>gb|BC064194.1| Xenopus tropicalis 2-4-dienoyl-Coenzyme A reductase 2, peroxisomal,
            mRNA (cDNA clone IMAGE:5307739), partial cds
          Length = 1322

 Score = 42.1 bits (21), Expect = 0.48
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 115  tcattgccctttgccctggca 135
            |||||||||||||||||||||
Sbjct: 1184 tcattgccctttgccctggca 1164

>gb|AC149152.3| Xenopus tropicalis clone ISB-217F3, complete sequence
          Length = 53218

 Score = 42.1 bits (21), Expect = 0.48
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 115   tcattgccctttgccctggca 135
             |||||||||||||||||||||
Sbjct: 16967 tcattgccctttgccctggca 16987

>gb|AC118621.6| Mus musculus chromosome 7, clone RP24-63H14, complete sequence
          Length = 230898

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                         
Query: 1      tattcattgatttttntacaagagtta 27
              ||||||| ||||||| |||||||||||
Sbjct: 180401 tattcatagatttttatacaagagtta 180427

>gb|AC074369.6| Homo sapiens BAC clone RP11-467K21 from 7, complete sequence
          Length = 61119

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 25    ttataaatagatactcattg 44
             ||||||||||||||||||||
Sbjct: 20865 ttataaatagatactcattg 20884

>gb|AC087672.7| Homo sapiens chromosome 8, clone RP11-6I2, complete sequence
          Length = 152061

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 38    ctcattgcatattntatttgga 59
             ||||||||||||| ||||||||
Sbjct: 46247 ctcattgcatattgtatttgga 46268

>gb|CP000232.1| Moorella thermoacetica ATCC 39073, complete genome
          Length = 2628784

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 118     ttgccctttgccctggcag 136
               |||||||||||||||||||
Sbjct: 1067366 ttgccctttgccctggcag 1067384

>gb|AC007158.10|AC007158 Homo sapiens, clone RP11-90A1, complete sequence
          Length = 201299

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 19     caagagttataaatagata 37
              |||||||||||||||||||
Sbjct: 152956 caagagttataaatagata 152974

>gb|AC096732.3| Homo sapiens BAC clone RP11-93L9 from 4, complete sequence
          Length = 184810

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 25    ttataaatagatactcattgcat 47
             |||||||||||||||||| ||||
Sbjct: 76413 ttataaatagatactcatggcat 76435

>gb|AC007092.4| Homo sapiens BAC clone RP11-90D1 from 2, complete sequence
          Length = 157176

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 19    caagagttataaatagata 37
             |||||||||||||||||||
Sbjct: 19883 caagagttataaatagata 19865

>gb|AC091266.8| Mus musculus chromosome 1, clone RP23-366C1, complete sequence
          Length = 177529

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 25     ttataaatagatactcatt 43
              |||||||||||||||||||
Sbjct: 121598 ttataaatagatactcatt 121580

>dbj|AP002956.1| Homo sapiens genomic DNA, chromosome 11q clone:R1105h09, complete
              sequence
          Length = 219574

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 119    tgccctttgccctggcaggcccg 141
              |||| ||||||||||||||||||
Sbjct: 187954 tgccgtttgccctggcaggcccg 187976


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 851,235
Number of Sequences: 3902068
Number of extensions: 851235
Number of successful extensions: 67429
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 67390
Number of HSP's gapped (non-prelim): 39
length of query: 155
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 133
effective length of database: 17,147,199,772
effective search space: 2280577569676
effective search space used: 2280577569676
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)