ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal31d05
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|AJ401333.1|SHY401333 Saccharum hybrid cultivar R570 microsat... 44 0.12
2emb|AL591519.5| Human DNA sequence from clone RP11-160E20 on chr... 42 0.48
3gb|AC129605.4| Mus musculus BAC clone RP23-121N17 from chromosom... 40 1.9
4gb|AC154755.2| Mus musculus BAC clone RP24-406B22 from chromosom... 40 1.9
5gb|AC116686.15| Mus musculus chromosome 7, clone RP23-457H7, com... 40 1.9
6dbj|AP004960.1| Lotus japonicus genomic DNA, chromosome 6, clone... 40 1.9
7emb|X17024.1|LM5KDINS Locusta migratoria mRNA for 5-kDa protein ... 40 1.9
8emb|Z29964.1|LMGIRP3 L.migratoria gene for insulin-related pepti... 40 1.9
9ref|XM_521026.1| PREDICTED: Pan troglodytes similar to ubiquitou... 38 7.4
10gb|BC075703.1| Mus musculus ubiquitously transcribed tetratricop... 38 7.4
11gb|BC053433.1| Mus musculus ubiquitously transcribed tetratricop... 38 7.4
12ref|NM_009483.1| Mus musculus ubiquitously transcribed tetratric... 38 7.4
13gb|AC142405.4| Mus musculus BAC clone RP24-559P3 from chromosome... 38 7.4
14ref|NM_021140.1| Homo sapiens ubiquitously transcribed tetratric... 38 7.4
15gb|AC155285.9| Mus musculus 10 BAC RP23-66E4 (Roswell Park Cance... 38 7.4
16ref|XM_857020.1| PREDICTED: Canis familiaris similar to ubiquito... 38 7.4
17ref|XM_845565.1| PREDICTED: Canis familiaris similar to ubiquito... 38 7.4
18gb|AC127414.4| Mus musculus BAC clone RP23-246P24 from chromosom... 38 7.4
19gb|AC104396.7| Mus musculus BAC clone RP23-413J8 from chromosome... 38 7.4
20gb|AC122248.5| Mus musculus BAC clone RP23-156N18 from 7, comple... 38 7.4
21gb|AC122300.3| Mus musculus BAC clone RP23-275E20 from 7, comple... 38 7.4
22emb|BX296557.35| Zebrafish DNA sequence from clone CH211-284O1 i... 38 7.4
23emb|CR352263.9| Zebrafish DNA sequence from clone CH211-120M16 i... 38 7.4
24emb|AL669853.5| Mouse DNA sequence from clone RP23-204F22 on chr... 38 7.4
25emb|CR376838.7| Zebrafish DNA sequence from clone DKEY-15F23 in ... 38 7.4
26emb|BX537263.17| Zebrafish DNA sequence from clone DKEY-208G1 in... 38 7.4
27emb|BX511027.20| Zebrafish DNA sequence from clone CH211-281P14 ... 38 7.4
28dbj|AK080370.1| Mus musculus 3 days neonate thymus cDNA, RIKEN f... 38 7.4
29emb|BX649496.12| Zebrafish DNA sequence from clone CH211-212I24 ... 38 7.4
30emb|BX004760.10| Zebrafish DNA sequence from clone CH211-222O4 i... 38 7.4
31gb|BC093868.1| Homo sapiens ubiquitously transcribed tetratricop... 38 7.4
32ref|XM_228424.3| PREDICTED: Rattus norvegicus similar to ubiquit... 38 7.4
33emb|BX640694.1|HSM806761 Homo sapiens mRNA; cDNA DKFZp686N1481 (... 38 7.4
34gb|AC153960.3| Mus musculus 10 BAC RP24-210O10 (Roswell Park Can... 38 7.4
35dbj|AP002499.5| Homo sapiens genomic DNA, chromosome 11 clone:RP... 38 7.4
36dbj|AP003063.3| Homo sapiens genomic DNA, chromosome 11 clone:RP... 38 7.4
37gb|AF000993.1|HSAF000993 Homo sapiens ubiquitous TPR motif, X is... 38 7.4
38gb|AF000992.1|HSAF000992 Homo sapiens ubiquitous TPR motif, X is... 38 7.4
39gb|AC147562.5| Mus musculus BAC clone RP23-239A13 from 3, comple... 38 7.4
40emb|AL840631.9| Zebrafish DNA sequence from clone DKEY-210J14, c... 38 7.4
41dbj|AB208795.1| Homo sapiens mRNA for ubiquitously transcribed t... 38 7.4
42emb|AL683847.12| Mouse DNA sequence from clone RP23-109A3 on chr... 38 7.4
43emb|AJ002730.1|MMAJ2730 Mus musculus mRNA for ubiquitously trans... 38 7.4 
>emb|AJ401333.1|SHY401333 Saccharum hybrid cultivar R570 microsatellite DNA, clone mSSCIR56
          Length = 838

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 21  acatcaaaataattttacatgt 42
           ||||||||||||||||||||||
Sbjct: 289 acatcaaaataattttacatgt 268
to top
>emb|AL591519.5| Human DNA sequence from clone RP11-160E20 on chromosome 6, complete
             sequence
          Length = 99611

 Score = 42.1 bits (21), Expect = 0.48
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 11    taacaaggacacatcaaaata 31
             |||||||||||||||||||||
Sbjct: 12105 taacaaggacacatcaaaata 12085
to top
>gb|AC129605.4| Mus musculus BAC clone RP23-121N17 from chromosome 7, complete sequence
          Length = 232568

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 31     aattttacatgtgcacagca 50
              ||||||||||||||||||||
Sbjct: 148125 aattttacatgtgcacagca 148106
to top
>gb|AC154755.2| Mus musculus BAC clone RP24-406B22 from chromosome 13, complete sequence
          Length = 180363

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 15     aaggacacatcaaaataattttac 38
              |||||||| |||||||||||||||
Sbjct: 132807 aaggacacctcaaaataattttac 132830
to top
>gb|AC116686.15| Mus musculus chromosome 7, clone RP23-457H7, complete sequence
          Length = 223846

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 14     caaggacacatcaaaataat 33
              ||||||||||||||||||||
Sbjct: 106378 caaggacacatcaaaataat 106359
to top
>dbj|AP004960.1| Lotus japonicus genomic DNA, chromosome 6, clone:LjT19B18, TM0139,
            complete sequence
          Length = 106089

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 19   acacatcaaaataattttacatgt 42
            ||||||| ||||||||||||||||
Sbjct: 1487 acacatccaaataattttacatgt 1464
to top
>emb|X17024.1|LM5KDINS Locusta migratoria mRNA for 5-kDa protein precursor flanked by 2
           members of insulin superfamily
          Length = 686

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 24  tcaaaataattttacatgtgcaca 47
           ||||||||| ||||||||||||||
Sbjct: 645 tcaaaataaatttacatgtgcaca 668
to top
>emb|Z29964.1|LMGIRP3 L.migratoria gene for insulin-related peptide, fragment 2
          Length = 528

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 24  tcaaaataattttacatgtgcaca 47
           ||||||||| ||||||||||||||
Sbjct: 435 tcaaaataaatttacatgtgcaca 458
to top
>ref|XM_521026.1| PREDICTED: Pan troglodytes similar to ubiquitously transcribed
           tetratricopeptide repeat, X chromosome;
           ubiquitously-transcribed TPR gene on the X chromosome;
           ubiquitously transcribed tetratricopeptide repeat gene,
           X chromosome (LOC465593), mRNA
          Length = 1290

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 43  gcacagcagaatacttctg 61
           |||||||||||||||||||
Sbjct: 703 gcacagcagaatacttctg 721
to top
>gb|BC075703.1| Mus musculus ubiquitously transcribed tetratricopeptide repeat
           gene, X chromosome, mRNA (cDNA clone IMAGE:30466975),
           partial cds
          Length = 4304

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 43  gcacagcagaatacttctg 61
           |||||||||||||||||||
Sbjct: 576 gcacagcagaatacttctg 594
to top
>gb|BC053433.1| Mus musculus ubiquitously transcribed tetratricopeptide repeat gene,
            X chromosome, mRNA (cDNA clone MGC:59425 IMAGE:6516368),
            complete cds
          Length = 5309

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 43   gcacagcagaatacttctg 61
            |||||||||||||||||||
Sbjct: 1666 gcacagcagaatacttctg 1684
to top
>ref|NM_009483.1| Mus musculus ubiquitously transcribed tetratricopeptide repeat gene,
            X chromosome (Utx), mRNA
          Length = 5309

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 43   gcacagcagaatacttctg 61
            |||||||||||||||||||
Sbjct: 1666 gcacagcagaatacttctg 1684
to top
>gb|AC142405.4| Mus musculus BAC clone RP24-559P3 from chromosome 5, complete sequence
          Length = 144109

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 29    ataattttacatgtgcaca 47
             |||||||||||||||||||
Sbjct: 40531 ataattttacatgtgcaca 40549
to top
>ref|NM_021140.1| Homo sapiens ubiquitously transcribed tetratricopeptide repeat, X
            chromosome (UTX), mRNA
          Length = 5418

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 43   gcacagcagaatacttctg 61
            |||||||||||||||||||
Sbjct: 1347 gcacagcagaatacttctg 1365
to top
>gb|AC155285.9| Mus musculus 10 BAC RP23-66E4 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 188045

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                        
Query: 14    caaggacacatcaaaataattttacat 40
             ||||||||||||||||| ||| |||||
Sbjct: 20157 caaggacacatcaaaatgattatacat 20131
to top
>ref|XM_857020.1| PREDICTED: Canis familiaris similar to ubiquitously transcribed
            tetratricopeptide repeat, X chromosome, transcript
            variant 6 (LOC491845), mRNA
          Length = 4554

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 43   gcacagcagaatacttctg 61
            |||||||||||||||||||
Sbjct: 1678 gcacagcagaatacttctg 1696
to top
>ref|XM_845565.1| PREDICTED: Canis familiaris similar to ubiquitously transcribed
            tetratricopeptide repeat, X chromosome, transcript
            variant 2 (LOC491845), mRNA
          Length = 5767

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 43   gcacagcagaatacttctg 61
            |||||||||||||||||||
Sbjct: 1678 gcacagcagaatacttctg 1696
to top
>gb|AC127414.4| Mus musculus BAC clone RP23-246P24 from chromosome 7, complete sequence
          Length = 218222

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 24     tcaaaataattttacatgt 42
              |||||||||||||||||||
Sbjct: 193097 tcaaaataattttacatgt 193079
to top
>gb|AC104396.7| Mus musculus BAC clone RP23-413J8 from chromosome 3, complete sequence
          Length = 195860

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 19    acacatcaaaataatttta 37
             |||||||||||||||||||
Sbjct: 10307 acacatcaaaataatttta 10289
to top
>gb|AC122248.5| Mus musculus BAC clone RP23-156N18 from 7, complete sequence
          Length = 198901

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 24     tcaaaataattttacatgt 42
              |||||||||||||||||||
Sbjct: 170017 tcaaaataattttacatgt 170035
to top
>gb|AC122300.3| Mus musculus BAC clone RP23-275E20 from 7, complete sequence
          Length = 182032

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 29    ataattttacatgtgcaca 47
             |||||||||||||||||||
Sbjct: 28296 ataattttacatgtgcaca 28278
to top
>emb|BX296557.35| Zebrafish DNA sequence from clone CH211-284O1 in linkage group 7,
             complete sequence
          Length = 173360

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 37    acatgtgcacagcagaata 55
             |||||||||||||||||||
Sbjct: 48479 acatgtgcacagcagaata 48461
to top
>emb|CR352263.9| Zebrafish DNA sequence from clone CH211-120M16 in linkage group 3,
             complete sequence
          Length = 165166

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 11    taacaaggacacatcaaaataat 33
             |||||||||||||| ||||||||
Sbjct: 88886 taacaaggacacattaaaataat 88864
to top
>emb|AL669853.5| Mouse DNA sequence from clone RP23-204F22 on chromosome 11 Contains
             part of the Abca13 gene for ATP-binding cassette
             sub-family A (ABC1) member 13, complete sequence
          Length = 205759

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 24    tcaaaataattttacatgt 42
             |||||||||||||||||||
Sbjct: 43162 tcaaaataattttacatgt 43180
to top
>emb|CR376838.7| Zebrafish DNA sequence from clone DKEY-15F23 in linkage group 14,
             complete sequence
          Length = 256006

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 37    acatgtgcacagcagaata 55
             |||||||||||||||||||
Sbjct: 72796 acatgtgcacagcagaata 72814
to top
>emb|BX537263.17| Zebrafish DNA sequence from clone DKEY-208G1 in linkage group 14,
              complete sequence
          Length = 166940

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 37     acatgtgcacagcagaata 55
              |||||||||||||||||||
Sbjct: 136832 acatgtgcacagcagaata 136850
to top
>emb|BX511027.20| Zebrafish DNA sequence from clone CH211-281P14 in linkage group 14,
             complete sequence
          Length = 198761

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 37    acatgtgcacagcagaata 55
             |||||||||||||||||||
Sbjct: 90287 acatgtgcacagcagaata 90305
to top
>dbj|AK080370.1| Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched
            library, clone:A630079C23 product:ubiquitously
            transcribed tetratricopeptide repeat gene, X chromosome,
            full insert sequence
          Length = 4193

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 43   gcacagcagaatacttctg 61
            |||||||||||||||||||
Sbjct: 1685 gcacagcagaatacttctg 1703
to top
>emb|BX649496.12| Zebrafish DNA sequence from clone CH211-212I24 in linkage group 18,
              complete sequence
          Length = 243552

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 37     acatgtgcacagcagaata 55
              |||||||||||||||||||
Sbjct: 180304 acatgtgcacagcagaata 180286
to top
>emb|BX004760.10| Zebrafish DNA sequence from clone CH211-222O4 in linkage group 3,
              complete sequence
          Length = 190220

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 11     taacaaggacacatcaaaataat 33
              |||||||||||||| ||||||||
Sbjct: 108637 taacaaggacacattaaaataat 108615
to top
>gb|BC093868.1| Homo sapiens ubiquitously transcribed tetratricopeptide repeat, X
            chromosome, mRNA (cDNA clone MGC:120903 IMAGE:7939713),
            complete cds
          Length = 4326

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 43   gcacagcagaatacttctg 61
            |||||||||||||||||||
Sbjct: 1344 gcacagcagaatacttctg 1362
to top
>ref|XM_228424.3| PREDICTED: Rattus norvegicus similar to ubiquitously transcribed
            tetratricopeptide repeat gene, X chromosome (LOC317178),
            mRNA
          Length = 3348

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 43   gcacagcagaatacttctg 61
            |||||||||||||||||||
Sbjct: 1674 gcacagcagaatacttctg 1692
to top
>emb|BX640694.1|HSM806761 Homo sapiens mRNA; cDNA DKFZp686N1481 (from clone DKFZp686N1481)
          Length = 1946

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 43  gcacagcagaatacttctg 61
           |||||||||||||||||||
Sbjct: 102 gcacagcagaatacttctg 120
to top
>gb|AC153960.3| Mus musculus 10 BAC RP24-210O10 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 162022

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                        
Query: 14    caaggacacatcaaaataattttacat 40
             ||||||||||||||||| ||| |||||
Sbjct: 23214 caaggacacatcaaaatgattatacat 23240
to top
>dbj|AP002499.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-107P10, complete
              sequence
          Length = 176429

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 12     aacaaggacacatcaaaat 30
              |||||||||||||||||||
Sbjct: 173690 aacaaggacacatcaaaat 173672
to top
>dbj|AP003063.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-65M17, complete
              sequence
          Length = 181208

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 12     aacaaggacacatcaaaat 30
              |||||||||||||||||||
Sbjct: 114583 aacaaggacacatcaaaat 114565
to top
>gb|AF000993.1|HSAF000993 Homo sapiens ubiquitous TPR motif, X isoform (UTX) mRNA, alternative
            transcript 2, complete cds
          Length = 5418

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 43   gcacagcagaatacttctg 61
            |||||||||||||||||||
Sbjct: 1347 gcacagcagaatacttctg 1365
to top
>gb|AF000992.1|HSAF000992 Homo sapiens ubiquitous TPR motif, X isoform (UTX) mRNA, alternative
            transcript 1, complete cds
          Length = 4856

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 43   gcacagcagaatacttctg 61
            |||||||||||||||||||
Sbjct: 1347 gcacagcagaatacttctg 1365
to top
>gb|AC147562.5| Mus musculus BAC clone RP23-239A13 from 3, complete sequence
          Length = 167633

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 19    acacatcaaaataatttta 37
             |||||||||||||||||||
Sbjct: 66122 acacatcaaaataatttta 66104
to top
>emb|AL840631.9| Zebrafish DNA sequence from clone DKEY-210J14, complete sequence
          Length = 171481

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 19    acacatcaaaataatttta 37
             |||||||||||||||||||
Sbjct: 19650 acacatcaaaataatttta 19668
to top
>dbj|AB208795.1| Homo sapiens mRNA for ubiquitously transcribed tetratricopeptide
            repeat variant protein
          Length = 5372

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 43   gcacagcagaatacttctg 61
            |||||||||||||||||||
Sbjct: 1651 gcacagcagaatacttctg 1669
to top
>emb|AL683847.12| Mouse DNA sequence from clone RP23-109A3 on chromosome 4, complete
              sequence
          Length = 212973

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 26     aaaataattttacatgtgcacag 48
              |||||||| ||||||||||||||
Sbjct: 206262 aaaataatgttacatgtgcacag 206240
to top
>emb|AJ002730.1|MMAJ2730 Mus musculus mRNA for ubiquitously transcribed TPR gene on the X
            chromosome (Utx)
          Length = 4215

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 43   gcacagcagaatacttctg 61
            |||||||||||||||||||
Sbjct: 1125 gcacagcagaatacttctg 1143


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,358,184
Number of Sequences: 3902068
Number of extensions: 1358184
Number of successful extensions: 96389
Number of sequences better than 10.0: 43
Number of HSP's better than 10.0 without gapping: 43
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 96321
Number of HSP's gapped (non-prelim): 68
length of query: 155
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 133
effective length of database: 17,147,199,772
effective search space: 2280577569676
effective search space used: 2280577569676
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top