>gb|AF111103.1|MMHC322F16 Mouse major histocompatibility complex region containing the Q region
of class I
Length = 159179
Score = 40.1 bits (20), Expect = 3.8
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 255 gggttctgctgctgagccac 274
||||||||||||||||||||
Sbjct: 63769 gggttctgctgctgagccac 63788
>emb|AL713999.28| Human DNA sequence from clone RP11-263K19 on chromosome 1 Contains the
3' end of the TRIM46 gene for tripartite motif-containing
46, the MUC1 gene for mucin 1 (transmembrane), the THBS3
gene for thrombospondin 3, two novel genes, the MTX1 gene
for metaxin 1, the gene for a novel protein similar to
glucosidase (beta; acid (includes glucosylceramidase))
(GBA), a metaxin 1 (MTX1) pseudogene, the GBA gene for
glucosidase (beta; acid (includes glucosylceramidase)),
the C1orf2 gene for chromosome 1 open reading frame 2, the
SCAMP3 gene for secretory carrier membrane protein 3, the
CLK2 gene for CDC-like kinase 2, the HCN3 gene for
hyperpolarization activated cyclic nucleotide-gated
potassium channel 3, the PKLR gene for pyruvate kinase
(liver and RBC) and three CpG islands, complete sequence
Length = 133525
Score = 40.1 bits (20), Expect = 3.8
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 80 cagagagaccaggcagatgg 99
||||||||||||||||||||
Sbjct: 32506 cagagagaccaggcagatgg 32525
>emb|AL691429.17| Human DNA sequence from clone RP13-137A17 on chromosome 10 Contains the
5' end of a novel gene, four novel genes and nine CpG
islands, complete sequence
Length = 136299
Score = 40.1 bits (20), Expect = 3.8
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 78 ggcagagagaccaggcagat 97
||||||||||||||||||||
Sbjct: 93664 ggcagagagaccaggcagat 93683
>emb|CR974473.23| Mouse DNA sequence from clone RP23-38P5 on chromosome 17, complete
sequence
Length = 219471
Score = 40.1 bits (20), Expect = 3.8
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 255 gggttctgctgctgagccac 274
||||||||||||||||||||
Sbjct: 63092 gggttctgctgctgagccac 63111
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,171,694
Number of Sequences: 3902068
Number of extensions: 2171694
Number of successful extensions: 66631
Number of sequences better than 10.0: 24
Number of HSP's better than 10.0 without gapping: 24
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 66592
Number of HSP's gapped (non-prelim): 37
length of query: 290
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 268
effective length of database: 17,147,199,772
effective search space: 4595449538896
effective search space used: 4595449538896
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)