ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal31f07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT009480.1| Triticum aestivum clone wr1.pk0038.g11:fis, full ... 323 2e-85
2gb|AY103944.1| Zea mays PCO133356 mRNA sequence 44 0.24
3gb|AC105325.11| Mus musculus chromosome 1, clone RP24-455G23, co... 42 0.96
4gb|AC115917.10| Mus musculus chromosome 1, clone RP24-488H6, com... 42 0.96
5gb|AC092384.5| Homo sapiens chromosome 16 clone RP11-830F9, comp... 42 0.96
6gb|AC169510.1| Mus musculus BAC clone RP23-121E6 from chromosome... 40 3.8
7gb|BT016789.1| Zea mays clone Contig622 mRNA sequence 40 3.8
8gb|AF111103.1|MMHC322F16 Mouse major histocompatibility complex ... 40 3.8
9ref|XM_365787.1| Magnaporthe grisea 70-15 hypothetical protein (... 40 3.8
10gb|AY446862.1| Human herpesvirus 5 strain 3301 RL1 gene, partial... 40 3.8
11gb|AY446859.1| Human herpesvirus 5 strain W RL1, RL5A, RL6, RL10... 40 3.8
12gb|AC146999.1| Human Herpesvirus 5 AD169-BAC isolate, complete s... 40 3.8
13emb|AL713999.28| Human DNA sequence from clone RP11-263K19 on ch... 40 3.8
14emb|AL691429.17| Human DNA sequence from clone RP13-137A17 on ch... 40 3.8
15emb|X17403.1|HEHCMVCG Human cytomegalovirus strain AD169 complet... 40 3.8
16emb|BX294128.19| Zebrafish DNA sequence from clone DKEYP-35F12 i... 40 3.8
17emb|AL590870.14| Mouse DNA sequence from clone RP23-201H16 on ch... 40 3.8
18gb|AC022446.6| Homo sapiens chromosome 5 clone RP11-5H13, comple... 40 3.8
19gb|AC087216.1|AC087216 Mus musculus strain 129svj chromosome 17 ... 40 3.8
20gb|AC004615.1|AC004615 Homo sapiens BAC clone GS1-405L21 from 5p... 40 3.8
21gb|AC154730.3| Mus musculus BAC clone RP23-120M21 from chromosom... 40 3.8
22gb|AF023268.1|AF023268 Homo sapiens clk2 kinase (CLK2), propin1,... 40 3.8
23gb|AC145946.3| Gallus gallus BAC clone CH261-23O21 from chromoso... 40 3.8
24emb|CR974473.23| Mouse DNA sequence from clone RP23-38P5 on chro... 40 3.8

>gb|BT009480.1| Triticum aestivum clone wr1.pk0038.g11:fis, full insert mRNA
           sequence
          Length = 844

 Score =  323 bits (163), Expect = 2e-85
 Identities = 250/275 (90%), Gaps = 8/275 (2%)
 Strand = Plus / Plus

                                                                       
Query: 20  atgtaaccaagctctcaatagtagcccaacacggccaaacaggtgcctgccaatcatagg 79
           |||||||||||| ||||||||||||| |||||||  |||  |||||||||||||||| ||
Sbjct: 51  atgtaaccaagccctcaatagtagccaaacacgggaaaa--ggtgcctgccaatcattgg 108

                                                                       
Query: 80  cagagagaccaggcagatggagcctaacaaccagtgcaaaaacgcaactcaccaaagttc 139
           || ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 109 caaagagaccaggcagatagagcctaacaaccagtgcaaaaacgcaactcaccaaagttc 168

                                                                       
Query: 140 aaccatggaggacaaaacaatctatagcatcattgagac----cgcaaactgacttctaa 195
           |||||||||||||||||||||||||||||||| ||||||     |||||||||| |||||
Sbjct: 169 aaccatggaggacaaaacaatctatagcatca-tgagactgcatgcaaactgac-tctaa 226

                                                                       
Query: 196 actaagagataatgccgtcgctcagagacagcccagcaagctggctggtaggggcgttag 255
            |||||||||||||||||||||||  |  ||||| || |||||||||||||||||||| |
Sbjct: 227 tctaagagataatgccgtcgctcaaggttagcccggcgagctggctggtaggggcgttgg 286

                                              
Query: 256 ggttctgctgctgagccacgttgcggagaacatcc 290
           ||||||||||||| |||||||||||||||||||||
Sbjct: 287 ggttctgctgctgggccacgttgcggagaacatcc 321



to top

>gb|AY103944.1| Zea mays PCO133356 mRNA sequence
          Length = 2499

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                        
Query: 229  cagcaagctggctggtaggggcgttagggttctgctgctgagccacgttgcggagaacat 288
            |||||||||| ||||| |||| ||| | ||| ||||| || ||||| ||| |||||||||
Sbjct: 2150 cagcaagctgactggtcggggtgtttgcgttttgctgatgggccacattgtggagaacat 2091

              
Query: 289  cc 290
            ||
Sbjct: 2090 cc 2089



to top

>gb|AC105325.11| Mus musculus chromosome 1, clone RP24-455G23, complete sequence
          Length = 139801

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 254    agggttctgctgctgagccac 274
              |||||||||||||||||||||
Sbjct: 129129 agggttctgctgctgagccac 129109



to top

>gb|AC115917.10| Mus musculus chromosome 1, clone RP24-488H6, complete sequence
          Length = 186588

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 254   agggttctgctgctgagccac 274
             |||||||||||||||||||||
Sbjct: 25967 agggttctgctgctgagccac 25947



to top

>gb|AC092384.5| Homo sapiens chromosome 16 clone RP11-830F9, complete sequence
          Length = 219070

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 83     agagaccaggcagatggagcc 103
              |||||||||||||||||||||
Sbjct: 106559 agagaccaggcagatggagcc 106539



to top

>gb|AC169510.1| Mus musculus BAC clone RP23-121E6 from chromosome 14, complete sequence
          Length = 214403

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 68    gccaatcataggcagagagaccag 91
             |||||||| |||||||||||||||
Sbjct: 30116 gccaatcacaggcagagagaccag 30093



to top

>gb|BT016789.1| Zea mays clone Contig622 mRNA sequence
          Length = 1208

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 50/60 (83%)
 Strand = Plus / Minus

                                                                       
Query: 231 gcaagctggctggtaggggcgttagggttctgctgctgagccacgttgcggagaacatcc 290
           |||||||| ||||| |||  ||| ||||| |||||  | ||||| |||||||||||||||
Sbjct: 866 gcaagctgactggtcgggaggttcgggttttgctggggggccacattgcggagaacatcc 807



to top

>gb|AF111103.1|MMHC322F16 Mouse major histocompatibility complex region containing the Q region
             of class I
          Length = 159179

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 255   gggttctgctgctgagccac 274
             ||||||||||||||||||||
Sbjct: 63769 gggttctgctgctgagccac 63788



to top

>ref|XM_365787.1| Magnaporthe grisea 70-15 hypothetical protein (MG02489.4) partial
           mRNA
          Length = 1215

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 213 tcgctcagagacagcccagc 232
           ||||||||||||||||||||
Sbjct: 978 tcgctcagagacagcccagc 959



to top

>gb|AY446862.1| Human herpesvirus 5 strain 3301 RL1 gene, partial cds; RL5A, RL6, RL10,
             RL11, RL12, RL13, UL1, UL2, UL4, UL5, UL6, UL7, UL8, UL9,
             UL10, and UL11 genes, complete cds; and UL13 gene, partial
             cds
          Length = 18452

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 102   cctaacaaccagtgcaaaaa 121
             ||||||||||||||||||||
Sbjct: 12705 cctaacaaccagtgcaaaaa 12686



to top

>gb|AY446859.1| Human herpesvirus 5 strain W RL1, RL5A, RL6, RL10, RL11, RL12, RL13,
             UL1, UL2, UL4, UL5, UL6, UL7, UL8, UL9, UL10, and UL11
             genes, complete cds; and UL13 gene, partial cds
          Length = 18472

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 102   cctaacaaccagtgcaaaaa 121
             ||||||||||||||||||||
Sbjct: 12733 cctaacaaccagtgcaaaaa 12714



to top

>gb|AC146999.1| Human Herpesvirus 5 AD169-BAC isolate, complete sequence
          Length = 233739

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 102    cctaacaaccagtgcaaaaa 121
              ||||||||||||||||||||
Sbjct: 208150 cctaacaaccagtgcaaaaa 208169



to top

>emb|AL713999.28| Human DNA sequence from clone RP11-263K19 on chromosome 1 Contains the
             3' end of the TRIM46 gene for tripartite motif-containing
             46, the MUC1 gene for mucin 1 (transmembrane), the THBS3
             gene for thrombospondin 3, two novel genes, the MTX1 gene
             for metaxin 1, the gene for a novel protein similar to
             glucosidase (beta; acid (includes glucosylceramidase))
             (GBA), a metaxin 1 (MTX1) pseudogene, the GBA gene for
             glucosidase (beta; acid (includes glucosylceramidase)),
             the C1orf2 gene for chromosome 1 open reading frame 2, the
             SCAMP3 gene for secretory carrier membrane protein 3, the
             CLK2 gene for CDC-like kinase 2, the HCN3 gene for
             hyperpolarization activated cyclic nucleotide-gated
             potassium channel 3, the PKLR gene for pyruvate kinase
             (liver and RBC) and three CpG islands, complete sequence
          Length = 133525

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 80    cagagagaccaggcagatgg 99
             ||||||||||||||||||||
Sbjct: 32506 cagagagaccaggcagatgg 32525



to top

>emb|AL691429.17| Human DNA sequence from clone RP13-137A17 on chromosome 10 Contains the
             5' end of a novel gene, four novel genes and nine CpG
             islands, complete sequence
          Length = 136299

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 78    ggcagagagaccaggcagat 97
             ||||||||||||||||||||
Sbjct: 93664 ggcagagagaccaggcagat 93683



to top

>emb|X17403.1|HEHCMVCG Human cytomegalovirus strain AD169 complete genome
          Length = 229354

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 102   cctaacaaccagtgcaaaaa 121
             ||||||||||||||||||||
Sbjct: 13702 cctaacaaccagtgcaaaaa 13683



to top

>emb|BX294128.19| Zebrafish DNA sequence from clone DKEYP-35F12 in linkage group 10,
             complete sequence
          Length = 160042

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 219   agagacagcccagcaagctggctg 242
             ||||||||||||||| ||||||||
Sbjct: 95616 agagacagcccagcatgctggctg 95639



to top

>emb|AL590870.14| Mouse DNA sequence from clone RP23-201H16 on chromosome 13 Contains a
              PX19 or SBBI12 or PRELI pseudogene, complete sequence
          Length = 214308

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    ccatggaggacaaaacaatc 161
              ||||||||||||||||||||
Sbjct: 115927 ccatggaggacaaaacaatc 115946



to top

>gb|AC022446.6| Homo sapiens chromosome 5 clone RP11-5H13, complete sequence
          Length = 188534

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 218    cagagacagcccagcaagct 237
              ||||||||||||||||||||
Sbjct: 108329 cagagacagcccagcaagct 108310



to top

>gb|AC087216.1|AC087216 Mus musculus strain 129svj chromosome 17 clone GS1-11M9, complete
              sequence
          Length = 226594

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 255    gggttctgctgctgagccac 274
              ||||||||||||||||||||
Sbjct: 109024 gggttctgctgctgagccac 109043



to top

>gb|AC004615.1|AC004615 Homo sapiens BAC clone GS1-405L21 from 5p15.2, complete sequence
          Length = 235141

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 218    cagagacagcccagcaagct 237
              ||||||||||||||||||||
Sbjct: 199838 cagagacagcccagcaagct 199857



to top

>gb|AC154730.3| Mus musculus BAC clone RP23-120M21 from chromosome 14, complete
             sequence
          Length = 217242

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 68    gccaatcataggcagagagaccag 91
             |||||||| |||||||||||||||
Sbjct: 89451 gccaatcacaggcagagagaccag 89474



to top

>gb|AF023268.1|AF023268 Homo sapiens clk2 kinase (CLK2), propin1, cote1, glucocerebrosidase
             (GBA), and metaxin genes, complete cds; metaxin pseudogene
             and glucocerebrosidase pseudogene; and thrombospondin3
             (THBS3) gene, partial cds
          Length = 75270

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 80    cagagagaccaggcagatgg 99
             ||||||||||||||||||||
Sbjct: 69140 cagagagaccaggcagatgg 69121



to top

>gb|AC145946.3| Gallus gallus BAC clone CH261-23O21 from chromosome unknown, complete
              sequence
          Length = 248690

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 182    aaactgacttctaaactaagagat 205
              |||||||||||||||| |||||||
Sbjct: 169988 aaactgacttctaaacaaagagat 169965



to top

>emb|CR974473.23| Mouse DNA sequence from clone RP23-38P5 on chromosome 17, complete
             sequence
          Length = 219471

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 255   gggttctgctgctgagccac 274
             ||||||||||||||||||||
Sbjct: 63092 gggttctgctgctgagccac 63111


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,171,694
Number of Sequences: 3902068
Number of extensions: 2171694
Number of successful extensions: 66631
Number of sequences better than 10.0: 24
Number of HSP's better than 10.0 without gapping: 24
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 66592
Number of HSP's gapped (non-prelim): 37
length of query: 290
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 268
effective length of database: 17,147,199,772
effective search space: 4595449538896
effective search space used: 4595449538896
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top