ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal31c12
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AY661558.1| Hordeum vulgare subsp. vulgare eIF4E gene locus, ... 70 2e-09
2gb|AY054380.1| Hordeum patagonicum clone HpaLTR-INS Sukkula retr... 56 3e-05
3gb|AY643843.1|AY643842S2 Hordeum vulgare subsp. vulgare clones B... 54 1e-04
4gb|AF474072.1| Hordeum vulgare sp. vulgare cultivar Morex BAC cl... 54 1e-04
5gb|AF453665.1| Hordeum vulgare isolate HV Sukkula retrotransposo... 54 1e-04
6gb|AY054379.1| Hordeum murinum clone HmuLTR-INS Sukkula retrotra... 54 1e-04
7gb|AY054377.1| Hordeum vulgare clone LTR-INS1 Sukkula retrotrans... 54 1e-04
8gb|AY054376.1| Hordeum vulgare Sukkula retrotransposon long term... 54 1e-04
9emb|Y14573.1|HVCH4H Hordeum vulgare DNA for chromosome 4H 54 1e-04
10gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic prote... 54 1e-04
11gb|AY485643.1| Hordeum vulgare subsp. vulgare BAC 615K1, complet... 52 5e-04
12gb|AF474373.1| Hordeum vulgare subsp. vulgare BAC 259I16, comple... 50 0.002
13gb|AY643844.1|AY643842S3 Hordeum vulgare subsp. vulgare clones B... 46 0.028
14gb|AF509775.1| Hordeum vulgare subsp. vulgare isolate RSB409A Rp... 44 0.11
15gb|AF509774.1| Hordeum vulgare subsp. vulgare isolate RSB347 Rpg... 44 0.11
16dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 1.7
17dbj|AP003106.1| Oryza sativa (japonica cultivar-group) genomic D... 40 1.7
18gb|AF118384.1|AF118384 Manduca sexta N-ethylmaleimide sensitive ... 40 1.7
19gb|AC124721.4| Mus musculus chromosome 10 clone RP23-387G19, com... 38 6.9
20emb|CR956396.6| Pig DNA sequence from clone CH242-205N12 on chro... 38 6.9
21gb|AC152937.21| Medicago truncatula clone mth2-96n6, complete se... 38 6.9
22gb|AC153012.4| Mus musculus BAC clone RP23-302F19 from chromosom... 38 6.9
23gb|AC118557.2| Homo sapiens chromosome 1 clone RP11-499N7, compl... 38 6.9
24gb|AC011477.5| Homo sapiens chromosome 19 clone CTC-559E9, compl... 38 6.9
25gb|DQ007006.1| Babesia sp. WA1 clone WA1-GRP78 heat shock protei... 38 6.9
26gb|AC110921.9| Homo sapiens chromosome 17, clone CTD-2653B5, com... 38 6.9
27gb|AC137584.4| Mus musculus BAC clone RP23-351O20 from 9, comple... 38 6.9
28emb|AL671910.9| Mouse DNA sequence from clone RP23-245M12 on chr... 38 6.9 
>gb|AY661558.1| Hordeum vulgare subsp. vulgare eIF4E gene locus, complete sequence
          Length = 439641

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                                 
Query: 79     tgatagtaatggtatctagggaaatggtaatcctgccagagatcccacttg 129
              ||||||||||||||||| |||||||||| ||| |||| |||||||||||||
Sbjct: 325635 tgatagtaatggtatctggggaaatggtcatcttgcctgagatcccacttg 325585



 Score = 61.9 bits (31), Expect = 5e-07
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                                 
Query: 79     tgatagtaatggtatctagggaaatggtaatcctgccagagatcccacttg 129
              ||||||||||||||||| |||||||||| ||| |||| |||||||| ||||
Sbjct: 177413 tgatagtaatggtatctggggaaatggtcatcttgcctgagatcccgcttg 177363



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                                 
Query: 79     tgatagtaatggtatctagggaaatggtaatcctgccagagatcccacttg 129
              |||||||||||||||||  ||||||||| ||| |||| |||||||| ||||
Sbjct: 130080 tgatagtaatggtatctgtggaaatggtcatcttgcctgagatcccgcttg 130030
to top
>gb|AY054380.1| Hordeum patagonicum clone HpaLTR-INS Sukkula retrotransposon long
            terminal repeat, complete sequence
          Length = 7731

 Score = 56.0 bits (28), Expect = 3e-05
 Identities = 64/75 (85%), Gaps = 1/75 (1%)
 Strand = Plus / Minus

                                                                        
Query: 56   aaacgagacaactcncctgacattgatagtaatggtatctagggaaat-ggtaatcctgc 114
            |||||||||||||  | || || |||||||||||||||| |||||||| ||| ||| |||
Sbjct: 2847 aaacgagacaactagcatggcaatgatagtaatggtatccagggaaatgggtcatcttgc 2788

                           
Query: 115  cagagatcccacttg 129
            | |||||||| ||||
Sbjct: 2787 ctgagatcccgcttg 2773
to top
>gb|AY643843.1|AY643842S2 Hordeum vulgare subsp. vulgare clones BAC 519K7 and 799C8 hardness
             locus region
          Length = 129099

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                                
Query: 79    tgatagtaatggtatctagggaaatggtaatcctgccagagatcccacttg 129
             ||||||||||||||||| |||||||| | ||| |||| |||||||| ||||
Sbjct: 69652 tgatagtaatggtatctggggaaatgatcatcttgcctgagatcccgcttg 69702



 Score = 38.2 bits (19), Expect = 6.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                            
Query: 19    atttagcaggtggtaggcaactagacataat 49
             ||||| || |||||||||||| |||||||||
Sbjct: 69592 atttaacaagtggtaggcaacgagacataat 69622
to top
>gb|AF474072.1| Hordeum vulgare sp. vulgare cultivar Morex BAC clone 773k14, complete
             sequence
          Length = 113510

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                                
Query: 79    tgatagtaatggtatctagggaaatggtaatcctgccagagatcccacttg 129
             ||||||||||||||||| |||||||| | ||| |||| |||||||| ||||
Sbjct: 17882 tgatagtaatggtatctggggaaatgatcatcttgcctgagatcccgcttg 17932
to top
>gb|AF453665.1| Hordeum vulgare isolate HV Sukkula retrotransposon, partial sequence
          Length = 7674

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 79   tgatagtaatggtatctagggaaatggtaatcctgccagagatcccacttg 129
            ||||||||||||||||| |||||||| | ||| |||| |||||||| ||||
Sbjct: 2691 tgatagtaatggtatctggggaaatgatcatcttgcctgagatcccgcttg 2641



 Score = 42.1 bits (21), Expect = 0.44
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 19   atttagcaggtggtaggcaactagacata 47
            ||||| ||||||||||||||| |||||||
Sbjct: 2750 atttaacaggtggtaggcaacgagacata 2722
to top
>gb|AY054379.1| Hordeum murinum clone HmuLTR-INS Sukkula retrotransposon long
            terminal repeat, complete sequence
          Length = 7586

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 79   tgatagtaatggtatctagggaaatggtaatcctgccagagatcccacttg 129
            |||||||||||||||| ||||||||| | ||| |||| |||||||| ||||
Sbjct: 2621 tgatagtaatggtatccagggaaatgatcatcttgcccgagatcccgcttg 2571
to top
>gb|AY054377.1| Hordeum vulgare clone LTR-INS1 Sukkula retrotransposon long terminal
            repeat, complete sequence
          Length = 7575

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 79   tgatagtaatggtatctagggaaatggtaatcctgccagagatcccacttg 129
            ||||||||||||||||| |||||||| | ||| |||| |||||||| ||||
Sbjct: 2691 tgatagtaatggtatctggggaaatgatcatcttgcctgagatcccgcttg 2641



 Score = 42.1 bits (21), Expect = 0.44
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 19   atttagcaggtggtaggcaactagacata 47
            ||||| ||||||||||||||| |||||||
Sbjct: 2750 atttaacaggtggtaggcaacgagacata 2722
to top
>gb|AY054376.1| Hordeum vulgare Sukkula retrotransposon long terminal repeat, partial
            and complete sequences
          Length = 11820

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 79   tgatagtaatggtatctagggaaatggtaatcctgccagagatcccacttg 129
            ||||||||||||||||| |||||||| | ||| |||| |||||||| ||||
Sbjct: 2691 tgatagtaatggtatctggggaaatgatcatcttgcctgagatcccgcttg 2641



 Score = 46.1 bits (23), Expect = 0.028
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                                
Query: 79    tgatagtaatggtatctagggaaatggtaatcctgccagagatcccacttg 129
             ||||||||||||||||| |||||||| | ||| |||  |||||||| ||||
Sbjct: 10222 tgatagtaatggtatctggggaaatgatcatcttgcgtgagatcccgcttg 10172



 Score = 42.1 bits (21), Expect = 0.44
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 19   atttagcaggtggtaggcaactagacata 47
            ||||| ||||||||||||||| |||||||
Sbjct: 2750 atttaacaggtggtaggcaacgagacata 2722
to top
>emb|Y14573.1|HVCH4H Hordeum vulgare DNA for chromosome 4H
          Length = 59748

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                                
Query: 79    tgatagtaatggtatctagggaaatggtaatcctgccagagatcccacttg 129
             ||||||||||||||||| |||||||| | ||| |||| |||||||| ||||
Sbjct: 38800 tgatagtaatggtatctggggaaatgatcatcttgcctgagatcccgcttg 38850
to top
>gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic protein 1 (TIP1), tonoplast
            intrinsic protein 2 (TIP2), and Rar1 (Rar1) genes,
            complete cds
          Length = 65979

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 79   tgatagtaatggtatctagggaaatggtaatcctgccagagatcccacttg 129
            ||||||||||||||||| |||||||| | ||| |||| |||||||| ||||
Sbjct: 9574 tgatagtaatggtatctggggaaatgatcatcttgcctgagatcccgcttg 9524
to top
>gb|AY485643.1| Hordeum vulgare subsp. vulgare BAC 615K1, complete sequence
          Length = 114996

 Score = 52.0 bits (26), Expect = 5e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                            
Query: 79     tgatagtaatggtatctagggaaatggtaatcctgccagagatccc 124
              |||||||||||||||||||| ||||| | ||| |||| ||||||||
Sbjct: 104304 tgatagtaatggtatctaggaaaatgatcatcttgcctgagatccc 104349
to top
>gb|AF474373.1| Hordeum vulgare subsp. vulgare BAC 259I16, complete sequence
          Length = 124050

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                          
Query: 79    tgatagtaatggtatctagggaaatggtaatcctgccagagatcc 123
             ||||||||||| ||||| |||||||||| ||| |||| |||||||
Sbjct: 66353 tgatagtaatgatatctggggaaatggtcatcttgcctgagatcc 66397



 Score = 42.1 bits (21), Expect = 0.44
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 25    caggtggtaggcaactagacataat 49
             ||||||||||||||| |||||||||
Sbjct: 66299 caggtggtaggcaacgagacataat 66323
to top
>gb|AY643844.1|AY643842S3 Hordeum vulgare subsp. vulgare clones BAC 799C8 and 122A5 hardness
            locus region
          Length = 160897

 Score = 46.1 bits (23), Expect = 0.028
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                               
Query: 79   tgatagtaatggtatctagggaaatggtaatcctgccagagatcccacttg 129
            ||||||||||||||||| |||||||| |  || |||| |||||||| ||||
Sbjct: 4823 tgatagtaatggtatctggggaaatgatcctcttgcctgagatcccgcttg 4873



 Score = 38.2 bits (19), Expect = 6.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                           
Query: 19   atttagcaggtggtaggcaactagacataat 49
            ||||| || |||||||||||| |||||||||
Sbjct: 4763 atttaacatgtggtaggcaacaagacataat 4793
to top
>gb|AF509775.1| Hordeum vulgare subsp. vulgare isolate RSB409A Rpg1 region, genomic
            sequence
          Length = 7321

 Score = 44.1 bits (22), Expect = 0.11
 Identities = 85/105 (80%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                        
Query: 19   atttagcaggtggtaggcaactagacataatgaaagtaaacgagacaactcncctgacat 78
            ||||| || |||||||||||| |||||||  || || || ||||||||||  | || || 
Sbjct: 6189 atttaacatgtggtaggcaacgagacatagcgatag-aagcgagacaactaacatggcaa 6131

                                                         
Query: 79   tgatagtaatggtatctagggaaatggtaatcctgccagagatcc 123
            ||||||||||| ||||  |||||||||| ||| | || |||||||
Sbjct: 6130 tgatagtaatgatatcgggggaaatggtcatctttcctgagatcc 6086
to top
>gb|AF509774.1| Hordeum vulgare subsp. vulgare isolate RSB347 Rpg1 region, genomic
           sequence
          Length = 3124

 Score = 44.1 bits (22), Expect = 0.11
 Identities = 85/105 (80%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                       
Query: 19  atttagcaggtggtaggcaactagacataatgaaagtaaacgagacaactcncctgacat 78
           ||||| || |||||||||||| |||||||  || || || ||||||||||  | || || 
Sbjct: 960 atttaacatgtggtaggcaacgagacatagcgatag-aagcgagacaactaacatggcaa 902

                                                        
Query: 79  tgatagtaatggtatctagggaaatggtaatcctgccagagatcc 123
           ||||||||||| ||||  |||||||||| ||| | || |||||||
Sbjct: 901 tgatagtaatgatatcgggggaaatggtcatctttcctgagatcc 857
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 30       ggtaggcaactagacataat 49
                ||||||||||||||||||||
Sbjct: 32465844 ggtaggcaactagacataat 32465825
to top
>dbj|AP003106.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0665A11
          Length = 166421

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 30    ggtaggcaactagacataat 49
             ||||||||||||||||||||
Sbjct: 53365 ggtaggcaactagacataat 53346
to top
>gb|AF118384.1|AF118384 Manduca sexta N-ethylmaleimide sensitive fusion protein and Hitcher
            protein (NSF) mRNA, complete cds
          Length = 5475

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 43   acataatgaaagtaaacgag 62
            ||||||||||||||||||||
Sbjct: 2464 acataatgaaagtaaacgag 2483
to top
>gb|AC124721.4| Mus musculus chromosome 10 clone RP23-387G19, complete sequence
          Length = 216612

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 40     tagacataatgaaagtaaa 58
              |||||||||||||||||||
Sbjct: 110645 tagacataatgaaagtaaa 110627
to top
>emb|CR956396.6| Pig DNA sequence from clone CH242-205N12 on chromosome 7, complete
              sequence
          Length = 175108

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 80     gatagtaatggtatctagg 98
              |||||||||||||||||||
Sbjct: 161152 gatagtaatggtatctagg 161134
to top
>gb|AC152937.21| Medicago truncatula clone mth2-96n6, complete sequence
          Length = 108802

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 79    tgatagtaatggtatctagggaa 101
             |||||| ||||||||||||||||
Sbjct: 24799 tgatagaaatggtatctagggaa 24777
to top
>gb|AC153012.4| Mus musculus BAC clone RP23-302F19 from chromosome 9, complete sequence
          Length = 196764

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 111    ctgccagagatcccacttg 129
              |||||||||||||||||||
Sbjct: 178234 ctgccagagatcccacttg 178216
to top
>gb|AC118557.2| Homo sapiens chromosome 1 clone RP11-499N7, complete sequence
          Length = 168688

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 94    ctagggaaatggtaatcct 112
             |||||||||||||||||||
Sbjct: 25469 ctagggaaatggtaatcct 25487
to top
>gb|AC011477.5| Homo sapiens chromosome 19 clone CTC-559E9, complete sequence
          Length = 178710

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 88    tggtatctagggaaatggt 106
             |||||||||||||||||||
Sbjct: 63159 tggtatctagggaaatggt 63177
to top
>gb|DQ007006.1| Babesia sp. WA1 clone WA1-GRP78 heat shock protein 70-like protein
            mRNA, complete cds
          Length = 2243

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 73   tgacattgatagtaatggtatct 95
            ||||||||||| |||||||||||
Sbjct: 1657 tgacattgatactaatggtatct 1679
to top
>gb|AC110921.9| Homo sapiens chromosome 17, clone CTD-2653B5, complete sequence
          Length = 240058

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 105    gtaatcctgccagagatcc 123
              |||||||||||||||||||
Sbjct: 141585 gtaatcctgccagagatcc 141603
to top
>gb|AC137584.4| Mus musculus BAC clone RP23-351O20 from 9, complete sequence
          Length = 197108

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 111   ctgccagagatcccacttg 129
             |||||||||||||||||||
Sbjct: 39111 ctgccagagatcccacttg 39093
to top
>emb|AL671910.9| Mouse DNA sequence from clone RP23-245M12 on chromosome X, complete
              sequence
          Length = 141713

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 99     gaaatggtaatcctgccag 117
              |||||||||||||||||||
Sbjct: 103347 gaaatggtaatcctgccag 103329


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 790,253
Number of Sequences: 3902068
Number of extensions: 790253
Number of successful extensions: 57872
Number of sequences better than 10.0: 28
Number of HSP's better than 10.0 without gapping: 26
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 57808
Number of HSP's gapped (non-prelim): 64
length of query: 144
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 123
effective length of database: 17,151,101,840
effective search space: 2109585526320
effective search space used: 2109585526320
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top