| Clone Name | rbaal26e11 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AK107814.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-133-F06, full insert sequence Length = 527 Score = 167 bits (84), Expect = 3e-38 Identities = 111/120 (92%) Strand = Plus / Minus Query: 201 attgcgccttcctggcttctgctgggggcttccaaagaccaagacggtacttgtgagcaa 260 ||||||| ||| | ||||||||| |||||||||||||||||||||| ||||||||||||| Sbjct: 345 attgcgctttcttcgcttctgcttggggcttccaaagaccaagacgatacttgtgagcaa 286 Query: 261 agctcaaaatcaactttctatgcttgcaggggacgccgagcttcttgagccgcagcgtgc 320 | |||||||| ||||| |||||||||||||||| |||||||||||||||||||||||||| Sbjct: 285 aactcaaaattaacttcctatgcttgcaggggatgccgagcttcttgagccgcagcgtgc 226
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 95.6 bits (48), Expect = 8e-17 Identities = 69/76 (90%) Strand = Plus / Minus Query: 201 attgcgccttcctggcttctgctgggggcttccaaagaccaagacggtacttgtgagcaa 260 ||||||| ||| | ||||||||| |||||||||||||||||||||| ||||||||||||| Sbjct: 10977672 attgcgctttcttcgcttctgcttggggcttccaaagaccaagacgatacttgtgagcaa 10977613 Query: 261 agctcaaaatcaactt 276 | |||||||| ||||| Sbjct: 10977612 aactcaaaattaactt 10977597 Score = 73.8 bits (37), Expect = 3e-10 Identities = 40/41 (97%) Strand = Plus / Minus Query: 280 atgcttgcaggggacgccgagcttcttgagccgcagcgtgc 320 |||||||||||||| |||||||||||||||||||||||||| Sbjct: 10975621 atgcttgcaggggatgccgagcttcttgagccgcagcgtgc 10975581
>dbj|AP003578.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0682B08 Length = 138376 Score = 95.6 bits (48), Expect = 8e-17 Identities = 69/76 (90%) Strand = Plus / Minus Query: 201 attgcgccttcctggcttctgctgggggcttccaaagaccaagacggtacttgtgagcaa 260 ||||||| ||| | ||||||||| |||||||||||||||||||||| ||||||||||||| Sbjct: 6554 attgcgctttcttcgcttctgcttggggcttccaaagaccaagacgatacttgtgagcaa 6495 Query: 261 agctcaaaatcaactt 276 | |||||||| ||||| Sbjct: 6494 aactcaaaattaactt 6479 Score = 73.8 bits (37), Expect = 3e-10 Identities = 40/41 (97%) Strand = Plus / Minus Query: 280 atgcttgcaggggacgccgagcttcttgagccgcagcgtgc 320 |||||||||||||| |||||||||||||||||||||||||| Sbjct: 4503 atgcttgcaggggatgccgagcttcttgagccgcagcgtgc 4463
>dbj|AP002883.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0487H02 Length = 145491 Score = 95.6 bits (48), Expect = 8e-17 Identities = 69/76 (90%) Strand = Plus / Minus Query: 201 attgcgccttcctggcttctgctgggggcttccaaagaccaagacggtacttgtgagcaa 260 ||||||| ||| | ||||||||| |||||||||||||||||||||| ||||||||||||| Sbjct: 80514 attgcgctttcttcgcttctgcttggggcttccaaagaccaagacgatacttgtgagcaa 80455 Query: 261 agctcaaaatcaactt 276 | |||||||| ||||| Sbjct: 80454 aactcaaaattaactt 80439 Score = 73.8 bits (37), Expect = 3e-10 Identities = 40/41 (97%) Strand = Plus / Minus Query: 280 atgcttgcaggggacgccgagcttcttgagccgcagcgtgc 320 |||||||||||||| |||||||||||||||||||||||||| Sbjct: 78463 atgcttgcaggggatgccgagcttcttgagccgcagcgtgc 78423
>gb|BT018173.1| Zea mays clone EL01N0557C03.c mRNA sequence Length = 1486 Score = 85.7 bits (43), Expect = 8e-14 Identities = 64/71 (90%) Strand = Plus / Minus Query: 209 ttcctggcttctgctgggggcttccaaagaccaagacggtacttgtgagcaaagctcaaa 268 ||||||| ||||||| ||||||||| |||||||||||||||||||| ||||| |||||| Sbjct: 1104 ttcctgggttctgctttgggcttccagagaccaagacggtacttgtgtgcaaaactcaaa 1045 Query: 269 atcaactttct 279 ||||| ||||| Sbjct: 1044 atcaattttct 1034
>gb|AC084884.2| Oryza sativa chromosome 10 clone OSJNBa0031A07, complete sequence Length = 134553 Score = 75.8 bits (38), Expect = 8e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 217 ttctgctgggggcttccaaagaccaagacggtacttgtgagcaaagctcaaaat 270 ||||||| |||||||||||||||||||||| ||||||||||| || |||||||| Sbjct: 65165 ttctgcttggggcttccaaagaccaagacgatacttgtgagcgaaactcaaaat 65112 Score = 63.9 bits (32), Expect = 3e-07 Identities = 38/40 (95%) Strand = Plus / Minus Query: 281 tgcttgcaggggacgccgagcttcttgagccgcagcgtgc 320 ||||||||||||| ||||||||||||||||||||| |||| Sbjct: 63202 tgcttgcaggggatgccgagcttcttgagccgcagagtgc 63163
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 75.8 bits (38), Expect = 8e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 217 ttctgctgggggcttccaaagaccaagacggtacttgtgagcaaagctcaaaat 270 ||||||| |||||||||||||||||||||| ||||||||||| || |||||||| Sbjct: 2976743 ttctgcttggggcttccaaagaccaagacgatacttgtgagcgaaactcaaaat 2976690 Score = 63.9 bits (32), Expect = 3e-07 Identities = 38/40 (95%) Strand = Plus / Minus Query: 281 tgcttgcaggggacgccgagcttcttgagccgcagcgtgc 320 ||||||||||||| ||||||||||||||||||||| |||| Sbjct: 2974780 tgcttgcaggggatgccgagcttcttgagccgcagagtgc 2974741
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 75.8 bits (38), Expect = 8e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 217 ttctgctgggggcttccaaagaccaagacggtacttgtgagcaaagctcaaaat 270 ||||||| |||||||||||||||||||||| ||||||||||| || |||||||| Sbjct: 2976664 ttctgcttggggcttccaaagaccaagacgatacttgtgagcgaaactcaaaat 2976611 Score = 63.9 bits (32), Expect = 3e-07 Identities = 38/40 (95%) Strand = Plus / Minus Query: 281 tgcttgcaggggacgccgagcttcttgagccgcagcgtgc 320 ||||||||||||| ||||||||||||||||||||| |||| Sbjct: 2974701 tgcttgcaggggatgccgagcttcttgagccgcagagtgc 2974662
>ref|NM_189184.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 258 Score = 73.8 bits (37), Expect = 3e-10 Identities = 40/41 (97%) Strand = Plus / Minus Query: 280 atgcttgcaggggacgccgagcttcttgagccgcagcgtgc 320 |||||||||||||| |||||||||||||||||||||||||| Sbjct: 234 atgcttgcaggggatgccgagcttcttgagccgcagcgtgc 194
>ref|NM_194862.1| Oryza sativa (japonica cultivar-group) unknown protein (OSJNBa0031A07.10), mRNA Length = 345 Score = 63.9 bits (32), Expect = 3e-07 Identities = 38/40 (95%) Strand = Plus / Minus Query: 281 tgcttgcaggggacgccgagcttcttgagccgcagcgtgc 320 ||||||||||||| ||||||||||||||||||||| |||| Sbjct: 335 tgcttgcaggggatgccgagcttcttgagccgcagagtgc 296
>emb|AL109838.11|HSDJ796I8 Human DNA sequence from clone RP4-796I8 on chromosome 20 Contains a putative novel gene, ESTs, STSs and GSSs, complete sequence Length = 121235 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 4 gatgaaggtttctgcccaacc 24 ||||||||||||||||||||| Sbjct: 34061 gatgaaggtttctgcccaacc 34041
>gb|AC025578.26| Homo sapiens 12 BAC RP11-340M11 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 115528 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 29 aaagagaaatcctgagtagca 49 ||||||||||||||||||||| Sbjct: 6273 aaagagaaatcctgagtagca 6253
>gb|AC132350.4| Mus musculus BAC clone RP24-95A6 from chromosome 6, complete sequence Length = 177167 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 182 caaaaacaaaccaactttta 201 |||||||||||||||||||| Sbjct: 58183 caaaaacaaaccaactttta 58164
>gb|AC164075.4| Mus musculus chromosome 7, clone RP24-259P13, complete sequence Length = 159578 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 208 cttcctggcttctgctgggg 227 |||||||||||||||||||| Sbjct: 33665 cttcctggcttctgctgggg 33646
>gb|AC159247.2| Mus musculus BAC clone RP24-249C9 from chromosome 6, complete sequence Length = 190474 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 182 caaaaacaaaccaactttta 201 |||||||||||||||||||| Sbjct: 5407 caaaaacaaaccaactttta 5388
>gb|AC102334.10| Mus musculus chromosome 15, clone RP24-544N15, complete sequence Length = 162721 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 24 ctaacaaagagaaatcctga 43 |||||||||||||||||||| Sbjct: 882 ctaacaaagagaaatcctga 901
>gb|AF235103.5| Homo sapiens chromosome 8 multiple clones map q24.3, complete sequence Length = 345524 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 207 ccttcctggcttctgctggg 226 |||||||||||||||||||| Sbjct: 113106 ccttcctggcttctgctggg 113087
>gb|AC110903.25| Mus musculus chromosome 7, clone RP24-174G2, complete sequence Length = 181076 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 208 cttcctggcttctgctgggg 227 |||||||||||||||||||| Sbjct: 135589 cttcctggcttctgctgggg 135570
>gb|J00277.1|HUMRASH Homo sapiens c-Ha-ras1 p21 protein gene, complete cds Length = 6453 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 210 tcctggcttctgctgggggc 229 |||||||||||||||||||| Sbjct: 4575 tcctggcttctgctgggggc 4594
>gb|AC127421.3| Mus musculus BAC clone RP24-314F1 from chromosome 18, complete sequence Length = 170221 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 207 ccttcctggcttctgctggg 226 |||||||||||||||||||| Sbjct: 120073 ccttcctggcttctgctggg 120054
>gb|AC116998.3| Mus musculus BAC clone RP23-16F6 from 18, complete sequence Length = 216959 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 207 ccttcctggcttctgctggg 226 |||||||||||||||||||| Sbjct: 111451 ccttcctggcttctgctggg 111432
>emb|AL596264.13| Mouse DNA sequence from clone RP23-232G8 on chromosome 11 Contains a novel gene, complete sequence Length = 175724 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 209 ttcctggcttctgctggggg 228 |||||||||||||||||||| Sbjct: 57512 ttcctggcttctgctggggg 57493
>emb|BX571714.7| Zebrafish DNA sequence from clone DKEY-16L2 in linkage group 3, complete sequence Length = 240105 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 165 tccccaagtcgacacttcaa 184 |||||||||||||||||||| Sbjct: 134260 tccccaagtcgacacttcaa 134279
>dbj|AB072334.1| Mus musculus rasH2 transgenic DNA, integrated synthetic human c-Ha-ras transgene Length = 21705 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 210 tcctggcttctgctgggggc 229 |||||||||||||||||||| Sbjct: 19775 tcctggcttctgctgggggc 19794 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 210 tcctggcttctgctgggggc 229 |||||||||||||||||||| Sbjct: 12789 tcctggcttctgctgggggc 12808 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 210 tcctggcttctgctgggggc 229 |||||||||||||||||||| Sbjct: 5803 tcctggcttctgctgggggc 5822
>dbj|AK128830.1| Homo sapiens cDNA FLJ46317 fis, clone TESTI4041832 Length = 3597 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 210 tcctggcttctgctgggggc 229 |||||||||||||||||||| Sbjct: 2747 tcctggcttctgctgggggc 2728
>dbj|AK127225.1| Homo sapiens cDNA FLJ45292 fis, clone BRHIP3002931 Length = 4949 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 207 ccttcctggcttctgctggg 226 |||||||||||||||||||| Sbjct: 3057 ccttcctggcttctgctggg 3076
>gb|AC090987.5| Homo sapiens chromosome 8, clone RP11-269I24, complete sequence Length = 153805 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 206 gccttcctggcttctgctgg 225 |||||||||||||||||||| Sbjct: 69367 gccttcctggcttctgctgg 69386
>gb|AC137894.5| Homo sapiens chromosome 11, clone RP13-46H24, complete sequence Length = 165000 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 210 tcctggcttctgctgggggc 229 |||||||||||||||||||| Sbjct: 153099 tcctggcttctgctgggggc 153080
>gb|AC138374.2| Homo sapiens chromosome 11, clone CTD-2647G13, complete sequence Length = 196424 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 210 tcctggcttctgctgggggc 229 |||||||||||||||||||| Sbjct: 47342 tcctggcttctgctgggggc 47323
>gb|AC102198.9| Mus musculus chromosome 15, clone RP24-499H13, complete sequence Length = 139134 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 24 ctaacaaagagaaatcctga 43 |||||||||||||||||||| Sbjct: 124765 ctaacaaagagaaatcctga 124784
>emb|AL928885.9| Zebrafish DNA sequence from clone CH211-195G24 in linkage group 3, complete sequence Length = 196857 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 165 tccccaagtcgacacttcaa 184 |||||||||||||||||||| Sbjct: 14264 tccccaagtcgacacttcaa 14283
>gb|AC148020.3| Mus musculus BAC clone RP23-6A22 from 18, complete sequence Length = 238892 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 207 ccttcctggcttctgctggg 226 |||||||||||||||||||| Sbjct: 237489 ccttcctggcttctgctggg 237508
>emb|AJ535307.1|PTR535307 Pan troglodytes H-ras minisatellite upstream flanking sequence Length = 850 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 210 tcctggcttctgctgggggc 229 |||||||||||||||||||| Sbjct: 733 tcctggcttctgctgggggc 752 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,583,234 Number of Sequences: 3902068 Number of extensions: 3583234 Number of successful extensions: 65648 Number of sequences better than 10.0: 33 Number of HSP's better than 10.0 without gapping: 33 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 65549 Number of HSP's gapped (non-prelim): 99 length of query: 321 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 299 effective length of database: 17,147,199,772 effective search space: 5127012731828 effective search space used: 5127012731828 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)