>gb|AC010125.4| Homo sapiens PAC clone RP5-1075C10 from 7, complete sequence
          Length = 171457

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 50     tgtcagtgtattataggcagaa 71
              ||||||||||||||||||||||
Sbjct: 131892 tgtcagtgtattataggcagaa 131913

>gb|AC145819.1| Pan troglodytes BAC clone RP43-99J22 from 7, complete sequence
          Length = 159950

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 50     tgtcagtgtattataggcagaa 71
              ||||||||||||||||||||||
Sbjct: 117145 tgtcagtgtattataggcagaa 117124

>ref|XM_799485.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053507947.10) partial mRNA
          Length = 2559

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 236  aatctgtcctgtaatcttgcctgcc 260
            |||||||||||||| ||||||||||
Sbjct: 1965 aatctgtcctgtaagcttgcctgcc 1989

>gb|CP000057.1| Haemophilus influenzae strain 86-028NP, complete genome
          Length = 1913428

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 15      accacgtccgtggaataaag 34
               ||||||||||||||||||||
Sbjct: 1332564 accacgtccgtggaataaag 1332583

>gb|AC165305.4| Mus musculus chromosome 8, clone RP23-101P20, complete sequence
          Length = 193230

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 107   catgataacatcttggcttg 126
             ||||||||||||||||||||
Sbjct: 67087 catgataacatcttggcttg 67068

>gb|AC098717.3| Mus musculus BAC clone RP23-2G2 from 12, complete sequence
          Length = 211702

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 516    ctgttttgtttgtgaccatc 535
              ||||||||||||||||||||
Sbjct: 195325 ctgttttgtttgtgaccatc 195344

>emb|AL591416.4| Human DNA sequence from clone RP11-108N13 on chromosome 6 Contains a
              ribosomal protein L6 (RPL6) pseudogene and the 5' end of a
              novel gene, complete sequence
          Length = 157068

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 212    ttgctgaaggttaaaatgtt 231
              ||||||||||||||||||||
Sbjct: 148935 ttgctgaaggttaaaatgtt 148916

>emb|AL354696.11| Human DNA sequence from clone RP11-74J13 on chromosome 13 Contains a
             novel gene (FLJ30271, FLJ13413, DKFZp547M073), a
             calmodulin pseudogene, a novel gene (DKFZP434E2318), the
             MTFR1 gene for mitochondrial translational release factor
             1 (RF1, MTTRF1), a ras homolog gene family, member G (rho
             G) (ARHG) pseudogene, the 5' end of the gene for a novel
             TPR domain containing protein and 3 CpG islands, complete
             sequence
          Length = 202565

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 199   ctgaaaatatattttgctga 218
             ||||||||||||||||||||
Sbjct: 54338 ctgaaaatatattttgctga 54357

>emb|AL049758.11|HSJ437M21 Human DNA sequence from clone RP3-437M21 on chromosome 22q13.2-13.33,
             complete sequence
          Length = 87402

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 394   tacatacataccattgctga 413
             ||||||||||||||||||||
Sbjct: 83320 tacatacataccattgctga 83301

>emb|BX324225.7| Zebrafish DNA sequence from clone DKEY-180I22 in linkage group 21,
             complete sequence
          Length = 207125

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 200   tgaaaatatattttgctgaa 219
             ||||||||||||||||||||
Sbjct: 24613 tgaaaatatattttgctgaa 24632

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                            
Query: 295      aaagtggtgtgttacgtcattgaagttatttataggtctgacaa 338
                |||||| |||||||| |||||||||||  ||||| | |||||||
Sbjct: 25424558 aaagtgatgtgttacatcattgaagttggttatacgcctgacaa 25424601

>dbj|AP004192.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1643_A10
          Length = 130037

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                         
Query: 295   aaagtggtgtgttacgtcattgaagttatttataggtctgacaa 338
             |||||| |||||||| |||||||||||  ||||| | |||||||
Sbjct: 80220 aaagtgatgtgttacatcattgaagttggttatacgcctgacaa 80263

>emb|CT010460.16| Mouse DNA sequence from clone RP23-311G21 on chromosome 12, complete
             sequence
          Length = 243288

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 516   ctgttttgtttgtgaccatc 535
             ||||||||||||||||||||
Sbjct: 81947 ctgttttgtttgtgaccatc 81928

>dbj|AB016815.1| Anthocidaris crassispina mRNA for Src-type protein tyrosine kinase,
           complete cds
          Length = 2019

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 315 tgaagttatttataggtctg 334
           ||||||||||||||||||||
Sbjct: 232 tgaagttatttataggtctg 213

>gb|L42023.1| Haemophilus influenzae Rd KW20, complete genome
          Length = 1830138

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 15      accacgtccgtggaataaag 34
               ||||||||||||||||||||
Sbjct: 1700547 accacgtccgtggaataaag 1700528

>dbj|AP002905.2| Homo sapiens genomic DNA, chromosome 8q23, clone:KB1672E10
          Length = 158401

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 202   aaaatatattttgctgaagg 221
             ||||||||||||||||||||
Sbjct: 46771 aaaatatattttgctgaagg 46752


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,347,958
Number of Sequences: 3902068
Number of extensions: 5347958
Number of successful extensions: 87731
Number of sequences better than 10.0: 16
Number of HSP's better than 10.0 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 87649
Number of HSP's gapped (non-prelim): 82
length of query: 662
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 639
effective length of database: 17,143,297,704
effective search space: 10954567232856
effective search space used: 10954567232856
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)