ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal31b20
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AF398144.1|AF398144 Brassica rapa subsp. pekinensis 60S ribos... 98 1e-17
2dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 90 3e-15
3dbj|AP003827.3| Oryza sativa (japonica cultivar-group) genomic D... 90 3e-15
4ref|NM_187105.2| Oryza sativa (japonica cultivar-group), mRNA 80 3e-12
5dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic D... 80 3e-12
6dbj|AK121702.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 3e-12
7dbj|AK063789.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 3e-12
8dbj|AP005105.3| Oryza sativa (japonica cultivar-group) genomic D... 74 2e-10
9dbj|AK069083.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 2e-10
10dbj|AK058924.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 2e-10
11dbj|AK058830.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 2e-10
12gb|BT016180.1| Zea mays clone Contig13 mRNA sequence 72 7e-10
13gb|AY106167.1| Zea mays PCO141571 mRNA sequence 70 3e-09
14gb|AY109380.1| Zea mays CL2281_1 mRNA sequence 68 1e-08
15gb|DQ019457.1| Lilium longiflorum clone LP07 ribosomal protein-l... 64 2e-07
16gb|U64678.1|GHU64678 Gossypium hirsutum ribosomal protein L44 is... 64 2e-07
17gb|M62396.1|YSAQLAG C.maltosa ribosomal protein L41 (LEL41) gene... 64 2e-07
18ref|NM_117509.1| Arabidopsis thaliana structural constituent of ... 60 2e-06
19gb|AY497301.1| Phalaenopsis hybrid cultivar 60S ribosomal protei... 60 2e-06
20emb|Z97336.1|ATFCA1 Arabidopsis thaliana DNA chromosome 4, ESSA ... 60 2e-06
21emb|AL161538.2|ATCHRIV38 Arabidopsis thaliana DNA chromosome 4, ... 60 2e-06
22gb|AY081639.1| Arabidopsis thaliana ribosomal protein (Z97336.1)... 60 2e-06
23gb|AY065121.1| Arabidopsis thaliana ribosomal protein (Z97336.1)... 60 2e-06
24emb|BX829272.1|CNS0A2I0 Arabidopsis thaliana Full-length cDNA Co... 60 2e-06
25gb|AY085784.1| Arabidopsis thaliana clone 18153 mRNA, complete s... 60 2e-06
26ref|NM_113242.1| Arabidopsis thaliana structural constituent of ... 52 6e-04
27gb|AY062855.1| Arabidopsis thaliana 60S ribosomal protein L44-li... 52 6e-04
28gb|AY085174.1| Arabidopsis thaliana clone 13557 mRNA, complete s... 52 6e-04
29dbj|AB015474.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 52 6e-04
30gb|BT001193.1| Arabidopsis thaliana 60S ribosomal protein L44-li... 52 6e-04
31gb|AY674230.1| Ixodes pacificus clone IP_7_60_92_138_CLU ribosom... 44 0.15
32gb|DQ317826.1| Palola sp. AS-2005 isolate Kosrae161 cytochrome c... 44 0.15
33gb|U64677.1|GHU64677 Gossypium hirsutum ribosomal protein L44 is... 44 0.15
34gb|AC151757.1| Ornithorhynchus anatinus chromosome UNK clone OAB... 42 0.58
35gb|AC102454.7| Mus musculus chromosome 5, clone RP24-296L13, com... 40 2.3
36emb|CR628336.1| Legionella pneumophila str. Paris complete genome 40 2.3
37emb|CR356241.8| Zebrafish DNA sequence from clone DKEY-90M21 in ... 40 2.3
38dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 2.3
39dbj|AP003250.3| Oryza sativa (japonica cultivar-group) genomic D... 40 2.3
40gb|AC145545.2| Homo sapiens chromosome UNKNOWN clone RP11-1365M9... 38 9.1
41gb|AC101908.8| Mus musculus chromosome 1, clone RP24-275J1, comp... 38 9.1
42gb|AE017343.1| Cryptococcus neoformans var. neoformans JEC21 chr... 38 9.1
43gb|AC149072.1| x. tropicalis BAC clone ISB1-341L17 containing ge... 38 9.1
44gb|AC148207.4| Callicebus moloch clone LB5-404B3, complete sequence 38 9.1
45gb|AC146183.3| Pan troglodytes BAC clone CH251-548L16 from Y, co... 38 9.1
46gb|AC129778.5| Homo sapiens BAC clone RP11-1221G12 from UL, comp... 38 9.1
47gb|AC125523.4| Mus musculus BAC clone RP24-376O18 from chromosom... 38 9.1
48gb|AC006045.2| Homo sapiens BAC clone RP11-547G15 from 7, comple... 38 9.1
49ref|XM_544464.2| PREDICTED: Canis familiaris similar to acid sph... 38 9.1
50gb|AC158393.2| Mus musculus BAC clone RP23-368G21 from chromosom... 38 9.1
51gb|AC158580.3| Mus musculus chromosome 1, clone RP24-97G17, comp... 38 9.1
52emb|AL845321.4| Human DNA sequence from clone RP11-236F9 on chro... 38 9.1
53emb|AL591379.18| Human DNA sequence from clone RP11-381O7 on chr... 38 9.1
54emb|AL445665.20| Human DNA sequence from clone RP11-574E24 on ch... 38 9.1
55emb|AL158209.23| Human DNA sequence from clone RP11-275N1 on chr... 38 9.1
56emb|AL137070.9| Human DNA sequence from clone RP11-251O17 on chr... 38 9.1
57emb|AL645639.17| Mouse DNA sequence from clone RP23-370G8 on chr... 38 9.1
58emb|CR788302.6| Zebrafish DNA sequence from clone DKEYP-38A10, c... 38 9.1
59gb|AC155256.2| Mus musculus BAC clone RP24-142I9 from chromosome... 38 9.1
60gb|AC090610.6| Homo sapiens chromosome 17, clone RP11-493I24, co... 38 9.1
61emb|BX784037.13| Zebrafish DNA sequence from clone DKEY-96H14 in... 38 9.1
62dbj|BS000630.2| Pan troglodytes chromosome Y clone: PTB-245N19, ... 38 9.1
63gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 38 9.1
64gb|AC183386.2| Pan troglodytes BAC clone CH251-223N18 from chrom... 38 9.1
65gb|AC104331.2| Homo sapiens chromosome 3 clone RP11-543A18, comp... 38 9.1
66gb|AC007529.5| Homo sapiens 12p13 BAC RPCI11-69C13 (Roswell Park... 38 9.1
67gb|AC002091.2| Homo sapiens chromosome 17, clone CTB-41I6, compl... 38 9.1
68ref|XM_392625.2| PREDICTED: Apis mellifera similar to ENSANGP000... 38 9.1
69gb|AC074008.5| Homo sapiens BAC clone RP11-582H21 from 2, comple... 38 9.1
70gb|AC073909.25| Homo sapiens X BAC RP11-759L5 (Roswell Park Canc... 38 9.1
71gb|AC016731.7| Homo sapiens BAC clone RP11-375H16 from 2, comple... 38 9.1
72gb|AC068043.7| Homo sapiens BAC clone RP11-505B22 from 2, comple... 38 9.1
73gb|U63573.1|OTU63573 Oxytricha trifallax WR micronuclear telomer... 38 9.1
74emb|BX294181.5| Zebrafish DNA sequence from clone CH211-284E13 i... 38 9.1
75emb|BX119982.8| Zebrafish DNA sequence from clone CH211-214J4 in... 38 9.1
76emb|AL845331.2| Human DNA sequence from clone RP11-407P15 on chr... 38 9.1
77gb|AC007004.3|AC007004 Homo sapiens clone NH0521D03, complete se... 38 9.1
78emb|AL954355.10| Mouse DNA sequence from clone RP23-94F6 on chro... 38 9.1
79gb|AC004087.1|AC004087 Homo sapiens Xp22 GSHB-314C4 (Genome Syst... 38 9.1
80gb|AC134907.5| Mus musculus BAC clone RP23-362K17 from 8, comple... 38 9.1
81gb|AC165349.2| Mus musculus BAC clone RP23-212M22 from chromosom... 38 9.1
82gb|DP000019.1| Callicebus moloch target 1 genomic scaffold 38 9.1
83emb|AL929054.5| Mouse DNA sequence from clone RP23-454A14 on chr... 38 9.1 
>gb|AF398144.1|AF398144 Brassica rapa subsp. pekinensis 60S ribosomal protein L144 mRNA,
           partial cds
          Length = 518

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 126 cagcttagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
           ||||||||||||| || |||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 364 cagcttagaaaagtgatgttcccttgcccttcttgtctccaccgatttcaaaatgcttgc 305
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 89.7 bits (45), Expect = 3e-15
 Identities = 53/56 (94%)
 Strand = Plus / Minus

                                                                        
Query: 130      ttagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
                |||||||||||| |||||||||||||||||||||||||| ||| ||||||||||||
Sbjct: 20209121 ttagaaaagagacgttcccttgcccttcttgtctccaccaatttcaaaatgcttgc 20209066



 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 52/56 (92%)
 Strand = Plus / Minus

                                                                        
Query: 130      ttagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
                |||||||||||| |||||||||||||||||||||||||| |||  |||||||||||
Sbjct: 20245561 ttagaaaagagacgttcccttgcccttcttgtctccaccaattttaaaatgcttgc 20245506



 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 52/56 (92%)
 Strand = Plus / Minus

                                                                        
Query: 130      ttagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
                |||||||||||| |||||||||||||||||||||||||| |||  |||||||||||
Sbjct: 20227344 ttagaaaagagacgttcccttgcccttcttgtctccaccaattttaaaatgcttgc 20227289



 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 60/67 (89%)
 Strand = Plus / Minus

                                                                            
Query: 119      atatcatcagcttagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaa 178
                |||||| || ||||||| || || |||||||||||||||||||||||||||||| |||| 
Sbjct: 15397536 atatcagcatcttagaagagtgaagttcccttgcccttcttgtctccaccgatttcaaag 15397477

                       
Query: 179      tgcttgc 185
                |||||||
Sbjct: 15397476 tgcttgc 15397470



 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                        
Query: 130      ttagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
                |||||||||||| |||||||||||||||||||||||||| ||  | ||||||||||
Sbjct: 20258289 ttagaaaagagatgttcccttgcccttcttgtctccaccaatctcgaaatgcttgc 20258234



 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                        
Query: 130      ttagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
                |||||||||||| |||||||||||||||||||||||||| ||  | ||||||||||
Sbjct: 20252131 ttagaaaagagatgttcccttgcccttcttgtctccaccaatctcgaaatgcttgc 20252076



 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                        
Query: 130      ttagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
                |||||||||||| |||||||||||||||||||||||||| ||  | ||||||||||
Sbjct: 20240071 ttagaaaagagatgttcccttgcccttcttgtctccaccaatctcgaaatgcttgc 20240016



 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                        
Query: 130      ttagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
                |||||||||||| |||||||||||||||||||||||||| ||  | ||||||||||
Sbjct: 20233912 ttagaaaagagatgttcccttgcccttcttgtctccaccaatctcgaaatgcttgc 20233857



 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                        
Query: 130      ttagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
                |||||||||||| |||||||||||||||||||||||||| ||  | ||||||||||
Sbjct: 20221854 ttagaaaagagatgttcccttgcccttcttgtctccaccaatctcgaaatgcttgc 20221799



 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                        
Query: 130      ttagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
                |||||||||||| |||||||||||||||||||||||||| ||  | ||||||||||
Sbjct: 20215695 ttagaaaagagatgttcccttgcccttcttgtctccaccaatctcgaaatgcttgc 20215640



 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                        
Query: 130      ttagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
                |||||||||||| |||||||||||||||||||||||||| ||  | ||||||||||
Sbjct: 20204755 ttagaaaagagatgttcccttgcccttcttgtctccaccaatctcgaaatgcttgc 20204700
to top
>dbj|AP003827.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OJ1372_D12
          Length = 179898

 Score = 89.7 bits (45), Expect = 3e-15
 Identities = 53/56 (94%)
 Strand = Plus / Minus

                                                                      
Query: 130    ttagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
              |||||||||||| |||||||||||||||||||||||||| ||| ||||||||||||
Sbjct: 111509 ttagaaaagagacgttcccttgcccttcttgtctccaccaatttcaaaatgcttgc 111454



 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 52/56 (92%)
 Strand = Plus / Minus

                                                                      
Query: 130    ttagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
              |||||||||||| |||||||||||||||||||||||||| |||  |||||||||||
Sbjct: 147949 ttagaaaagagacgttcccttgcccttcttgtctccaccaattttaaaatgcttgc 147894



 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 52/56 (92%)
 Strand = Plus / Minus

                                                                      
Query: 130    ttagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
              |||||||||||| |||||||||||||||||||||||||| |||  |||||||||||
Sbjct: 129732 ttagaaaagagacgttcccttgcccttcttgtctccaccaattttaaaatgcttgc 129677



 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                      
Query: 130    ttagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
              |||||||||||| |||||||||||||||||||||||||| ||  | ||||||||||
Sbjct: 160677 ttagaaaagagatgttcccttgcccttcttgtctccaccaatctcgaaatgcttgc 160622



 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                      
Query: 130    ttagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
              |||||||||||| |||||||||||||||||||||||||| ||  | ||||||||||
Sbjct: 154519 ttagaaaagagatgttcccttgcccttcttgtctccaccaatctcgaaatgcttgc 154464



 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                      
Query: 130    ttagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
              |||||||||||| |||||||||||||||||||||||||| ||  | ||||||||||
Sbjct: 142459 ttagaaaagagatgttcccttgcccttcttgtctccaccaatctcgaaatgcttgc 142404



 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                      
Query: 130    ttagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
              |||||||||||| |||||||||||||||||||||||||| ||  | ||||||||||
Sbjct: 136300 ttagaaaagagatgttcccttgcccttcttgtctccaccaatctcgaaatgcttgc 136245



 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                      
Query: 130    ttagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
              |||||||||||| |||||||||||||||||||||||||| ||  | ||||||||||
Sbjct: 124242 ttagaaaagagatgttcccttgcccttcttgtctccaccaatctcgaaatgcttgc 124187



 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                      
Query: 130    ttagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
              |||||||||||| |||||||||||||||||||||||||| ||  | ||||||||||
Sbjct: 118083 ttagaaaagagatgttcccttgcccttcttgtctccaccaatctcgaaatgcttgc 118028



 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                      
Query: 130    ttagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
              |||||||||||| |||||||||||||||||||||||||| ||  | ||||||||||
Sbjct: 107143 ttagaaaagagatgttcccttgcccttcttgtctccaccaatctcgaaatgcttgc 107088
to top
>ref|NM_187105.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 701

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 60/67 (89%)
 Strand = Plus / Minus

                                                                       
Query: 119 atatcatcagcttagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaa 178
           |||||| || ||||||| || || |||||||||||||||||||||||||||||| |||| 
Sbjct: 405 atatcagcatcttagaagagtgaagttcccttgcccttcttgtctccaccgatttcaaag 346

                  
Query: 179 tgcttgc 185
           |||||||
Sbjct: 345 tgcttgc 339
to top
>dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OJ1047_A06
          Length = 111673

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 60/67 (89%)
 Strand = Plus / Minus

                                                                          
Query: 119    atatcatcagcttagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaa 178
              |||||| || ||||||| || || |||||||||||||||||||||||||||||| |||| 
Sbjct: 104535 atatcagcatcttagaagagtgaagttcccttgcccttcttgtctccaccgatttcaaag 104476

                     
Query: 179    tgcttgc 185
              |||||||
Sbjct: 104475 tgcttgc 104469
to top
>dbj|AK121702.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033073H17, full
           insert sequence
          Length = 725

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 60/67 (89%)
 Strand = Plus / Minus

                                                                       
Query: 119 atatcatcagcttagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaa 178
           |||||| || ||||||| || || |||||||||||||||||||||||||||||| |||| 
Sbjct: 429 atatcagcatcttagaagagtgaagttcccttgcccttcttgtctccaccgatttcaaag 370

                  
Query: 179 tgcttgc 185
           |||||||
Sbjct: 369 tgcttgc 363
to top
>dbj|AK063789.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-121-E03, full
           insert sequence
          Length = 701

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 60/67 (89%)
 Strand = Plus / Minus

                                                                       
Query: 119 atatcatcagcttagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaa 178
           |||||| || ||||||| || || |||||||||||||||||||||||||||||| |||| 
Sbjct: 405 atatcagcatcttagaagagtgaagttcccttgcccttcttgtctccaccgatttcaaag 346

                  
Query: 179 tgcttgc 185
           |||||||
Sbjct: 345 tgcttgc 339
to top
>dbj|AP005105.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7,
           BAC clone:OSJNBb0052O11
          Length = 106467

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                   
Query: 130 ttagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
           |||||||||||| |||||||||||||||||||||||||| ||  | ||||||||||
Sbjct: 900 ttagaaaagagatgttcccttgcccttcttgtctccaccaatctcgaaatgcttgc 845
to top
>dbj|AK069083.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023009C02, full
            insert sequence
          Length = 2173

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                    
Query: 130  ttagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
            |||||||||||| |||||||||||||||||||||||||| ||  | ||||||||||
Sbjct: 2015 ttagaaaagagatgttcccttgcccttcttgtctccaccaatctcgaaatgcttgc 1960
to top
>dbj|AK058924.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-009-C01, full
           insert sequence
          Length = 676

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                   
Query: 130 ttagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
           |||||||||||| |||||||||||||||||||||||||| ||  | ||||||||||
Sbjct: 289 ttagaaaagagatgttcccttgcccttcttgtctccaccaatctcgaaatgcttgc 234
to top
>dbj|AK058830.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-004-A07, full
           insert sequence
          Length = 355

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                   
Query: 130 ttagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
           |||||||||||| |||||||||||||||||||||||||| ||  | ||||||||||
Sbjct: 114 ttagaaaagagatgttcccttgcccttcttgtctccaccaatctcgaaatgcttgc 59
to top
>gb|BT016180.1| Zea mays clone Contig13 mRNA sequence
          Length = 640

 Score = 71.9 bits (36), Expect = 7e-10
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 127 agcttagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
           |||||| |||||||| || ||||||||||||||||||||||| ||  ||||||||||||
Sbjct: 410 agcttaaaaaagagatgtgcccttgcccttcttgtctccaccaatctcaaaatgcttgc 352
to top
>gb|AY106167.1| Zea mays PCO141571 mRNA sequence
          Length = 641

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 128 gcttagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
           |||||||| ||||||||||||||||| |||||||| ||||||||  |||| |||||||
Sbjct: 379 gcttagaacagagaggttcccttgcctttcttgtcaccaccgatctcaaagtgcttgc 322
to top
>gb|AY109380.1| Zea mays CL2281_1 mRNA sequence
          Length = 1446

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                    
Query: 129 cttagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
           ||||||| ||||| || ||||||||||||||||||||||| ||  ||||||||||||
Sbjct: 811 cttagaagagagatgtgcccttgcccttcttgtctccaccaatctcaaaatgcttgc 755
to top
>gb|DQ019457.1| Lilium longiflorum clone LP07 ribosomal protein-like mRNA, partial
           sequence
          Length = 526

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 131 tagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
           ||||| ||||| |||||||| |||||||| |||||||||||  ||||||||||||
Sbjct: 374 tagaagagagatgttcccttccccttcttatctccaccgatctcaaaatgcttgc 320
to top
>gb|U64678.1|GHU64678 Gossypium hirsutum ribosomal protein L44 isoform b (RL44), complete
           cds
          Length = 542

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 131 tagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
           |||||||| || |||||||| ||||||||||||||||| ||| |||| |||||||
Sbjct: 363 tagaaaagtgatgttcccttccccttcttgtctccaccaatttcaaagtgcttgc 309
to top
>gb|M62396.1|YSAQLAG C.maltosa ribosomal protein L41 (LEL41) gene, complete cds
          Length = 515

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 131 tagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
           |||||||| ||||||||||| || |||||||| ||||| ||| ||||||||||||
Sbjct: 351 tagaaaagtgaggttccctttcctttcttgtccccacctatttcaaaatgcttgc 297
to top
>ref|NM_117509.1| Arabidopsis thaliana structural constituent of ribosome AT4G14320
           mRNA, complete cds
          Length = 533

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 137 agagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
           ||||| |||||||| ||||||||||||||||||||  |||| |||||||
Sbjct: 390 agagatgttccctttcccttcttgtctccaccgatctcaaagtgcttgc 342
to top
>gb|AY497301.1| Phalaenopsis hybrid cultivar 60S ribosomal protein L44 (PL44-1)
           mRNA, complete cds
          Length = 708

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 129 cttagaaaagagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
           ||||||| ||||| |||||||| ||||||||||||||||| ||  |||| |||||||
Sbjct: 479 cttagaacagagatgttcccttccccttcttgtctccaccaatctcaaagtgcttgc 423
to top
>emb|Z97336.1|ATFCA1 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment
           No. 1
          Length = 206606

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 137 agagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
           ||||| |||||||| ||||||||||||||||||||  |||| |||||||
Sbjct: 692 agagatgttccctttcccttcttgtctccaccgatctcaaagtgcttgc 740
to top
>emb|AL161538.2|ATCHRIV38 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 38
          Length = 198944

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                               
Query: 137    agagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
              ||||| |||||||| ||||||||||||||||||||  |||| |||||||
Sbjct: 140132 agagatgttccctttcccttcttgtctccaccgatctcaaagtgcttgc 140180
to top
>gb|AY081639.1| Arabidopsis thaliana ribosomal protein (Z97336.1) mRNA, complete
           cds
          Length = 371

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 137 agagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
           ||||| |||||||| ||||||||||||||||||||  |||| |||||||
Sbjct: 311 agagatgttccctttcccttcttgtctccaccgatctcaaagtgcttgc 263
to top
>gb|AY065121.1| Arabidopsis thaliana ribosomal protein (Z97336.1) mRNA, complete
           cds
          Length = 494

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 137 agagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
           ||||| |||||||| ||||||||||||||||||||  |||| |||||||
Sbjct: 365 agagatgttccctttcccttcttgtctccaccgatctcaaagtgcttgc 317
to top
>emb|BX829272.1|CNS0A2I0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL86ZH09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 480

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 137 agagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
           ||||| |||||||| ||||||||||||||||||||  |||| |||||||
Sbjct: 349 agagatgttccctttcccttcttgtctccaccgatctcaaagtgcttgc 301
to top
>gb|AY085784.1| Arabidopsis thaliana clone 18153 mRNA, complete sequence
          Length = 533

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 137 agagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
           ||||| |||||||| ||||||||||||||||||||  |||| |||||||
Sbjct: 390 agagatgttccctttcccttcttgtctccaccgatctcaaagtgcttgc 342
to top
>ref|NM_113242.1| Arabidopsis thaliana structural constituent of ribosome AT3G23390
           mRNA, complete cds
          Length = 536

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 137 agagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
           ||||| |||||||| ||||||||||| ||||||||  | ||||||||||
Sbjct: 363 agagatgttccctttcccttcttgtcaccaccgatctcgaaatgcttgc 315
to top
>gb|AY062855.1| Arabidopsis thaliana 60S ribosomal protein L44-like (At3g23400;
           MLM24.12) mRNA, complete cds
          Length = 521

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 137 agagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
           ||||| |||||||| ||||||||||| ||||||||  | ||||||||||
Sbjct: 361 agagatgttccctttcccttcttgtcaccaccgatctcgaaatgcttgc 313
to top
>gb|AY085174.1| Arabidopsis thaliana clone 13557 mRNA, complete sequence
          Length = 536

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 137 agagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
           ||||| |||||||| ||||||||||| ||||||||  | ||||||||||
Sbjct: 363 agagatgttccctttcccttcttgtcaccaccgatctcgaaatgcttgc 315
to top
>dbj|AB015474.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MLM24
          Length = 87487

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                              
Query: 137   agagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
             ||||| |||||||| ||||||||||| ||||||||  | ||||||||||
Sbjct: 48799 agagatgttccctttcccttcttgtcaccaccgatctcgaaatgcttgc 48751
to top
>gb|BT001193.1| Arabidopsis thaliana 60S ribosomal protein L44-like (At3g23400)
           mRNA, complete cds
          Length = 365

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 137 agagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
           ||||| |||||||| ||||||||||| ||||||||  | ||||||||||
Sbjct: 311 agagatgttccctttcccttcttgtcaccaccgatctcgaaatgcttgc 263
to top
>gb|AY674230.1| Ixodes pacificus clone IP_7_60_92_138_CLU ribosomal protein L44
           mRNA, complete cds
          Length = 318

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 145 tcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
           |||||||| |||||||||||| |||||  |||| |||||||
Sbjct: 300 tcccttgcgcttcttgtctccgccgatctcaaagtgcttgc 260
to top
>gb|DQ317826.1| Palola sp. AS-2005 isolate Kosrae161 cytochrome c oxidase subunit I
           (COI) gene, partial cds; mitochondrial
          Length = 608

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 144 ttcccttgcccttcttgtctcc 165
           ||||||||||||||||||||||
Sbjct: 227 ttcccttgcccttcttgtctcc 248
to top
>gb|U64677.1|GHU64677 Gossypium hirsutum ribosomal protein L44 isoform a (RL44), complete
           cds
          Length = 455

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 137 agagaggttcccttgcccttcttgtctccaccgattncaaaatgcttgc 185
           ||||| ||||| || ||||||||||||||||| ||  |||| |||||||
Sbjct: 327 agagatgttcctttccccttcttgtctccaccaatctcaaagtgcttgc 279
to top
>gb|AC151757.1| Ornithorhynchus anatinus chromosome UNK clone OABb-457P24, complete
              sequence
          Length = 135835

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 4      gttggacagaaaggcaaaaca 24
              |||||||||||||||||||||
Sbjct: 101123 gttggacagaaaggcaaaaca 101143
to top
>gb|AC102454.7| Mus musculus chromosome 5, clone RP24-296L13, complete sequence
          Length = 149588

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 13    aaaggcaaaacatatgctacatgg 36
             |||||||||||||||| |||||||
Sbjct: 41866 aaaggcaaaacatatgatacatgg 41843
to top
>emb|CR628336.1| Legionella pneumophila str. Paris complete genome
          Length = 3503610

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 86      aagttctggcacaacattct 105
               ||||||||||||||||||||
Sbjct: 1904811 aagttctggcacaacattct 1904830
to top
>emb|CR356241.8| Zebrafish DNA sequence from clone DKEY-90M21 in linkage group 19,
             complete sequence
          Length = 74299

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 10    cagaaaggcaaaacatatgc 29
             ||||||||||||||||||||
Sbjct: 49663 cagaaaggcaaaacatatgc 49682
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 58      tattaagataatagattgtt 77
               ||||||||||||||||||||
Sbjct: 1991830 tattaagataatagattgtt 1991811
to top
>dbj|AP003250.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0443D08
          Length = 146670

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    tattaagataatagattgtt 77
             ||||||||||||||||||||
Sbjct: 54408 tattaagataatagattgtt 54389
to top
>gb|AC145545.2| Homo sapiens chromosome UNKNOWN clone RP11-1365M9, complete sequence
          Length = 184813

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 77    tcaggtgggaagttctggc 95
             |||||||||||||||||||
Sbjct: 30194 tcaggtgggaagttctggc 30212
to top
>gb|AC101908.8| Mus musculus chromosome 1, clone RP24-275J1, complete sequence
          Length = 164826

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 13     aaaggcaaaacatatgcta 31
              |||||||||||||||||||
Sbjct: 118176 aaaggcaaaacatatgcta 118158
to top
>gb|AE017343.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 3, complete
               sequence
          Length = 2105742

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                      
Query: 105     tgaacataacagggatatcatca 127
               |||||||| ||||||||||||||
Sbjct: 1053260 tgaacatatcagggatatcatca 1053282
to top
>gb|AC149072.1| x. tropicalis BAC clone ISB1-341L17 containing genes for vex1 and
             vent1, complete sequence
          Length = 65797

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 20    aaacatatgctacatggcc 38
             |||||||||||||||||||
Sbjct: 60587 aaacatatgctacatggcc 60569
to top
>gb|AC148207.4| Callicebus moloch clone LB5-404B3, complete sequence
          Length = 175081

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 53     cagaatattaagataatag 71
              |||||||||||||||||||
Sbjct: 174000 cagaatattaagataatag 174018
to top
>gb|AC146183.3| Pan troglodytes BAC clone CH251-548L16 from Y, complete sequence
          Length = 234142

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 71     gattgttcaggtgggaagt 89
              |||||||||||||||||||
Sbjct: 136174 gattgttcaggtgggaagt 136156
to top
>gb|AC129778.5| Homo sapiens BAC clone RP11-1221G12 from UL, complete sequence
          Length = 236177

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 77    tcaggtgggaagttctggc 95
             |||||||||||||||||||
Sbjct: 46902 tcaggtgggaagttctggc 46920
to top
>gb|AC125523.4| Mus musculus BAC clone RP24-376O18 from chromosome 15, complete
            sequence
          Length = 176341

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                       
Query: 1    gtagttggacagaaaggcaaaacatat 27
            |||||||||||| ||| ||||||||||
Sbjct: 3276 gtagttggacagtaagacaaaacatat 3302
to top
>gb|AC006045.2| Homo sapiens BAC clone RP11-547G15 from 7, complete sequence
          Length = 193126

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 56   aatattaagataatagatt 74
            |||||||||||||||||||
Sbjct: 3647 aatattaagataatagatt 3665
to top
>ref|XM_544464.2| PREDICTED: Canis familiaris similar to acid sphingomyelinase-like
           phosphodiesterase 3B isoform 1 (LOC487338), mRNA
          Length = 1407

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 80  ggtgggaagttctggcaca 98
           |||||||||||||||||||
Sbjct: 94  ggtgggaagttctggcaca 112
to top
>gb|AC158393.2| Mus musculus BAC clone RP23-368G21 from chromosome 14, complete
             sequence
          Length = 200173

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 6     tggacagaaaggcaaaaca 24
             |||||||||||||||||||
Sbjct: 34425 tggacagaaaggcaaaaca 34443
to top
>gb|AC158580.3| Mus musculus chromosome 1, clone RP24-97G17, complete sequence
          Length = 159618

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 13     aaaggcaaaacatatgcta 31
              |||||||||||||||||||
Sbjct: 122385 aaaggcaaaacatatgcta 122403
to top
>emb|AL845321.4| Human DNA sequence from clone RP11-236F9 on chromosome 9 Contains an
             aquaporin 7(AQP7) pseudogene, a novel gene, three novel
             pseudogenes, a pseudogene similar to part of BMS1-like,
             ribosome assembly protein (yeast)(BMS1L) and a CpG island,
             complete sequence
          Length = 158462

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 77    tcaggtgggaagttctggc 95
             |||||||||||||||||||
Sbjct: 86332 tcaggtgggaagttctggc 86350
to top
>emb|AL591379.18| Human DNA sequence from clone RP11-381O7 on chromosome 9 Contains an
              aquaporin 7 (AQP7) pseudogene, a novel gene, three novel
              pseudogenes, a pseudogene similar to part of BMS1-like,
              ribosome assembly protein (yeast) (BMS1L), a pseudogene
              similar to part of tripartite motif-containing family
              protein and a CpG island, complete sequence
          Length = 194491

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 77     tcaggtgggaagttctggc 95
              |||||||||||||||||||
Sbjct: 112875 tcaggtgggaagttctggc 112857
to top
>emb|AL445665.20| Human DNA sequence from clone RP11-574E24 on chromosome 9 Contains an
             aquaporin 7 (AQP7) pseudogene and a CpG island, complete
             sequence
          Length = 179371

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 77    tcaggtgggaagttctggc 95
             |||||||||||||||||||
Sbjct: 90069 tcaggtgggaagttctggc 90051
to top
>emb|AL158209.23| Human DNA sequence from clone RP11-275N1 on chromosome 10 Contains a
              novel gene and a pseudogene similar to part of FLJ10581,
              complete sequence
          Length = 132327

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 94     gcacaacattctgaacata 112
              |||||||||||||||||||
Sbjct: 117960 gcacaacattctgaacata 117942
to top
>emb|AL137070.9| Human DNA sequence from clone RP11-251O17 on chromosome 9 Contains 2
              calponin 2 (CNN2) pseudogenes, a gene for a novel protein
              similar to aquaporin 7 (AQP7), part of gene for a novel
              protein similar to methylenetetrahydrofolate
              dehydrogenase(NADP+ dependent), methenyltetrahydrofolate
              cyclohydrolase, formyltetrahydrofolate synthetase (MTHFD1)
              and a CpG island, complete sequence
          Length = 170237

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 77     tcaggtgggaagttctggc 95
              |||||||||||||||||||
Sbjct: 170191 tcaggtgggaagttctggc 170209
to top
>emb|AL645639.17| Mouse DNA sequence from clone RP23-370G8 on chromosome 11 Contains a
              novel gene (LOC327917), the 5' end of the Adamts2 gene for
              a disintegrin-like and metalloprotease (reprolysin type)
              with thrombospondin type 1 motif 2, two novel genes
              (4930579K21) and a CpG island, complete sequence
          Length = 188520

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 139    agaggttcccttgcccttc 157
              |||||||||||||||||||
Sbjct: 178434 agaggttcccttgcccttc 178452
to top
>emb|CR788302.6| Zebrafish DNA sequence from clone DKEYP-38A10, complete sequence
          Length = 172778

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 12    gaaaggcaaaacatatgct 30
             |||||||||||||||||||
Sbjct: 84459 gaaaggcaaaacatatgct 84441
to top
>gb|AC155256.2| Mus musculus BAC clone RP24-142I9 from chromosome 12, complete sequence
          Length = 163949

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 95     cacaacattctgaacataacagg 117
              |||||||| ||||||||||||||
Sbjct: 133586 cacaacatcctgaacataacagg 133608
to top
>gb|AC090610.6| Homo sapiens chromosome 17, clone RP11-493I24, complete sequence
          Length = 185980

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 50    agccagaatattaagataa 68
             |||||||||||||||||||
Sbjct: 26411 agccagaatattaagataa 26429
to top
>emb|BX784037.13| Zebrafish DNA sequence from clone DKEY-96H14 in linkage group 22,
             complete sequence
          Length = 126572

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 12    gaaaggcaaaacatatgct 30
             |||||||||||||||||||
Sbjct: 43223 gaaaggcaaaacatatgct 43241
to top
>dbj|BS000630.2| Pan troglodytes chromosome Y clone: PTB-245N19, complete sequence
          Length = 149685

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 71     gattgttcaggtgggaagt 89
              |||||||||||||||||||
Sbjct: 130145 gattgttcaggtgggaagt 130127
to top
>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 71       gattgttcaggtgggaagt 89
                |||||||||||||||||||
Sbjct: 18659119 gattgttcaggtgggaagt 18659137
to top
>gb|AC183386.2| Pan troglodytes BAC clone CH251-223N18 from chromosome 9, complete
              sequence
          Length = 138215

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 77     tcaggtgggaagttctggc 95
              |||||||||||||||||||
Sbjct: 132202 tcaggtgggaagttctggc 132220
to top
>gb|AC104331.2| Homo sapiens chromosome 3 clone RP11-543A18, complete sequence
          Length = 201049

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 100    cattctgaacataacagggatat 122
              ||||| |||||||||||||||||
Sbjct: 144635 cattcagaacataacagggatat 144657
to top
>gb|AC007529.5| Homo sapiens 12p13 BAC RPCI11-69C13 (Roswell Park Cancer Institute
             Human BAC Library) complete sequence
          Length = 147239

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 54    agaatattaagataataga 72
             |||||||||||||||||||
Sbjct: 15115 agaatattaagataataga 15097
to top
>gb|AC002091.2| Homo sapiens chromosome 17, clone CTB-41I6, complete sequence
          Length = 161816

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 50     agccagaatattaagataa 68
              |||||||||||||||||||
Sbjct: 141541 agccagaatattaagataa 141559
to top
>ref|XM_392625.2| PREDICTED: Apis mellifera similar to ENSANGP00000012852 (LOC409099),
            mRNA
          Length = 8445

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 19   aaaacatatgctacatggc 37
            |||||||||||||||||||
Sbjct: 5645 aaaacatatgctacatggc 5627
to top
>gb|AC074008.5| Homo sapiens BAC clone RP11-582H21 from 2, complete sequence
          Length = 159439

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 101   attctgaacataacaggga 119
             |||||||||||||||||||
Sbjct: 44045 attctgaacataacaggga 44063
to top
>gb|AC073909.25| Homo sapiens X BAC RP11-759L5 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 156411

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 94    gcacaacattctgaacata 112
             |||||||||||||||||||
Sbjct: 37576 gcacaacattctgaacata 37558
to top
>gb|AC016731.7| Homo sapiens BAC clone RP11-375H16 from 2, complete sequence
          Length = 120082

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 62     aagataatagattgttcag 80
              |||||||||||||||||||
Sbjct: 104180 aagataatagattgttcag 104198
to top
>gb|AC068043.7| Homo sapiens BAC clone RP11-505B22 from 2, complete sequence
          Length = 162217

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 44    agttatagccagaatattaagat 66
             ||||| |||||||||||||||||
Sbjct: 53615 agttaaagccagaatattaagat 53593
to top
>gb|U63573.1|OTU63573 Oxytricha trifallax WR micronuclear telomere-binding protein beta
           subunit gene, partial cds
          Length = 1577

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 147 ccttgcccttcttgtctccaccg 169
           ||||| |||||||||||||||||
Sbjct: 245 ccttggccttcttgtctccaccg 223
to top
>emb|BX294181.5| Zebrafish DNA sequence from clone CH211-284E13 in linkage group 5,
             complete sequence
          Length = 171388

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 89    ttctggcacaacattctgaacat 111
             |||| ||||||||||||||||||
Sbjct: 23067 ttctagcacaacattctgaacat 23045
to top
>emb|BX119982.8| Zebrafish DNA sequence from clone CH211-214J4 in linkage group 23,
              complete sequence
          Length = 210702

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 89     ttctggcacaacattctgaacat 111
              ||||||||||| |||||||||||
Sbjct: 157250 ttctggcacaaaattctgaacat 157228
to top
>emb|AL845331.2| Human DNA sequence from clone RP11-407P15 on chromosome 9, complete
             sequence
          Length = 185111

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 77    tcaggtgggaagttctggc 95
             |||||||||||||||||||
Sbjct: 20001 tcaggtgggaagttctggc 19983
to top
>gb|AC007004.3|AC007004 Homo sapiens clone NH0521D03, complete sequence
          Length = 35960

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 71    gattgttcaggtgggaagt 89
             |||||||||||||||||||
Sbjct: 19492 gattgttcaggtgggaagt 19510
to top
>emb|AL954355.10| Mouse DNA sequence from clone RP23-94F6 on chromosome X, complete
              sequence
          Length = 133265

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 94     gcacaacattctgaacata 112
              |||||||||||||||||||
Sbjct: 119639 gcacaacattctgaacata 119657
to top
>gb|AC004087.1|AC004087 Homo sapiens Xp22 GSHB-314C4 (Genome Systems Human BAC library)
             complete sequence
          Length = 124791

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 94    gcacaacattctgaacata 112
             |||||||||||||||||||
Sbjct: 74767 gcacaacattctgaacata 74749
to top
>gb|AC134907.5| Mus musculus BAC clone RP23-362K17 from 8, complete sequence
          Length = 186341

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 54     agaatattaagataataga 72
              |||||||||||||||||||
Sbjct: 107831 agaatattaagataataga 107813
to top
>gb|AC165349.2| Mus musculus BAC clone RP23-212M22 from chromosome 12, complete sequence
          Length = 199483

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 95     cacaacattctgaacataacagg 117
              |||||||| ||||||||||||||
Sbjct: 107456 cacaacatcctgaacataacagg 107478
to top
>gb|DP000019.1| Callicebus moloch target 1 genomic scaffold
          Length = 2105003

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 53      cagaatattaagataatag 71
               |||||||||||||||||||
Sbjct: 2103922 cagaatattaagataatag 2103940
to top
>emb|AL929054.5| Mouse DNA sequence from clone RP23-454A14 on chromosome 2, complete
             sequence
          Length = 198497

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 6     tggacagaaaggcaaaaca 24
             |||||||||||||||||||
Sbjct: 72030 tggacagaaaggcaaaaca 72012


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,642,692
Number of Sequences: 3902068
Number of extensions: 1642692
Number of successful extensions: 117431
Number of sequences better than 10.0: 83
Number of HSP's better than 10.0 without gapping: 84
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 117065
Number of HSP's gapped (non-prelim): 366
length of query: 185
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 163
effective length of database: 17,147,199,772
effective search space: 2794993562836
effective search space used: 2794993562836
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top