| Clone Name | rbaal29d02 |
|---|---|
| Clone Library Name | barley_pub |
| No. | Definition | Score (bits) |
E Value |
1 | ref|XM_453649.1| Kluyveromyces lactis NRRL Y-1140, KLLA0D13156g ... | 38 | 5.7 | 2 | gb|AC012085.4| Homo sapiens 12 BAC RP11-887P2 (Roswell Park Canc... | 38 | 5.7 | 3 | emb|CR382124.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... | 38 | 5.7 | 4 | gb|AC108748.7| Homo sapiens 3 BAC RP11-280H21 (Roswell Park Canc... | 38 | 5.7 |
|---|
>ref|XM_453649.1| Kluyveromyces lactis NRRL Y-1140, KLLA0D13156g predicted mRNA Length = 3288 Score = 38.2 bits (19), Expect = 5.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 atgatgttccttcataagc 36 ||||||||||||||||||| Sbjct: 792 atgatgttccttcataagc 774
>gb|AC012085.4| Homo sapiens 12 BAC RP11-887P2 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 170269 Score = 38.2 bits (19), Expect = 5.7 Identities = 21/22 (95%) Strand = Plus / Minus Query: 99 actnaatttatttctcaaaagg 120 ||| |||||||||||||||||| Sbjct: 35724 actcaatttatttctcaaaagg 35703
>emb|CR382124.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome D of strain NRRL Y-1140 of Kluyveromyces lactis Length = 1715506 Score = 38.2 bits (19), Expect = 5.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 atgatgttccttcataagc 36 ||||||||||||||||||| Sbjct: 1127398 atgatgttccttcataagc 1127416
>gb|AC108748.7| Homo sapiens 3 BAC RP11-280H21 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 60995 Score = 38.2 bits (19), Expect = 5.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 105 tttatttctcaaaaggcag 123 ||||||||||||||||||| Sbjct: 30983 tttatttctcaaaaggcag 30965 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 609,869 Number of Sequences: 3902068 Number of extensions: 609869 Number of successful extensions: 43757 Number of sequences better than 10.0: 4 Number of HSP's better than 10.0 without gapping: 4 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 43749 Number of HSP's gapped (non-prelim): 8 length of query: 123 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 102 effective length of database: 17,151,101,840 effective search space: 1749412387680 effective search space used: 1749412387680 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)