>gb|AF479054.1| Triticum aestivum cytochrome reductase mRNA, partial cds
          Length = 348

 Score =  101 bits (51), Expect = 5e-19
 Identities = 94/110 (85%)
 Strand = Plus / Minus

                                                                       
Query: 17  tcactcttggtggattatagaacatggaaattccaactgctgcgatnttggagaaagctc 76
           |||||||||| ||||||||||||||||||||||||||||||  ||  || || |||||| 
Sbjct: 348 tcactcttggcggattatagaacatggaaattccaactgctttgacatttgacaaagctt 289

                                                             
Query: 77  cacctttagtatctgngggacagcttctnctgctncttgtaccacatcgc 126
           ||| | ||||||||| |||||||| ||| ||||| ||||||  |||||||
Sbjct: 288 cacatctagtatctgtgggacagcntctcctgctccttgtagtacatcgc 239

>gb|BT017053.1| Zea mays clone EL01N0354D06.c mRNA sequence
          Length = 530

 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 81  tttagtatctgngggacagcttctnctgctncttgtaccacat 123
           |||| |||||| |||| ||||||| ||||| ||||||||||||
Sbjct: 298 tttaatatctgtgggaaagcttctcctgctccttgtaccacat 256

>gb|AY103678.1| Zea mays PCO101383 mRNA sequence
          Length = 637

 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 81  tttagtatctgngggacagcttctnctgctncttgtaccacat 123
           ||||||||||| |||| ||||||| |||||  |||||||||||
Sbjct: 397 tttagtatctgtgggaaagcttctcctgctctttgtaccacat 355

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                    
Query: 81      tttagtatctgngggacagcttctnctgctncttgta 117
               ||||||||||| |||| ||||||| ||||| ||||||
Sbjct: 3866960 tttagtatctgtgggatagcttctcctgctccttgta 3866924



 Score = 48.1 bits (24), Expect = 0.007
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                    
Query: 81      tttagtatctgngggacagcttctnctgctncttgta 117
               ||||||||||| |||| ||||||| ||||| ||||||
Sbjct: 3828904 tttagtatctgtgggatagcttctcctgctccttgta 3828868

>dbj|AP002069.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0015E04
          Length = 152046

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                   
Query: 81     tttagtatctgngggacagcttctnctgctncttgta 117
              ||||||||||| |||| ||||||| ||||| ||||||
Sbjct: 124914 tttagtatctgtgggatagcttctcctgctccttgta 124878



 Score = 48.1 bits (24), Expect = 0.007
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                  
Query: 81    tttagtatctgngggacagcttctnctgctncttgta 117
             ||||||||||| |||| ||||||| ||||| ||||||
Sbjct: 86858 tttagtatctgtgggatagcttctcctgctccttgta 86822

>dbj|AK120341.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013061B12, full
           insert sequence
          Length = 564

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 81  tttagtatctgngggacagcttctnctgctncttgta 117
           ||||||||||| |||| ||||||| ||||| ||||||
Sbjct: 322 tttagtatctgtgggatagcttctcctgctccttgta 286

>dbj|AK119716.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-F09, full
           insert sequence
          Length = 552

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 81  tttagtatctgngggacagcttctnctgctncttgta 117
           ||||||||||| |||| ||||||| ||||| ||||||
Sbjct: 321 tttagtatctgtgggatagcttctcctgctccttgta 285

>emb|AL844904.4| Mouse DNA sequence from clone RP23-315J3 on chromosome X, complete
             sequence
          Length = 186544

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 30    attatagaacatggaaattc 49
             ||||||||||||||||||||
Sbjct: 46299 attatagaacatggaaattc 46280

>emb|AL023850.1|CEY67D11A Caenorhabditis elegans YAC Y67D11A, complete sequence
          Length = 12805

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 30   attatagaacatggaaatt 48
            |||||||||||||||||||
Sbjct: 9620 attatagaacatggaaatt 9602

>emb|AL391688.1| Human DNA sequence from clone RP11-524D16 on chromosome X Contains the
             3' end of the gene for sushi-repeat protein (SRPUL) and
             the 3' end of the SYTL4 gene for synaptotagmin-like 4
             (granuphilin-a), complete sequence
          Length = 46229

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 28    ggattatagaacatggaaa 46
             |||||||||||||||||||
Sbjct: 20790 ggattatagaacatggaaa 20772

>emb|AL158217.25| Human DNA sequence from clone RP4-650H14 on chromosome 1p36.23-36.33
             Contains the 3' end of the ESPN gene for espin, the
             TNFRSF25 gene for tumor necrosis factor receptor
             superfamily member 25, the gene for a novel PH
             domain-containing protein and four CpG islands, complete
             sequence
          Length = 53983

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 73    gctccacctttagtatctg 91
             |||||||||||||||||||
Sbjct: 30185 gctccacctttagtatctg 30203

>gb|AC131602.4| Rattus norvegicus 2 BAC CH230-33J10 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 216155

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 73     gctccacctttagtatctg 91
              |||||||||||||||||||
Sbjct: 114483 gctccacctttagtatctg 114501

>emb|BX005472.11| Zebrafish DNA sequence from clone CH211-119C22 in linkage group 11,
              complete sequence
          Length = 158170

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 27     tggattatagaacatggaa 45
              |||||||||||||||||||
Sbjct: 136115 tggattatagaacatggaa 136133


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 736,647
Number of Sequences: 3902068
Number of extensions: 736647
Number of successful extensions: 38096
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 38073
Number of HSP's gapped (non-prelim): 23
length of query: 134
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 113
effective length of database: 17,151,101,840
effective search space: 1938074507920
effective search space used: 1938074507920
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)