaacatca 2657



to top

>emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL Y-1140
               of Kluyveromyces lactis
          Length = 2234072

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 409     tcggaattggcattggcatcggcatcgg 436
               ||||||||||||| ||||| ||||||||
Sbjct: 1775895 tcggaattggcatgggcatgggcatcgg 1775922



to top

>emb|CR380959.1| Candida glabrata strain CBS138 chromosome M complete sequence
          Length = 1400893

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                               
Query: 414     attggcattggcatcggcatcggcatcggcat 445
               |||||||||||||| ||||| ||||| |||||
Sbjct: 1244125 attggcattggcattggcatgggcattggcat 1244156



to top

>gb|AC158790.5| Mus musculus chromosome 1, clone RP23-223M9, complete sequence
          Length = 178205

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 219   ttgaatttatttaacttaaa 238
             ||||||||||||||||||||
Sbjct: 55973 ttgaatttatttaacttaaa 55992



to top

>gb|AC103620.12| Mus musculus chromosome 1, clone RP24-219C22, complete sequence
          Length = 171728

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 219    ttgaatttatttaacttaaa 238
              ||||||||||||||||||||
Sbjct: 118362 ttgaatttatttaacttaaa 118381



to top

>emb|BX538352.1| Cryptosporidium parvum chromosome 6, complete sequence; segment 3/4
          Length = 293050

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 414    attggcattggcatcggcatcggcatcggcat 445
              |||||||||||||| ||||| ||||| |||||
Sbjct: 177398 attggcattggcattggcattggcattggcat 177429



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 414    attggcattggcatcggcatcggcatcggcat 445
              |||||||||||||| ||||| ||||| |||||
Sbjct: 177392 attggcattggcattggcattggcattggcat 177423



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 414    attggcattggcatcggcatcggcatcggcat 445
              |||||||||||||| ||||| ||||| |||||
Sbjct: 177386 attggcattggcattggcattggcattggcat 177417



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 414    attggcattggcatcggcatcggcatcggcat 445
              |||||||||||||| ||||| ||||| |||||
Sbjct: 177380 attggcattggcattggcattggcattggcat 177411



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 414    attggcattggcatcggcatcggcatcggcat 445
              |||||||||||||| ||||| ||||| |||||
Sbjct: 177374 attggcattggcattggcattggcattggcat 177405



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 414    attggcattggcatcggcatcggcatcggcat 445
              |||||||||||||| ||||| ||||| |||||
Sbjct: 177368 attggcattggcattggcattggcattggcat 177399



to top

>emb|BX294023.1|NCB20D17 Neurospora crassa DNA linkage group V BAC clone B20D17
          Length = 71593

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 422   tggcatcggcatcggcatcg 441
             ||||||||||||||||||||
Sbjct: 56477 tggcatcggcatcggcatcg 56496



to top

>emb|AL939125.1|SCO939125 Streptomyces coelicolor A3(2) complete genome; segment 22/29
          Length = 295150

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 423   ggcatcggcatcggcatcgg 442
             ||||||||||||||||||||
Sbjct: 50728 ggcatcggcatcggcatcgg 50709



to top

>emb|AL627383.5| Zebrafish DNA sequence from clone RP71-1O18 in linkage group 14
             Contains a novel gene similar to GRIA3 (ionotrophic
             glutamate receptor AMPA 3), a novel gene similar to THOC2
             (THO complex 2) and two CpG islands, complete sequence
          Length = 166395

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 165   tagacagacataatacagtttata 188
             |||||| |||||||||||||||||
Sbjct: 94484 tagacaaacataatacagtttata 94507



to top

>emb|AL021086.1|DMC86E4 Drosophila melanogaster cosmid clone 86E4
          Length = 29352

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 411   ggaattggcattggcatcggcatcggcatcgg 442
             |||||||| ||||||||||| ||||| |||||
Sbjct: 11333 ggaattggaattggcatcggaatcggaatcgg 11364



to top

>emb|AJ849796.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
            line P2-O3+4-36
          Length = 2106

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 414  attggcattggcatcggcatcggcatcggcat 445
            |||||||| ||||||  |||||||||||||||
Sbjct: 1488 attggcatcggcatcaacatcggcatcggcat 1519



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 418  gcattggcatcggcatcggcatcggcat 445
            |||||||||||||||||  |||||||||
Sbjct: 1486 gcattggcatcggcatcaacatcggcat 1513



to top

>emb|AJ849794.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
            line P2-O3+4-32
          Length = 2088

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 414  attggcattggcatcggcatcggcatcggcat 445
            |||||||| ||||||  |||||||||||||||
Sbjct: 1481 attggcatcggcatcaacatcggcatcggcat 1512



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 418  gcattggcatcggcatcggcatcggcat 445
            |||||||||||||||||  |||||||||
Sbjct: 1479 gcattggcatcggcatcaacatcggcat 1506



to top

>emb|AJ849793.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
            line P2-O3+4-31
          Length = 2066

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 414  attggcattggcatcggcatcggcatcggcat 445
            |||||||| ||||||  |||||||||||||||
Sbjct: 1481 attggcatcggcatcaacatcggcatcggcat 1512



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 418  gcattggcatcggcatcggcatcggcat 445
            |||||||||||||||||  |||||||||
Sbjct: 1479 gcattggcatcggcatcaacatcggcat 1506



to top

>emb|AJ849791.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
            line P2-O3+4-29
          Length = 2104

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 414  attggcattggcatcggcatcggcatcggcat 445
            |||||||| ||||||  |||||||||||||||
Sbjct: 1488 attggcatcggcatcaacatcggcatcggcat 1519



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 418  gcattggcatcggcatcggcatcggcat 445
            |||||||||||||||||  |||||||||
Sbjct: 1486 gcattggcatcggcatcaacatcggcat 1513



to top

>emb|AJ849789.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
            line P2-O3+4-27
          Length = 2105

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 414  attggcattggcatcggcatcggcatcggcat 445
            |||||||| ||||||  |||||||||||||||
Sbjct: 1489 attggcatcggcatcaacatcggcatcggcat 1520



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 418  gcattggcatcggcatcggcatcggcat 445
            |||||||||||||||||  |||||||||
Sbjct: 1487 gcattggcatcggcatcaacatcggcat 1514



to top

>emb|AJ849788.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
            line P2-O3+4-26
          Length = 2099

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 414  attggcattggcatcggcatcggcatcggcat 445
            |||||||| ||||||  |||||||||||||||
Sbjct: 1481 attggcatcggcatcaacatcggcatcggcat 1512



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 418  gcattggcatcggcatcggcatcggcat 445
            |||||||||||||||||  |||||||||
Sbjct: 1479 gcattggcatcggcatcaacatcggcat 1506



to top

>emb|AJ849785.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
            line P2-O3+4-23
          Length = 2087

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 414  attggcattggcatcggcatcggcatcggcat 445
            |||||||| ||||||  |||||||||||||||
Sbjct: 1489 attggcatcggcatcaacatcggcatcggcat 1520



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 418  gcattggcatcggcatcggcatcggcat 445
            |||||||||||||||||  |||||||||
Sbjct: 1487 gcattggcatcggcatcaacatcggcat 1514



to top

>emb|AJ849784.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
            line P2-O3+4-22
          Length = 2106

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 414  attggcattggcatcggcatcggcatcggcat 445
            |||||||| ||||||  |||||||||||||||
Sbjct: 1488 attggcatcggcatcaacatcggcatcggcat 1519



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 418  gcattggcatcggcatcggcatcggcat 445
            |||||||||||||||||  |||||||||
Sbjct: 1486 gcattggcatcggcatcaacatcggcat 1513



to top

>emb|AJ849783.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
            line P2-O3+4-21
          Length = 2107

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 414  attggcattggcatcggcatcggcatcggcat 445
            |||||||| ||||||  |||||||||||||||
Sbjct: 1489 attggcatcggcatcaacatcggcatcggcat 1520



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 418  gcattggcatcggcatcggcatcggcat 445
            |||||||||||||||||  |||||||||
Sbjct: 1487 gcattggcatcggcatcaacatcggcat 1514



to top

>emb|AJ849779.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
            line P2-Ost-11
          Length = 2095

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 414  attggcattggcatcggcatcggcatcggcat 445
            |||||||| ||||||  |||||||||||||||
Sbjct: 1495 attggcatcggcatcaacatcggcatcggcat 1526



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 418  gcattggcatcggcatcggcatcggcat 445
            |||||||||||||||||  |||||||||
Sbjct: 1493 gcattggcatcggcatcaacatcggcat 1520



to top

>emb|AJ849769.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
            line P2-Ost-01
          Length = 2088

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 414  attggcattggcatcggcatcggcatcggcat 445
            |||||||| ||||||  |||||||||||||||
Sbjct: 1496 attggcatcggcatcaacatcggcatcggcat 1527



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 418  gcattggcatcggcatcggcatcggcat 445
            |||||||||||||||||  |||||||||
Sbjct: 1494 gcattggcatcggcatcaacatcggcat 1521



to top

>gb|AC093454.3| Drosophila melanogaster 3L BAC RP98-23K2 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 168479

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 422   tggcatcggcatcggcatcg 441
             ||||||||||||||||||||
Sbjct: 73257 tggcatcggcatcggcatcg 73276



to top

>emb|BX005430.14| Zebrafish DNA sequence from clone DKEY-19E4 in linkage group 6,
             complete sequence
          Length = 209866

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 175   taatacagtttataaaaacg 194
             ||||||||||||||||||||
Sbjct: 76736 taatacagtttataaaaacg 76717



to top

>dbj|AB229973.1| Aspergillus oryzae cDNA, contig sequence: AoEST6859
          Length = 548

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 424 gcatcggcatcggcatcggc 443
           ||||||||||||||||||||
Sbjct: 180 gcatcggcatcggcatcggc 161



to top

>ref|NM_168654.1| Drosophila melanogaster CG13073-RA, transcript variant A (CG13073),
           mRNA
          Length = 699

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 422 tggcatcggcatcggcatcg 441
           ||||||||||||||||||||
Sbjct: 279 tggcatcggcatcggcatcg 298



to top

>dbj|AP007155.1| Aspergillus oryzae RIB40 genomic DNA, SC003
          Length = 4170692

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 424     gcatcggcatcggcatcggc 443
               ||||||||||||||||||||
Sbjct: 1564337 gcatcggcatcggcatcggc 1564356



to top

>ref|NM_140588.1| Drosophila melanogaster CG13073-RB, transcript variant B (CG13073),
           mRNA
          Length = 1056

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 422 tggcatcggcatcggcatcg 441
           ||||||||||||||||||||
Sbjct: 529 tggcatcggcatcggcatcg 548



to top

>ref|XM_686765.1| PREDICTED: Danio rerio similar to mKIAA0777 protein (LOC563408), mRNA
          Length = 4042

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 32   gagcagatgacagtagagtt 51
            ||||||||||||||||||||
Sbjct: 2027 gagcagatgacagtagagtt 2008



to top

>gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, complete genome
          Length = 3561584

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 417     ggcattggcatcggcatcgg 436
               ||||||||||||||||||||
Sbjct: 1718074 ggcattggcatcggcatcgg 1718093



to top

>gb|CP000249.1| Frankia sp. CcI3, complete genome
          Length = 5433628

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 423     ggcatcggcatcggcatcgg 442
               ||||||||||||||||||||
Sbjct: 5344121 ggcatcggcatcggcatcgg 5344140



to top

>ref|XM_627731.1| Cryptosporidium parvum Iowa II hypothetical protein (cgd6_3940),
           partial mRNA
          Length = 891

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 414 attggcattggcatcggcatcggcatcggcat 445
           |||||||||||||| ||||| ||||| |||||
Sbjct: 749 attggcattggcattggcattggcattggcat 718



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 414 attggcattggcatcggcatcggcatcggcat 445
           |||||||||||||| ||||| ||||| |||||
Sbjct: 743 attggcattggcattggcattggcattggcat 712



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 414 attggcattggcatcggcatcggcatcggcat 445
           |||||||||||||| ||||| ||||| |||||
Sbjct: 737 attggcattggcattggcattggcattggcat 706



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 414 attggcattggcatcggcatcggcatcggcat 445
           |||||||||||||| ||||| ||||| |||||
Sbjct: 731 attggcattggcattggcattggcattggcat 700



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 414 attggcattggcatcggcatcggcatcggcat 445
           |||||||||||||| ||||| ||||| |||||
Sbjct: 725 attggcattggcattggcattggcattggcat 694



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 414 attggcattggcatcggcatcggcatcggcat 445
           |||||||||||||| ||||| ||||| |||||
Sbjct: 719 attggcattggcattggcattggcattggcat 688



to top

>ref|XM_628599.1| Cryptosporidium parvum Iowa II hypothetical protein (cgd7_4500),
           partial mRNA
          Length = 2511

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 415 ttggcattggcatcggcatcggcatcgg 442
           ||||||||||||| ||||| ||||||||
Sbjct: 580 ttggcattggcattggcattggcatcgg 553



to top

>dbj|AK014123.1| Mus musculus 13 days embryo head cDNA, RIKEN full-length enriched
            library, clone:3110035E14 product:hypothetical protein,
            full insert sequence
          Length = 1707

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 219  ttgaatttatttaacttaaa 238
            ||||||||||||||||||||
Sbjct: 1504 ttgaatttatttaacttaaa 1523



to top

>gb|AC093103.1| Drosophila melanogaster, chromosome 2L, region 35X-36X, BAC clone
              BACR39O07, complete sequence
          Length = 153352

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 416    tggcattggcatcggcatcggcatcggc 443
              ||||| ||||| ||||||||||||||||
Sbjct: 123133 tggcagtggcagcggcatcggcatcggc 123160



to top

>dbj|AK043759.1| Mus musculus 10 days neonate cortex cDNA, RIKEN full-length enriched
            library, clone:A830029A12 product:hypothetical
            Gram-positive cocci surface protein 'anchoring'
            hexapeptide containing protein, full insert sequence
          Length = 3189

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 219  ttgaatttatttaacttaaa 238
            ||||||||||||||||||||
Sbjct: 2986 ttgaatttatttaacttaaa 3005



to top

>dbj|AK043576.1| Mus musculus 10 days neonate cortex cDNA, RIKEN full-length enriched
            library, clone:A830009H09 product:RIKEN cDNA 3110035E14
            gene, full insert sequence
          Length = 3016

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 219  ttgaatttatttaacttaaa 238
            ||||||||||||||||||||
Sbjct: 2832 ttgaatttatttaacttaaa 2851



to top

>emb|CR377733.1| Pinus pinaster SSR, clone PPA3D05r
          Length = 596

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 414 attggcattggcatcggcat 433
           ||||||||||||||||||||
Sbjct: 91  attggcattggcatcggcat 110



to top

>emb|CR377574.1| Pinus pinaster SSR, clone PPA7E08r
          Length = 319

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 414 attggcattggcatcggcat 433
           ||||||||||||||||||||
Sbjct: 120 attggcattggcatcggcat 139



to top

>gb|AC009203.5|AC009203 Drosophila melanogaster, chromosome 2L, region 36E-37C, BAC clone
             BACR07J05, complete sequence
          Length = 172061

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                 
Query: 399   agaattagcatcggaattggcattggcatcggcatc 434
             ||||| || |||||||| ||||| ||||||||||||
Sbjct: 83772 agaatcagaatcggaataggcatcggcatcggcatc 83737



to top

>gb|AC007771.7|AC007771 Drosophila melanogaster, chromosome 3R, region 92E-92F, BAC clone
              BACR26M03, complete sequence
          Length = 197071

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 418    gcattggcatcggcatcggcatcg 441
              ||||| ||||||||||||||||||
Sbjct: 180823 gcatttgcatcggcatcggcatcg 180846



to top

>emb|Z54148.1|BABP26GEN B.abortus bp26 gene
          Length = 1170

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 420 attggcatcggcatcggcat 439
           ||||||||||||||||||||
Sbjct: 783 attggcatcggcatcggcat 764



to top

>dbj|AK111199.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-178-E01, full
           insert sequence
          Length = 2351

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 417 ggcattggcatcggcatcggcatcggca 444
           ||||| ||| ||||||||||||||||||
Sbjct: 657 ggcatcggcgtcggcatcggcatcggca 630



to top

>gb|BC066997.1| Mus musculus RIKEN cDNA 3110035E14 gene, mRNA (cDNA clone MGC:91354
            IMAGE:5703513), complete cds
          Length = 2969

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 219  ttgaatttatttaacttaaa 238
            ||||||||||||||||||||
Sbjct: 2747 ttgaatttatttaacttaaa 2766



to top

>emb|CT806423.2| Pan troglodytes chromosome X clone CH251-25B01 map Xq28, complete
              sequence
          Length = 220032

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 549    atgacacttcccttgcttcc 568
              ||||||||||||||||||||
Sbjct: 197144 atgacacttcccttgcttcc 197163



to top

>gb|AC008369.1|AC008369 Drosophila melanogaster, chromosome 2R, region 52A4-52B4, P1 clones
             BACR48C01 and DS08592, complete sequence
          Length = 192366

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 419   cattggcatcggcatcggca 438
             ||||||||||||||||||||
Sbjct: 59573 cattggcatcggcatcggca 59592



to top

>gb|AE003732.3| Drosophila melanogaster chromosome 3R, section 70 of 118 of the
             complete sequence
          Length = 224529

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 418   gcattggcatcggcatcggcatcg 441
             ||||| ||||||||||||||||||
Sbjct: 17097 gcatttgcatcggcatcggcatcg 17120



to top

>gb|AE003660.2| Drosophila melanogaster chromosome 2L, section 69 of 83 of the complete
              sequence
          Length = 232737

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                  
Query: 399    agaattagcatcggaattggcattggcatcggcatc 434
              ||||| || |||||||| ||||| ||||||||||||
Sbjct: 109532 agaatcagaatcggaataggcatcggcatcggcatc 109497



to top

>gb|AE003645.4| Drosophila melanogaster chromosome 2L, section 54 of 83 of the complete
             sequence
          Length = 262207

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 416   tggcattggcatcggcatcggcatcggc 443
             ||||| ||||| ||||||||||||||||
Sbjct: 16035 tggcagtggcagcggcatcggcatcggc 16008



to top

>gb|AE003810.3| Drosophila melanogaster chromosome 2R, section 40 of 73 of the complete
              sequence
          Length = 271178

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 419    cattggcatcggcatcggca 438
              ||||||||||||||||||||
Sbjct: 136931 cattggcatcggcatcggca 136950



to top

>gb|AE003793.3| Drosophila melanogaster chromosome 2R, section 57 of 73 of the complete
             sequence
          Length = 271902

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 414   attggcattggcatcggcatcggcatcggcat 445
             |||||||| |||||||  ||||||||||||||
Sbjct: 46152 attggcatcggcatcgatatcggcatcggcat 46121



to top

>gb|AE003781.5| Drosophila melanogaster chromosome 2L, section 80 of 83 of the complete
              sequence
          Length = 323775

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 409    tcggaattggcattggcatcggca 432
              |||| |||||||||||||||||||
Sbjct: 264476 tcggcattggcattggcatcggca 264499



to top

>gb|AE003528.3| Drosophila melanogaster chromosome 3L, section 57 of 83 of the complete
              sequence
          Length = 283815

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 422    tggcatcggcatcggcatcg 441
              ||||||||||||||||||||
Sbjct: 193134 tggcatcggcatcggcatcg 193115



to top

>gb|AE003500.4| Drosophila melanogaster chromosome X, section 52 of 74 of the complete
              sequence
          Length = 303344

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 6      cattatacagaagtactgaataca 29
              ||||||||| ||||||||||||||
Sbjct: 285847 cattatacaaaagtactgaataca 285824



to top

>emb|BX001002.4| Zebrafish DNA sequence from clone CH211-51G4 in linkage group 14,
             complete sequence
          Length = 177858

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 32    gagcagatgacagtagagtt 51
             ||||||||||||||||||||
Sbjct: 41669 gagcagatgacagtagagtt 41688



to top

>gb|AC164120.2| Mus musculus BAC clone RP24-289J17 from chromosome 14, complete sequence
          Length = 147050

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 426    atcggcatcggcatcggcat 445
              ||||||||||||||||||||
Sbjct: 105359 atcggcatcggcatcggcat 105378



to top

>gb|AC147598.2| Gallus gallus BAC clone CH261-121K14 from chromosome unknown, complete
             sequence
          Length = 197142

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 168   acagacataatacagtttat 187
             ||||||||||||||||||||
Sbjct: 40037 acagacataatacagtttat 40056



to top

>gb|AE017262.2| Listeria monocytogenes str. 4b F2365, complete genome
          Length = 2905187

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 424     gcatcggcatcggcatcggc 443
               ||||||||||||||||||||
Sbjct: 1850723 gcatcggcatcggcatcggc 1850742



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                       
Query: 406     gcatcggaattggcattggcatcggcatcggcatcggcat 445
               ||||||| || ||| | |||||| ||||||||||||||||
Sbjct: 1849480 gcatcggcatcggcgtcggcatcagcatcggcatcggcat 1849519



to top

>dbj|AB070517.1| Sus scrofa CHRNE, MINK genes for AchR epsilon subunit, GCK family
           kinase, partial cds
          Length = 1585

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 246 tagggcagtttgggcacttg 265
           ||||||||||||||||||||
Sbjct: 134 tagggcagtttgggcacttg 115


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,525,487
Number of Sequences: 3902068
Number of extensions: 5525487
Number of successful extensions: 109854
Number of sequences better than 10.0: 249
Number of HSP's better than 10.0 without gapping: 250
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 107680
Number of HSP's gapped (non-prelim): 1974
length of query: 603
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 580
effective length of database: 17,143,297,704
effective search space: 9943112668320
effective search space used: 9943112668320
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top