ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal29f20
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AK112051.1| Oryza sativa (japonica cultivar-group) cDNA clon... 363 4e-97
2dbj|AK099388.1| Oryza sativa (japonica cultivar-group) cDNA clon... 363 4e-97
3gb|AY104951.1| Zea mays PCO082478 mRNA sequence 303 3e-79
4dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 285 7e-74
5dbj|AP005396.3| Oryza sativa (japonica cultivar-group) genomic D... 285 7e-74
6dbj|AP005090.3| Oryza sativa (japonica cultivar-group) genomic D... 285 7e-74
7gb|AY104915.1| Zea mays PCO082477 mRNA sequence 117 4e-23
8ref|NM_116283.2| Arabidopsis thaliana unknown protein AT4G00585 ... 50 0.007
9gb|AY091239.1| Arabidopsis thaliana unknown protein (At4g00585) ... 50 0.007
10gb|AY063842.1| Arabidopsis thaliana unknown protein (At4g00585) ... 50 0.007
11emb|AL161472.2|ATCHRIV2 Arabidopsis thaliana DNA chromosome 4, c... 50 0.007
12emb|BX828090.1|CNS0A3SJ Arabidopsis thaliana Full-length cDNA Co... 50 0.007
13emb|BX827289.1|CNS0A3P8 Arabidopsis thaliana Full-length cDNA Co... 50 0.007
14gb|AY085811.1| Arabidopsis thaliana clone 18459 mRNA, complete s... 50 0.007
15dbj|AK118700.1| Arabidopsis thaliana mRNA for unknown protein, c... 50 0.007
16gb|AF058919.2|F6N23 Arabidopsis thaliana BAC F6N23 50 0.007
17gb|AC148817.3| Medicago truncatula chromosome 7 BAC clone mth2-2... 46 0.11
18gb|AC102680.10| Mus musculus chromosome 8, clone RP24-88L18, com... 46 0.11
19gb|CP000089.1| Dechloromonas aromatica RCB, complete genome 42 1.7
20gb|AC104012.11| Homo sapiens chromosome 8, clone RP11-281N10, co... 42 1.7
21dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
22gb|AF165147.1|AF165147 Homo sapiens chromosome 21q22.1, PAC I228... 42 1.7
23dbj|BS000165.1| Pan troglodytes chromosome 22 clone:PTB-057B23, ... 42 1.7
24emb|AL163247.2|HS21C047 Homo sapiens chromosome 21 segment HS21C047 42 1.7
25emb|BX957275.7| Zebrafish DNA sequence from clone DKEY-220E22 in... 42 1.7
26gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, com... 42 1.7
27gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ... 42 1.7
28emb|AL663011.2|OSJN00215 Oryza sativa genomic DNA, chromosome 4,... 42 1.7
29ref|NM_193237.1| Oryza sativa (japonica cultivar-group), predic... 40 6.9
30gb|BT019290.1| Zea mays clone Contig963.F mRNA sequence 40 6.9
31gb|AC149783.2| Bos taurus BAC CH240-3K17 (Children's Hospital O... 40 6.9
32gb|AC161005.4| Pan troglodytes BAC clone CH251-668M6 from chromo... 40 6.9
33gb|AY813451.1| Schistosoma japonicum SJCHGC08298 protein mRNA, c... 40 6.9
34gb|AC159321.3| Mus musculus BAC clone RP23-18G14 from chromosome... 40 6.9
35gb|AC103934.10| Mus musculus chromosome 6, clone RP23-287O14, co... 40 6.9
36gb|AF457781.1| Schizothorax progastus haplotype SPR332-5f2 mitoc... 40 6.9
37gb|AF457780.1| Schizothorax progastus haplotype SPR332-3f2 mitoc... 40 6.9
38gb|AF457779.1| Schizothorax progastus haplotype SPR332-2f2 mitoc... 40 6.9
39gb|AF457778.1| Schizothorax progastus haplotype SPR332-1f2 mitoc... 40 6.9
40gb|AF457777.1| Schizothorax richardsonii haplotype SRI330-2f2 mi... 40 6.9
41gb|AF457776.1| Schizothorax richardsonii haplotype SRI330-1f2 mi... 40 6.9
42gb|AF457775.1| Schizothorax richardsonii haplotype SRI324-3f2 mi... 40 6.9
43gb|AF457774.1| Schizothorax richardsonii haplotype SRI324-2f2 mi... 40 6.9
44gb|AF457772.1| Schizothorax macrophthalmus haplotype SMA326-9f2 ... 40 6.9
45gb|AF457771.1| Schizothorax macrophthalmus haplotype SMA326-8f2 ... 40 6.9
46gb|AF457770.1| Schizothorax macrophthalmus haplotype SMA326-7f2 ... 40 6.9
47gb|AF457769.1| Schizothorax macrophthalmus haplotype SMA326-5f2 ... 40 6.9
48gb|AF457768.1| Schizothorax nepalensis haplotype SNE327-9f2 mito... 40 6.9
49gb|AF457767.1| Schizothorax nepalensis haplotype SNE327-8f2 mito... 40 6.9
50gb|AF457766.1| Schizothorax nepalensis haplotype SNE327-7f2 mito... 40 6.9
51gb|AF457765.1| Schizothorax nepalensis haplotype SNE327-6f2 mito... 40 6.9
52gb|AF457764.1| Schizothorax nepalensis haplotype SNE327-5f2 mito... 40 6.9
53gb|AF457763.1| Schizothorax nepalensis haplotype SNE327-4f2 mito... 40 6.9
54gb|AF457762.1| Schizothorax nepalensis haplotype SNE327-3f2 mito... 40 6.9
55gb|AF457761.1| Schizothorax nepalensis haplotype SNE327-1f2 mito... 40 6.9
56gb|AF457760.1| Schizothorax raraensis haplotype SrA325-8f2 mitoc... 40 6.9
57gb|AF457759.1| Schizothorax raraensis haplotype SRA325-7f2 mitoc... 40 6.9
58gb|AF457757.1| Schizothorax raraensis haplotype SRA325-4f2 mitoc... 40 6.9
59gb|AF457756.1| Schizothorax raraensis haplotype SRA325-3f2 mitoc... 40 6.9
60gb|AF457754.1| Schizothorax raraensis haplotype SRA326-13f2 mito... 40 6.9
61gb|AF457753.1| Schizothorax raraensis haplotype SRA326-12f2 mito... 40 6.9
62emb|CR450787.6| Zebrafish DNA sequence from clone CH211-222O17 i... 40 6.9
63gb|AC002382.1| Homo sapiens BAC clone CTB-22J17 from 7, complete... 40 6.9
64gb|AC117436.6| Homo sapiens 3 BAC RP11-69K16 (Roswell Park Cance... 40 6.9
65emb|BX294138.1| Pirellula sp. strain 1 complete genome; segment ... 40 6.9
66gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome 40 6.9
67gb|CP000133.1| Rhizobium etli CFN 42, complete genome 40 6.9
68gb|AF087022.1|AF087022 Streptomyces venezuelae cytochrome P450 m... 40 6.9
69gb|AC161386.4| Pan troglodytes BAC clone CH251-497P4 from chromo... 40 6.9
70gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome 40 6.9
71dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
72dbj|AP003449.2| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
73gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 40 6.9
74gb|AC128714.15| Homo sapiens 3 BAC RP11-433C9 (Roswell Park Canc... 40 6.9
75dbj|AP005572.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
76gb|AY110731.1| Zea mays CL6588_1 mRNA sequence 40 6.9
77emb|AL136298.5|CNS01DW2 Human chromosome 14 DNA sequence BAC R-1... 40 6.9
78gb|AE015927.1| Clostridium tetani E88, complete genome 40 6.9
79gb|AF079139.1|AF079139 Streptomyces venezuelae pikCD operon, com... 40 6.9
80gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome 40 6.9
81dbj|AP003972.2| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 6.9 
>dbj|AK112051.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-104-E03, full
           insert sequence
          Length = 636

 Score =  363 bits (183), Expect = 4e-97
 Identities = 246/267 (92%)
 Strand = Plus / Minus

                                                                       
Query: 146 tccttcagtattccttcttgccaaagttcttgcaccaaagctgggatgggattggccgga 205
           ||||||| || || |||||||||||||| ||||||||||| || |||||||| |||||||
Sbjct: 318 tccttcaatactctttcttgccaaagtttttgcaccaaagttgagatgggatcggccgga 259

                                                                       
Query: 206 ctgggtggtgcgggcgttgctcgagctcggcggatttcatggcgatggggatgcagacga 265
           | ||||| || ||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 258 ccgggtgatgtgggcgttgctcgagctcggcggacttcatggcgatggggatgcagacga 199

                                                                       
Query: 266 ggaagatgccgaccatggcgatggcggtgttgcggcgccagtggacgggccggcagtagg 325
           |||||| ||||| |||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 198 ggaagacgccgaacatggcgatggcggtgttgcggcgccagtgcacgggccggcagtagg 139

                                                                       
Query: 326 gcccgcccgtcatgctccacaccttctgccggaagtcgccgccgctcgggccgtggccgc 385
           ||||||||||||||||||| ||||||||||||||||||||||| |   ||||||| ||||
Sbjct: 138 gcccgcccgtcatgctccataccttctgccggaagtcgccgcctccgtggccgtgcccgc 79

                                      
Query: 386 catggtcgccgcccatctccgccgccg 412
           ||||||||||||||||| |||||||||
Sbjct: 78  catggtcgccgcccatcgccgccgccg 52
to top
>dbj|AK099388.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033076P14, full
           insert sequence
          Length = 473

 Score =  363 bits (183), Expect = 4e-97
 Identities = 246/267 (92%)
 Strand = Plus / Minus

                                                                       
Query: 146 tccttcagtattccttcttgccaaagttcttgcaccaaagctgggatgggattggccgga 205
           ||||||| || || |||||||||||||| ||||||||||| || |||||||| |||||||
Sbjct: 307 tccttcaatactctttcttgccaaagtttttgcaccaaagttgagatgggatcggccgga 248

                                                                       
Query: 206 ctgggtggtgcgggcgttgctcgagctcggcggatttcatggcgatggggatgcagacga 265
           | ||||| || ||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 247 ccgggtgatgtgggcgttgctcgagctcggcggacttcatggcgatggggatgcagacga 188

                                                                       
Query: 266 ggaagatgccgaccatggcgatggcggtgttgcggcgccagtggacgggccggcagtagg 325
           |||||| ||||| |||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 187 ggaagacgccgaacatggcgatggcggtgttgcggcgccagtgcacgggccggcagtagg 128

                                                                       
Query: 326 gcccgcccgtcatgctccacaccttctgccggaagtcgccgccgctcgggccgtggccgc 385
           ||||||||||||||||||| ||||||||||||||||||||||| |   ||||||| ||||
Sbjct: 127 gcccgcccgtcatgctccataccttctgccggaagtcgccgcctccgtggccgtgcccgc 68

                                      
Query: 386 catggtcgccgcccatctccgccgccg 412
           ||||||||||||||||| |||||||||
Sbjct: 67  catggtcgccgcccatcgccgccgccg 41
to top
>gb|AY104951.1| Zea mays PCO082478 mRNA sequence
          Length = 673

 Score =  303 bits (153), Expect = 3e-79
 Identities = 207/225 (92%)
 Strand = Plus / Minus

                                                                       
Query: 145 gtccttcagtattccttcttgccaaagttcttgcaccaaagctgggatgggattggccgg 204
           |||||||||||||||||||| |||||||| |||||||| || || |||||||||||||||
Sbjct: 380 gtccttcagtattccttcttaccaaagtttttgcaccacagttgagatgggattggccgg 321

                                                                       
Query: 205 actgggtggtgcgggcgttgctcgagctcggcggatttcatggcgatggggatgcagacg 264
           |||||||| |||||||||||||||||||| ||||| ||||| |||||||||||||||| |
Sbjct: 320 actgggtgatgcgggcgttgctcgagctctgcggacttcatagcgatggggatgcagatg 261

                                                                       
Query: 265 aggaagatgccgaccatggcgatggcggtgttgcggcgccagtggacgggccggcagtag 324
           ||||||| ||||| |||||||||||||||||| ||||||||||||||||| |||||||| 
Sbjct: 260 aggaagacgccgaacatggcgatggcggtgttacggcgccagtggacggggcggcagtac 201

                                                        
Query: 325 ggcccgcccgtcatgctccacaccttctgccggaagtcgccgccg 369
           || ||||||||||||||||| |||||||| |||||||||||||||
Sbjct: 200 gggccgcccgtcatgctccataccttctggcggaagtcgccgccg 156
to top
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  285 bits (144), Expect = 7e-74
 Identities = 177/188 (94%)
 Strand = Plus / Plus

                                                                            
Query: 225      ctcgagctcggcggatttcatggcgatggggatgcagacgaggaagatgccgaccatggc 284
                ||||||||||||||| ||||||||||||||||||||||||||||||| ||||| ||||||
Sbjct: 21962742 ctcgagctcggcggacttcatggcgatggggatgcagacgaggaagacgccgaacatggc 21962801

                                                                            
Query: 285      gatggcggtgttgcggcgccagtggacgggccggcagtagggcccgcccgtcatgctcca 344
                |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 21962802 gatggcggtgttgcggcgccagtgcacgggccggcagtagggcccgcccgtcatgctcca 21962861

                                                                            
Query: 345      caccttctgccggaagtcgccgccgctcgggccgtggccgccatggtcgccgcccatctc 404
                 ||||||||||||||||||||||| |   ||||||| ||||||||||||||||||||| |
Sbjct: 21962862 taccttctgccggaagtcgccgcctccgtggccgtgcccgccatggtcgccgcccatcgc 21962921

                        
Query: 405      cgccgccg 412
                ||||||||
Sbjct: 21962922 cgccgccg 21962929



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Plus

                                                                            
Query: 146      tccttcagtattccttcttgccaaagttcttgcaccaaagctgggatgggattggccgga 205
                ||||||| || || |||||||||||||| ||||||||||| || |||||||| |||||||
Sbjct: 21961132 tccttcaatactctttcttgccaaagtttttgcaccaaagttgagatgggatcggccgga 21961191

                                     
Query: 206      ctgggtggtgcgggcgttgct 226
                | ||||| || ||||||||||
Sbjct: 21961192 ccgggtgatgtgggcgttgct 21961212



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 360      gtcgccgccgctcgggccgt 379
                ||||||||||||||||||||
Sbjct: 11786273 gtcgccgccgctcgggccgt 11786254
to top
>dbj|AP005396.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
            clone:P0635G10
          Length = 146728

 Score =  285 bits (144), Expect = 7e-74
 Identities = 177/188 (94%)
 Strand = Plus / Plus

                                                                        
Query: 225  ctcgagctcggcggatttcatggcgatggggatgcagacgaggaagatgccgaccatggc 284
            ||||||||||||||| ||||||||||||||||||||||||||||||| ||||| ||||||
Sbjct: 4806 ctcgagctcggcggacttcatggcgatggggatgcagacgaggaagacgccgaacatggc 4865

                                                                        
Query: 285  gatggcggtgttgcggcgccagtggacgggccggcagtagggcccgcccgtcatgctcca 344
            |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 4866 gatggcggtgttgcggcgccagtgcacgggccggcagtagggcccgcccgtcatgctcca 4925

                                                                        
Query: 345  caccttctgccggaagtcgccgccgctcgggccgtggccgccatggtcgccgcccatctc 404
             ||||||||||||||||||||||| |   ||||||| ||||||||||||||||||||| |
Sbjct: 4926 taccttctgccggaagtcgccgcctccgtggccgtgcccgccatggtcgccgcccatcgc 4985

                    
Query: 405  cgccgccg 412
            ||||||||
Sbjct: 4986 cgccgccg 4993



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Plus

                                                                        
Query: 146  tccttcagtattccttcttgccaaagttcttgcaccaaagctgggatgggattggccgga 205
            ||||||| || || |||||||||||||| ||||||||||| || |||||||| |||||||
Sbjct: 3196 tccttcaatactctttcttgccaaagtttttgcaccaaagttgagatgggatcggccgga 3255

                                 
Query: 206  ctgggtggtgcgggcgttgct 226
            | ||||| || ||||||||||
Sbjct: 3256 ccgggtgatgtgggcgttgct 3276
to top
>dbj|AP005090.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OJ1065_E04
          Length = 115865

 Score =  285 bits (144), Expect = 7e-74
 Identities = 177/188 (94%)
 Strand = Plus / Plus

                                                                         
Query: 225   ctcgagctcggcggatttcatggcgatggggatgcagacgaggaagatgccgaccatggc 284
             ||||||||||||||| ||||||||||||||||||||||||||||||| ||||| ||||||
Sbjct: 93459 ctcgagctcggcggacttcatggcgatggggatgcagacgaggaagacgccgaacatggc 93518

                                                                         
Query: 285   gatggcggtgttgcggcgccagtggacgggccggcagtagggcccgcccgtcatgctcca 344
             |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 93519 gatggcggtgttgcggcgccagtgcacgggccggcagtagggcccgcccgtcatgctcca 93578

                                                                         
Query: 345   caccttctgccggaagtcgccgccgctcgggccgtggccgccatggtcgccgcccatctc 404
              ||||||||||||||||||||||| |   ||||||| ||||||||||||||||||||| |
Sbjct: 93579 taccttctgccggaagtcgccgcctccgtggccgtgcccgccatggtcgccgcccatcgc 93638

                     
Query: 405   cgccgccg 412
             ||||||||
Sbjct: 93639 cgccgccg 93646



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Plus

                                                                         
Query: 146   tccttcagtattccttcttgccaaagttcttgcaccaaagctgggatgggattggccgga 205
             ||||||| || || |||||||||||||| ||||||||||| || |||||||| |||||||
Sbjct: 91849 tccttcaatactctttcttgccaaagtttttgcaccaaagttgagatgggatcggccgga 91908

                                  
Query: 206   ctgggtggtgcgggcgttgct 226
             | ||||| || ||||||||||
Sbjct: 91909 ccgggtgatgtgggcgttgct 91929
to top
>gb|AY104915.1| Zea mays PCO082477 mRNA sequence
          Length = 1855

 Score =  117 bits (59), Expect = 4e-23
 Identities = 77/83 (92%)
 Strand = Plus / Minus

                                                                        
Query: 145  gtccttcagtattccttcttgccaaagttcttgcaccaaagctgggatgggattggccgg 204
            |||||||||||||||||||| |||||||| |||||||| || || |||||||||||||||
Sbjct: 1698 gtccttcagtattccttcttaccaaagtttttgcaccacagttgagatgggattggccgg 1639

                                   
Query: 205  actgggtggtgcgggcgttgctc 227
            |||||||| ||||||||||||||
Sbjct: 1638 actgggtgatgcgggcgttgctc 1616
to top
>ref|NM_116283.2| Arabidopsis thaliana unknown protein AT4G00585 mRNA, complete cds
          Length = 558

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                       
Query: 245 tggcgatggggatgcagacgaggaagatgccgaccatggcgatggcggtgttgcggcgcc 304
           |||||||||||||||| || ||||| | ||||| ||| || ||||||||||| || ||||
Sbjct: 246 tggcgatggggatgcacacaaggaaaacgccgaacatagcaatggcggtgttccgacgcc 187

            
Query: 305 a 305
           |
Sbjct: 186 a 186
to top
>gb|AY091239.1| Arabidopsis thaliana unknown protein (At4g00585) mRNA, complete cds
          Length = 298

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                       
Query: 245 tggcgatggggatgcagacgaggaagatgccgaccatggcgatggcggtgttgcggcgcc 304
           |||||||||||||||| || ||||| | ||||| ||| || ||||||||||| || ||||
Sbjct: 157 tggcgatggggatgcacacaaggaaaacgccgaacatagcaatggcggtgttccgacgcc 98

            
Query: 305 a 305
           |
Sbjct: 97  a 97
to top
>gb|AY063842.1| Arabidopsis thaliana unknown protein (At4g00585) mRNA, complete cds
          Length = 565

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                       
Query: 245 tggcgatggggatgcagacgaggaagatgccgaccatggcgatggcggtgttgcggcgcc 304
           |||||||||||||||| || ||||| | ||||| ||| || ||||||||||| || ||||
Sbjct: 244 tggcgatggggatgcacacaaggaaaacgccgaacatagcaatggcggtgttccgacgcc 185

            
Query: 305 a 305
           |
Sbjct: 184 a 184
to top
>emb|AL161472.2|ATCHRIV2 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 2
          Length = 197975

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                         
Query: 245   tggcgatggggatgcagacgaggaagatgccgaccatggcgatggcggtgttgcggcgcc 304
             |||||||||||||||| || ||||| | ||||| ||| || ||||||||||| || ||||
Sbjct: 58815 tggcgatggggatgcacacaaggaaaacgccgaacatagcaatggcggtgttccgacgcc 58874

              
Query: 305   a 305
             |
Sbjct: 58875 a 58875
to top
>emb|BX828090.1|CNS0A3SJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH51ZB10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1370

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                       
Query: 245 tggcgatggggatgcagacgaggaagatgccgaccatggcgatggcggtgttgcggcgcc 304
           |||||||||||||||| || ||||| | ||||| ||| || ||||||||||| || ||||
Sbjct: 249 tggcgatggggatgcacacaaggaaaacgccgaacatagcaatggcggtgttccgacgcc 190

            
Query: 305 a 305
           |
Sbjct: 189 a 189
to top
>emb|BX827289.1|CNS0A3P8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS34ZC07 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1365

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                       
Query: 245 tggcgatggggatgcagacgaggaagatgccgaccatggcgatggcggtgttgcggcgcc 304
           |||||||||||||||| || ||||| | ||||| ||| || ||||||||||| || ||||
Sbjct: 233 tggcgatggggatgcacacaaggaaaacgccgaacatagcaatggcggtgttccgacgcc 174

            
Query: 305 a 305
           |
Sbjct: 173 a 173
to top
>gb|AY085811.1| Arabidopsis thaliana clone 18459 mRNA, complete sequence
          Length = 550

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                       
Query: 245 tggcgatggggatgcagacgaggaagatgccgaccatggcgatggcggtgttgcggcgcc 304
           |||||||||||||||| || ||||| | ||||| ||| || ||||||||||| || ||||
Sbjct: 244 tggcgatggggatgcacacaaggaaaacgccgaacatagcaatggcggtgttccgacgcc 185

            
Query: 305 a 305
           |
Sbjct: 184 a 184
to top
>dbj|AK118700.1| Arabidopsis thaliana mRNA for unknown protein, complete cds, clone:
           RAFL19-96-J18
          Length = 552

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                       
Query: 245 tggcgatggggatgcagacgaggaagatgccgaccatggcgatggcggtgttgcggcgcc 304
           |||||||||||||||| || ||||| | ||||| ||| || ||||||||||| || ||||
Sbjct: 246 tggcgatggggatgcacacaaggaaaacgccgaacatagcaatggcggtgttccgacgcc 187

            
Query: 305 a 305
           |
Sbjct: 186 a 186
to top
>gb|AF058919.2|F6N23 Arabidopsis thaliana BAC F6N23
          Length = 91849

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                         
Query: 245   tggcgatggggatgcagacgaggaagatgccgaccatggcgatggcggtgttgcggcgcc 304
             |||||||||||||||| || ||||| | ||||| ||| || ||||||||||| || ||||
Sbjct: 39941 tggcgatggggatgcacacaaggaaaacgccgaacatagcaatggcggtgttccgacgcc 40000

              
Query: 305   a 305
             |
Sbjct: 40001 a 40001
to top
>gb|AC148817.3| Medicago truncatula chromosome 7 BAC clone mth2-22c10, complete
             sequence
          Length = 123020

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                                
Query: 249   gatggggatgcagacgaggaagatgccgaccatggcgatggcggtgttgcg 299
             |||||| || || ||||||| ||| |||| ||| |||||||||||||||||
Sbjct: 50141 gatgggaatacaaacgaggacgataccgaacatagcgatggcggtgttgcg 50191



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 51/61 (83%)
 Strand = Plus / Plus

                                                                         
Query: 166   ccaaagttcttgcaccaaagctgggatgggattggccggactgggtggtgcgggcgttgc 225
             ||||||||||||||||| |  ||||| |||||||| || || ||||| || || ||||||
Sbjct: 46561 ccaaagttcttgcaccacatttgggaagggattggacgaaccgggtgatgtggtcgttgc 46620

              
Query: 226   t 226
             |
Sbjct: 46621 t 46621
to top
>gb|AC102680.10| Mus musculus chromosome 8, clone RP24-88L18, complete sequence
          Length = 201260

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 111   aaaaacaggattttctttgtgaa 133
             |||||||||||||||||||||||
Sbjct: 89625 aaaaacaggattttctttgtgaa 89603
to top
>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome
          Length = 4501104

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 270     gatgccgaccatggcgatggc 290
               |||||||||||||||||||||
Sbjct: 1169626 gatgccgaccatggcgatggc 1169646
to top
>gb|AC104012.11| Homo sapiens chromosome 8, clone RP11-281N10, complete sequence
          Length = 170668

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 118   ggattttctttgtgaaagtct 138
             |||||||||||||||||||||
Sbjct: 95590 ggattttctttgtgaaagtct 95610
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
               sequence
          Length = 35498469

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 390     gtcgccgcccatctccgccgccggt 414
               ||||||||| |||||||||||||||
Sbjct: 1951648 gtcgccgccgatctccgccgccggt 1951624
to top
>gb|AF165147.1|AF165147 Homo sapiens chromosome 21q22.1, PAC I2280, complete sequence
          Length = 146735

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 111   aaaaacaggattttctttgtg 131
             |||||||||||||||||||||
Sbjct: 46064 aaaaacaggattttctttgtg 46044
to top
>dbj|BS000165.1| Pan troglodytes chromosome 22 clone:PTB-057B23, map 22, complete
             sequences
          Length = 142215

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 111   aaaaacaggattttctttgtg 131
             |||||||||||||||||||||
Sbjct: 97321 aaaaacaggattttctttgtg 97301
to top
>emb|AL163247.2|HS21C047 Homo sapiens chromosome 21 segment HS21C047
          Length = 340000

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 111    aaaaacaggattttctttgtg 131
              |||||||||||||||||||||
Sbjct: 164542 aaaaacaggattttctttgtg 164522
to top
>emb|BX957275.7| Zebrafish DNA sequence from clone DKEY-220E22 in linkage group 20,
             complete sequence
          Length = 57535

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 112   aaaacaggattttctttgtgaaagt 136
             ||||||||||||| |||||||||||
Sbjct: 50852 aaaacaggattttttttgtgaaagt 50876
to top
>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence
          Length = 3809201

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 209     ggtggtgcgggcgttgctcga 229
               |||||||||||||||||||||
Sbjct: 1505327 ggtggtgcgggcgttgctcga 1505347
to top
>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 373     gggccgtggccgccatggtcgccgc 397
               ||||||| |||||||||||||||||
Sbjct: 4010605 gggccgtcgccgccatggtcgccgc 4010629



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 482    ggcgggccgcgccgctgctg 501
              ||||||||||||||||||||
Sbjct: 195996 ggcgggccgcgccgctgctg 196015
to top
>emb|AL663011.2|OSJN00215 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0080H08,
             complete sequence
          Length = 138127

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 390   gtcgccgcccatctccgccgccggt 414
             ||||||||| |||||||||||||||
Sbjct: 94885 gtcgccgccgatctccgccgccggt 94861
to top
>ref|NM_193237.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1071

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 380 ggccgccatggtcgccgccc 399
           ||||||||||||||||||||
Sbjct: 297 ggccgccatggtcgccgccc 316
to top
>gb|BT019290.1| Zea mays clone Contig963.F mRNA sequence
          Length = 760

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 174 cttgcaccaaagctgggatgggat 197
           |||||||||||| |||||||||||
Sbjct: 164 cttgcaccaaagatgggatgggat 187
to top
>gb|AC149783.2| Bos taurus  BAC CH240-3K17 (Children's Hospital Oakland Research
             Institute Bovine BAC Library (male)) complete sequence
          Length = 205084

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 84    ggttatgacaaaagaaggca 103
             ||||||||||||||||||||
Sbjct: 24486 ggttatgacaaaagaaggca 24505
to top
>gb|AC161005.4| Pan troglodytes BAC clone CH251-668M6 from chromosome 7, complete
              sequence
          Length = 217746

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 102    cacaaaggtaaaaacaggattttc 125
              ||||||| ||||||||||||||||
Sbjct: 120986 cacaaagataaaaacaggattttc 120963
to top
>gb|AY813451.1| Schistosoma japonicum SJCHGC08298 protein mRNA, complete cds
          Length = 844

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 113 aaacaggattttctttgtga 132
           ||||||||||||||||||||
Sbjct: 138 aaacaggattttctttgtga 119
to top
>gb|AC159321.3| Mus musculus BAC clone RP23-18G14 from chromosome 6, complete sequence
          Length = 202584

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 106    aaggtaaaaacaggattttctttg 129
              ||||||| ||||||||||||||||
Sbjct: 150962 aaggtaagaacaggattttctttg 150985
to top
>gb|AC103934.10| Mus musculus chromosome 6, clone RP23-287O14, complete sequence
          Length = 208817

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 106   aaggtaaaaacaggattttctttg 129
             ||||||| ||||||||||||||||
Sbjct: 73976 aaggtaagaacaggattttctttg 73953
to top
>gb|AF457781.1| Schizothorax progastus haplotype SPR332-5f2 mitochondrial control
           region, partial sequence
          Length = 583

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   tccttgtatgtgataataaa 21
           ||||||||||||||||||||
Sbjct: 180 tccttgtatgtgataataaa 199
to top
>gb|AF457780.1| Schizothorax progastus haplotype SPR332-3f2 mitochondrial control
           region, partial sequence
          Length = 585

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   tccttgtatgtgataataaa 21
           ||||||||||||||||||||
Sbjct: 180 tccttgtatgtgataataaa 199
to top
>gb|AF457779.1| Schizothorax progastus haplotype SPR332-2f2 mitochondrial control
           region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   tccttgtatgtgataataaa 21
           ||||||||||||||||||||
Sbjct: 181 tccttgtatgtgataataaa 200
to top
>gb|AF457778.1| Schizothorax progastus haplotype SPR332-1f2 mitochondrial control
           region, partial sequence
          Length = 580

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   tccttgtatgtgataataaa 21
           ||||||||||||||||||||
Sbjct: 181 tccttgtatgtgataataaa 200
to top
>gb|AF457777.1| Schizothorax richardsonii haplotype SRI330-2f2 mitochondrial
           control region, partial sequence
          Length = 586

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   tccttgtatgtgataataaa 21
           ||||||||||||||||||||
Sbjct: 181 tccttgtatgtgataataaa 200
to top
>gb|AF457776.1| Schizothorax richardsonii haplotype SRI330-1f2 mitochondrial
           control region, partial sequence
          Length = 586

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   tccttgtatgtgataataaa 21
           ||||||||||||||||||||
Sbjct: 181 tccttgtatgtgataataaa 200
to top
>gb|AF457775.1| Schizothorax richardsonii haplotype SRI324-3f2 mitochondrial
           control region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   tccttgtatgtgataataaa 21
           ||||||||||||||||||||
Sbjct: 181 tccttgtatgtgataataaa 200
to top
>gb|AF457774.1| Schizothorax richardsonii haplotype SRI324-2f2 mitochondrial
           control region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   tccttgtatgtgataataaa 21
           ||||||||||||||||||||
Sbjct: 181 tccttgtatgtgataataaa 200
to top
>gb|AF457772.1| Schizothorax macrophthalmus haplotype SMA326-9f2 mitochondrial
           control region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   tccttgtatgtgataataaa 21
           ||||||||||||||||||||
Sbjct: 181 tccttgtatgtgataataaa 200
to top
>gb|AF457771.1| Schizothorax macrophthalmus haplotype SMA326-8f2 mitochondrial
           control region, partial sequence
          Length = 586

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   tccttgtatgtgataataaa 21
           ||||||||||||||||||||
Sbjct: 181 tccttgtatgtgataataaa 200
to top
>gb|AF457770.1| Schizothorax macrophthalmus haplotype SMA326-7f2 mitochondrial
           control region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   tccttgtatgtgataataaa 21
           ||||||||||||||||||||
Sbjct: 181 tccttgtatgtgataataaa 200
to top
>gb|AF457769.1| Schizothorax macrophthalmus haplotype SMA326-5f2 mitochondrial
           control region, partial sequence
          Length = 580

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   tccttgtatgtgataataaa 21
           ||||||||||||||||||||
Sbjct: 181 tccttgtatgtgataataaa 200
to top
>gb|AF457768.1| Schizothorax nepalensis haplotype SNE327-9f2 mitochondrial control
           region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   tccttgtatgtgataataaa 21
           ||||||||||||||||||||
Sbjct: 181 tccttgtatgtgataataaa 200
to top
>gb|AF457767.1| Schizothorax nepalensis haplotype SNE327-8f2 mitochondrial control
           region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   tccttgtatgtgataataaa 21
           ||||||||||||||||||||
Sbjct: 181 tccttgtatgtgataataaa 200
to top
>gb|AF457766.1| Schizothorax nepalensis haplotype SNE327-7f2 mitochondrial control
           region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   tccttgtatgtgataataaa 21
           ||||||||||||||||||||
Sbjct: 181 tccttgtatgtgataataaa 200
to top
>gb|AF457765.1| Schizothorax nepalensis haplotype SNE327-6f2 mitochondrial control
           region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   tccttgtatgtgataataaa 21
           ||||||||||||||||||||
Sbjct: 181 tccttgtatgtgataataaa 200
to top
>gb|AF457764.1| Schizothorax nepalensis haplotype SNE327-5f2 mitochondrial control
           region, partial sequence
          Length = 586

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   tccttgtatgtgataataaa 21
           ||||||||||||||||||||
Sbjct: 181 tccttgtatgtgataataaa 200
to top
>gb|AF457763.1| Schizothorax nepalensis haplotype SNE327-4f2 mitochondrial control
           region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   tccttgtatgtgataataaa 21
           ||||||||||||||||||||
Sbjct: 181 tccttgtatgtgataataaa 200
to top
>gb|AF457762.1| Schizothorax nepalensis haplotype SNE327-3f2 mitochondrial control
           region, partial sequence
          Length = 586

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   tccttgtatgtgataataaa 21
           ||||||||||||||||||||
Sbjct: 181 tccttgtatgtgataataaa 200
to top
>gb|AF457761.1| Schizothorax nepalensis haplotype SNE327-1f2 mitochondrial control
           region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   tccttgtatgtgataataaa 21
           ||||||||||||||||||||
Sbjct: 181 tccttgtatgtgataataaa 200
to top
>gb|AF457760.1| Schizothorax raraensis haplotype SrA325-8f2 mitochondrial control
           region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   tccttgtatgtgataataaa 21
           ||||||||||||||||||||
Sbjct: 181 tccttgtatgtgataataaa 200
to top
>gb|AF457759.1| Schizothorax raraensis haplotype SRA325-7f2 mitochondrial control
           region, partial sequence
          Length = 582

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   tccttgtatgtgataataaa 21
           ||||||||||||||||||||
Sbjct: 181 tccttgtatgtgataataaa 200
to top
>gb|AF457757.1| Schizothorax raraensis haplotype SRA325-4f2 mitochondrial control
           region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   tccttgtatgtgataataaa 21
           ||||||||||||||||||||
Sbjct: 181 tccttgtatgtgataataaa 200
to top
>gb|AF457756.1| Schizothorax raraensis haplotype SRA325-3f2 mitochondrial control
           region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   tccttgtatgtgataataaa 21
           ||||||||||||||||||||
Sbjct: 181 tccttgtatgtgataataaa 200
to top
>gb|AF457754.1| Schizothorax raraensis haplotype SRA326-13f2 mitochondrial control
           region, partial sequence
          Length = 582

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   tccttgtatgtgataataaa 21
           ||||||||||||||||||||
Sbjct: 181 tccttgtatgtgataataaa 200
to top
>gb|AF457753.1| Schizothorax raraensis haplotype SRA326-12f2 mitochondrial control
           region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   tccttgtatgtgataataaa 21
           ||||||||||||||||||||
Sbjct: 181 tccttgtatgtgataataaa 200
to top
>emb|CR450787.6| Zebrafish DNA sequence from clone CH211-222O17 in linkage group 12,
              complete sequence
          Length = 212974

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 104    caaaggtaaaaacaggattttctt 127
              |||||||||||||| |||||||||
Sbjct: 113052 caaaggtaaaaacaagattttctt 113029
to top
>gb|AC002382.1| Homo sapiens BAC clone CTB-22J17 from 7, complete sequence
          Length = 125590

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 102   cacaaaggtaaaaacaggattttc 125
             ||||||| ||||||||||||||||
Sbjct: 29791 cacaaagataaaaacaggattttc 29814
to top
>gb|AC117436.6| Homo sapiens 3 BAC RP11-69K16 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 133636

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 10    tgtgataataaaaagtacaa 29
             ||||||||||||||||||||
Sbjct: 21947 tgtgataataaaaagtacaa 21928
to top
>emb|BX294138.1| Pirellula sp. strain 1 complete genome; segment 6/24
          Length = 321950

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 189   ggatgggattggccggactg 208
             ||||||||||||||||||||
Sbjct: 33882 ggatgggattggccggactg 33863
to top
>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 365     cgccgctcgggccgtggccg 384
               ||||||||||||||||||||
Sbjct: 1553163 cgccgctcgggccgtggccg 1553144
to top
>gb|CP000133.1| Rhizobium etli CFN 42, complete genome
          Length = 4381608

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 267     gaagatgccgaccatggcga 286
               ||||||||||||||||||||
Sbjct: 2428497 gaagatgccgaccatggcga 2428516
to top
>gb|AF087022.1|AF087022 Streptomyces venezuelae cytochrome P450 monooxygenase (picK) gene,
           complete cds
          Length = 1470

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 468 gcggtctgggcctgggcggg 487
           ||||||||||||||||||||
Sbjct: 690 gcggtctgggcctgggcggg 671
to top
>gb|AC161386.4| Pan troglodytes BAC clone CH251-497P4 from chromosome 7, complete
              sequence
          Length = 193048

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 102    cacaaaggtaaaaacaggattttc 125
              ||||||| ||||||||||||||||
Sbjct: 188015 cacaaagataaaaacaggattttc 187992
to top
>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 379     tggccgccatggtcgccgcccatc 402
               |||||||| |||||||||||||||
Sbjct: 3664632 tggccgccctggtcgccgcccatc 3664609
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 380      ggccgccatggtcgccgccc 399
                ||||||||||||||||||||
Sbjct: 19434506 ggccgccatggtcgccgccc 19434487
to top
>dbj|AP003449.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OSJNBa0086A10
          Length = 151071

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 380   ggccgccatggtcgccgccc 399
             ||||||||||||||||||||
Sbjct: 43322 ggccgccatggtcgccgccc 43303
to top
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 351    ctgccggaagtcgccgccgc 370
              ||||||||||||||||||||
Sbjct: 350897 ctgccggaagtcgccgccgc 350878
to top
>gb|AC128714.15| Homo sapiens 3 BAC RP11-433C9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 109972

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 92    caaaagaaggcacaaaggtaaaaa 115
             ||||| ||||||||||||||||||
Sbjct: 47544 caaaaaaaggcacaaaggtaaaaa 47521
to top
>dbj|AP005572.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OJ1506_A04
          Length = 114998

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 360   gtcgccgccgctcgggccgt 379
             ||||||||||||||||||||
Sbjct: 29091 gtcgccgccgctcgggccgt 29072
to top
>gb|AY110731.1| Zea mays CL6588_1 mRNA sequence
          Length = 874

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 174 cttgcaccaaagctgggatgggat 197
           |||||||||||| |||||||||||
Sbjct: 229 cttgcaccaaagatgggatgggat 252
to top
>emb|AL136298.5|CNS01DW2 Human chromosome 14 DNA sequence BAC R-134E15 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 181532

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 86     ttatgacaaaagaaggcacaaaggtaaa 113
              ||||| ||||||||||||| ||||||||
Sbjct: 115169 ttatggcaaaagaaggcaccaaggtaaa 115196
to top
>gb|AE015927.1| Clostridium tetani E88, complete genome
          Length = 2799251

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 154     tattccttcttgccaaagtt 173
               ||||||||||||||||||||
Sbjct: 1517245 tattccttcttgccaaagtt 1517226
to top
>gb|AF079139.1|AF079139 Streptomyces venezuelae pikCD operon, complete sequence
          Length = 4342

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 468 gcggtctgggcctgggcggg 487
           ||||||||||||||||||||
Sbjct: 690 gcggtctgggcctgggcggg 671
to top
>gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome
          Length = 5224283

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 7       gtatgtgataataaaaagta 26
               ||||||||||||||||||||
Sbjct: 5063627 gtatgtgataataaaaagta 5063646
to top
>dbj|AP003972.2| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-861E23, complete
             sequence
          Length = 181946

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 244   atggcgatggggatgcagac 263
             ||||||||||||||||||||
Sbjct: 62048 atggcgatggggatgcagac 62029


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,013,686
Number of Sequences: 3902068
Number of extensions: 4013686
Number of successful extensions: 89348
Number of sequences better than 10.0: 81
Number of HSP's better than 10.0 without gapping: 82
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 88228
Number of HSP's gapped (non-prelim): 1120
length of query: 511
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 488
effective length of database: 17,143,297,704
effective search space: 8365929279552
effective search space used: 8365929279552
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top