>gb|AY293578.1| Haloarcula sp. D1 amino acid ABC transporter ATP-binding protein
(abc) gene, partial cds; acetyl-CoA synthetase
(ADP-forming) alpha subunit (acdA), acetyl-CoA
synthetase (ADP-forming) beta subunit (acdB),
4-hydroxybenzoyl-CoA thioesterase (tie), and gentisate
1,2-dioxygenase (gdo) genes, complete cds; and
Leu/Ile/Val-binding protein gene, partial cds
Length = 5709
Score = 42.1 bits (21), Expect = 0.70
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 156 accaccgcgccgacgccggcc 176
|||||||||||||||||||||
Sbjct: 868 accaccgcgccgacgccggcc 848
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
Length = 7036071
Score = 40.1 bits (20), Expect = 2.8
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 160 ccgcgccgacgccggccccgtcgc 183
|||||||| |||||||||||||||
Sbjct: 5616253 ccgcgccgccgccggccccgtcgc 5616276
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,211,905
Number of Sequences: 3902068
Number of extensions: 1211905
Number of successful extensions: 89079
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 88612
Number of HSP's gapped (non-prelim): 466
length of query: 217
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 195
effective length of database: 17,147,199,772
effective search space: 3343703955540
effective search space used: 3343703955540
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)