ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal27h06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_472439.1| Oryza sativa (japonica cultivar-group), predic... 56 3e-05
2dbj|AK067483.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 3e-05
3emb|AL606598.3|OSJN00036 Oryza sativa genomic DNA, chromosome 4,... 54 1e-04
4dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 54 1e-04
5gb|CP000235.1| Anaplasma phagocytophilum HZ, complete genome 44 0.097
6gb|AY812367.1| Schistosoma japonicum SJCHGC03855 protein mRNA, p... 42 0.38
7gb|U56103.1|CWU56103 Cuphea wrightii acyl-ACP thioesterase (FatB... 42 0.38
8ref|XM_716617.1| Candida albicans SC5314 hypothetical protein (C... 40 1.5
9ref|XM_716497.1| Candida albicans SC5314 hypothetical protein (C... 40 1.5
10emb|AL035537.1|SPBC21 S.pombe chromosome II cosmid c21 40 1.5
11ref|NM_001022260.1| Schizosaccharomyces pombe 972h- hypothetical... 40 1.5
12gb|M30827.1|YSPRAL2 S.pombe ral2 protein gene, complete cds 40 1.5
13emb|AL137024.27| Human DNA sequence from clone RP11-45A16 on chr... 38 6.0
14gb|AF307337.1|AF307337 Homo sapiens ALPP, ALPPL2, ALPI, XCE, CHR... 38 6.0
15gb|AC092165.4| Homo sapiens BAC clone RP11-753F4 from 2, complet... 38 6.0

>ref|XM_472439.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2277

 Score = 56.0 bits (28), Expect = 3e-05
 Identities = 59/68 (86%), Gaps = 1/68 (1%)
 Strand = Plus / Minus

                                                                        
Query: 58   gatataagatatctgccatctgatgttagtgatggtgttgaaagagcctttcgacttcca 117
            ||||| |||||||| |||||||||||||  |||||||  ||||||||| ||| | |||||
Sbjct: 1601 gatatgagatatcttccatctgatgttaaagatggtgaagaaagagcc-ttcaaattcca 1543

                    
Query: 118  aggccctt 125
            ||||||||
Sbjct: 1542 aggccctt 1535



to top

>dbj|AK067483.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013108P06, full
            insert sequence
          Length = 2652

 Score = 56.0 bits (28), Expect = 3e-05
 Identities = 59/68 (86%), Gaps = 1/68 (1%)
 Strand = Plus / Minus

                                                                        
Query: 58   gatataagatatctgccatctgatgttagtgatggtgttgaaagagcctttcgacttcca 117
            ||||| |||||||| |||||||||||||  |||||||  ||||||||| ||| | |||||
Sbjct: 1942 gatatgagatatcttccatctgatgttaaagatggtgaagaaagagcc-ttcaaattcca 1884

                    
Query: 118  aggccctt 125
            ||||||||
Sbjct: 1883 aggccctt 1876



to top

>emb|AL606598.3|OSJN00036 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0033G16,
             complete sequence
          Length = 114051

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 58/67 (86%), Gaps = 1/67 (1%)
 Strand = Plus / Plus

                                                                         
Query: 58    gatataagatatctgccatctgatgttagtgatggtgttgaaagagcctttcgacttcca 117
             ||||| |||||||| |||||||||||||  |||||||  ||||||||| ||| | |||||
Sbjct: 84479 gatatgagatatcttccatctgatgttaaagatggtgaagaaagagcc-ttcaaattcca 84537

                    
Query: 118   aggccct 124
             |||||||
Sbjct: 84538 aggccct 84544



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 58/67 (86%), Gaps = 1/67 (1%)
 Strand = Plus / Plus

                                                                            
Query: 58       gatataagatatctgccatctgatgttagtgatggtgttgaaagagcctttcgacttcca 117
                ||||| |||||||| |||||||||||||  |||||||  ||||||||| ||| | |||||
Sbjct: 20650045 gatatgagatatcttccatctgatgttaaagatggtgaagaaagagcc-ttcaaattcca 20650103

                       
Query: 118      aggccct 124
                |||||||
Sbjct: 20650104 aggccct 20650110



to top

>gb|CP000235.1| Anaplasma phagocytophilum HZ, complete genome
          Length = 1471282

 Score = 44.1 bits (22), Expect = 0.097
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 93     tgttgaaagagcctttcgactt 114
              ||||||||||||||||||||||
Sbjct: 728744 tgttgaaagagcctttcgactt 728765



to top

>gb|AY812367.1| Schistosoma japonicum SJCHGC03855 protein mRNA, partial cds
          Length = 843

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 58  gatataagatatctgccatct 78
           |||||||||||||||||||||
Sbjct: 396 gatataagatatctgccatct 376



to top

>gb|U56103.1|CWU56103 Cuphea wrightii acyl-ACP thioesterase (FatB1) mRNA, complete cds
          Length = 1296

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 12  gattgtcaaaatttccatatg 32
           |||||||||||||||||||||
Sbjct: 744 gattgtcaaaatttccatatg 764



to top

>ref|XM_716617.1| Candida albicans SC5314 hypothetical protein (CaO19_1633), mRNA
          Length = 2232

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 82  gttagtgatggtgttgaaagagcc 105
           ||||||| ||||||||||||||||
Sbjct: 949 gttagtggtggtgttgaaagagcc 972



to top

>ref|XM_716497.1| Candida albicans SC5314 hypothetical protein (CaO19_9201), mRNA
          Length = 2232

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 82  gttagtgatggtgttgaaagagcc 105
           ||||||| ||||||||||||||||
Sbjct: 949 gttagtggtggtgttgaaagagcc 972



to top

>emb|AL035537.1|SPBC21 S.pombe chromosome II cosmid c21
          Length = 15041

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 12   gattgtcaaaatttccatat 31
            ||||||||||||||||||||
Sbjct: 6572 gattgtcaaaatttccatat 6591



to top

>ref|NM_001022260.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPBC21.05c),
            partial mRNA
          Length = 1836

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 12   gattgtcaaaatttccatat 31
            ||||||||||||||||||||
Sbjct: 1326 gattgtcaaaatttccatat 1307



to top

>gb|M30827.1|YSPRAL2 S.pombe ral2 protein gene, complete cds
          Length = 2897

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 12   gattgtcaaaatttccatat 31
            ||||||||||||||||||||
Sbjct: 2022 gattgtcaaaatttccatat 2003



to top

>emb|AL137024.27| Human DNA sequence from clone RP11-45A16 on chromosome 9q32-33.3
             Contains the 3' end of the PAPPA gene for
             pregnancy-associated plasma protein A, a novel gene and
             the 3'end of the ASTN2 gene for astrotactin 2, complete
             sequence
          Length = 159430

 Score = 38.2 bits (19), Expect = 6.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 78    tgatgttagtgatggtgtt 96
             |||||||||||||||||||
Sbjct: 96826 tgatgttagtgatggtgtt 96844



to top

>gb|AF307337.1|AF307337 Homo sapiens ALPP, ALPPL2, ALPI, XCE, CHRND, and CHRNG genes, complete
              sequence
          Length = 210301

 Score = 38.2 bits (19), Expect = 6.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 104    cctttcgacttccaaggcc 122
              |||||||||||||||||||
Sbjct: 173443 cctttcgacttccaaggcc 173425



to top

>gb|AC092165.4| Homo sapiens BAC clone RP11-753F4 from 2, complete sequence
          Length = 100020

 Score = 38.2 bits (19), Expect = 6.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 104   cctttcgacttccaaggcc 122
             |||||||||||||||||||
Sbjct: 41583 cctttcgacttccaaggcc 41565


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 930,608
Number of Sequences: 3902068
Number of extensions: 930608
Number of successful extensions: 60261
Number of sequences better than 10.0: 16
Number of HSP's better than 10.0 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 60204
Number of HSP's gapped (non-prelim): 55
length of query: 128
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 107
effective length of database: 17,151,101,840
effective search space: 1835167896880
effective search space used: 1835167896880
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top