ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal26c23
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AJ623275.1| Hordeum vulgare mRNA for soluble acid invertase ... 579 e-162
2emb|AJ635225.1| Triticum aestivum mRNA for acid beta-fructofuran... 274 2e-70
3gb|DQ267825.1| Dendrocalamopsis oldhamii vacuolar invertase BObe... 198 1e-47
4emb|AJ532549.1|LTE532549 Lolium temulentum mRNA for putative sol... 165 2e-37
5gb|AY082350.1| Lolium perenne fructosyltransferase (FT2) mRNA, c... 143 6e-31
6dbj|AB186920.1| Lolium perenne mRNA for putative fructosyltransf... 115 1e-22
7gb|AF494041.1| Lolium perenne fructan 6-fructosyltransferase mRN... 107 3e-20
8gb|AF069309.1| Triticum aestivum vacuolar invertase (WIVRV) mRNA... 105 1e-19
9gb|AY575717.1| Triticum monococcum vacuolar invertase1 (vin1) mR... 88 3e-14
10emb|AJ532550.1|LTE532550 Lolium temulentum mRNA for putative fru... 84 5e-13
11gb|AY245431.1| Lolium perenne sucrose:sucrose 1-fructosyltransfe... 78 3e-11
12gb|DQ073970.1| Lolium perenne fructosyltransferase-like protein ... 76 1e-10
13gb|AF083856.1|AF083856 Saccharum hybrid cultivar H65-7052 solubl... 74 4e-10
14gb|AY023475.1| Oryza sativa microsatellite MRG5800 containing (T... 70 7e-09
15gb|AY575557.1| Oryza sativa (indica cultivar-group) cultivar IR6... 70 7e-09
16emb|AJ563384.1|ZMA563384 Zea mays partial ivr2 gene for vacuolar... 70 7e-09
17dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 70 7e-09
18gb|AF276704.1|AF276704 Oryza sativa vacuolar acid invertase (INV... 70 7e-09
19dbj|AP004851.3| Oryza sativa (japonica cultivar-group) genomic D... 70 7e-09
20dbj|AK072245.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 7e-09
21gb|AY107166.1| Zea mays PCO109921 mRNA sequence 70 7e-09
22gb|U31451.1|ZMU31451 Zea mays invertase mRNA, partial cds 70 7e-09
23gb|AY302083.1| Saccharum hybrid cultivar soluble acid invertase ... 66 1e-07
24gb|AF062735.1|AF062735 Saccharum officinarum soluble acid invert... 66 1e-07
25gb|AF492836.1| Lolium perenne putative sucrose:sucrose 1-fructos... 64 4e-07
26dbj|AB125218.1| Lolium perenne mRNA for putative fructosyltransf... 64 4e-07
27gb|AF062734.1|AF062734 Saccharum robustum soluble acid invertase... 58 3e-05
28gb|AF481763.1| Lolium perenne fructosyltransferase (FT1) mRNA, c... 56 1e-04
29dbj|AB088409.1| Triticum aestivum 1-FFT-A mRNA for fructan:fruct... 56 1e-04
30dbj|AB159786.1| Triticum aestivum 1-SST gene for sucrose:sucrose... 54 4e-04
31dbj|AB029888.1| Triticum aestivum 1-SST mRNA for sucrose:sucrose... 54 4e-04
32dbj|AB088410.1| Triticum aestivum 1-FFT-B mRNA for fructan:fruct... 50 0.006
33gb|AF192394.1|AF192394 Poa secunda sucrose:fructan 6-fructosyltr... 48 0.025
34emb|AJ297369.1|FAR297369 Festuca arundinacea mRNA for sucrose:su... 48 0.025
35emb|AL445238.12| Human DNA sequence from clone RP11-394A14 on ch... 46 0.099
36emb|AJ567377.2|HVU567377 Hordeum vulgare partial mRNA for sucros... 44 0.39
37emb|BX842566.4| Mouse DNA sequence from clone RP23-174M7 on chro... 44 0.39
38emb|AL929107.14| Mouse DNA sequence from clone RP23-6C6 on chrom... 44 0.39
39gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome 42 1.5
40emb|AL136982.11| Human DNA sequence from clone RP11-96C23 on chr... 42 1.5
41gb|AC025268.8| Homo sapiens chromosome 10 clone RP11-411A19, com... 42 1.5
42ref|XM_937229.1| PREDICTED: Homo sapiens KIAA1975 protein simila... 42 1.5
43ref|XM_943227.1| PREDICTED: Homo sapiens KIAA1975 protein simila... 42 1.5
44ref|XM_370567.4| PREDICTED: Homo sapiens KIAA1975 protein simila... 42 1.5
45ref|XM_931482.1| PREDICTED: Homo sapiens KIAA1975 protein simila... 42 1.5
46emb|AJ532551.1|LTE532551 Lolium temulentum partial mRNA for puta... 42 1.5
47emb|Y11124.1|CIPINVERT C.intybus mRNA for putative invertase 42 1.5
48emb|AJ006067.1|ACE6067 Allium cepa mRNA for invertase 42 1.5
49dbj|AB075855.1| Homo sapiens mRNA for KIAA1975 protein 42 1.5
50ref|XM_526649.1| PREDICTED: Pan troglodytes similar to cytochrom... 40 6.1
51gb|AY343323.1| Homo sapiens cytochrome P450 mRNA, complete cds 40 6.1
52ref|NM_183075.2| Homo sapiens cytochrome P450, family 2, subfami... 40 6.1
53ref|XM_610191.2| PREDICTED: Bos taurus similar to HECT, C2 and W... 40 6.1
54ref|NM_001040293.1| Danio rerio zgc:136455 (zgc:136455), mRNA 40 6.1
55gb|BC046671.1| Xenopus laevis similar to spleen focus forming vi... 40 6.1
56gb|BC115141.1| Danio rerio cDNA clone MGC:136455 IMAGE:7433898, ... 40 6.1
57emb|AL136089.15| Human DNA sequence from clone RP1-278E11 on chr... 40 6.1
58emb|AL161573.2|ATCHRIV69 Arabidopsis thaliana DNA chromosome 4, ... 40 6.1
59emb|AL078469.2|ATF25O24 Arabidopsis thaliana DNA chromosome 4, B... 40 6.1
60emb|AL035353.1|ATF16A16 Arabidopsis thaliana DNA chromosome 4, B... 40 6.1
61gb|U40819.1|RNU40819 Rattus norvegicus 5'-AMP-activated protein ... 40 6.1
62gb|AF222932.1| Psathyrostachys fragilis sucrose:fructan 6-fructo... 40 6.1
63gb|AC096564.3| Homo sapiens BAC clone RP11-286E11 from 4, comple... 40 6.1
64ref|XM_687067.1| PREDICTED: Danio rerio similar to GFHL3075 (LOC... 40 6.1
65emb|BX571694.10| Zebrafish DNA sequence from clone CH211-159E21 ... 40 6.1
66dbj|AB168699.1| Macaca fascicularis testis cDNA clone: QtsA-1423... 40 6.1
67ref|NM_019142.1| Rattus norvegicus protein kinase, AMP-activated... 40 6.1
68ref|NM_001003852.1| Danio rerio Iglon2 (LOC445375), mRNA 40 6.1
69gb|BC095250.1| Danio rerio Iglon2, mRNA (cDNA clone IMAGE:722248... 40 6.1
70gb|AC104081.2| Homo sapiens BAC clone RP11-559A1 from 2, complet... 40 6.1
71gb|AC018659.35| Homo sapiens 12 BAC RP11-528M18 (Roswell Park Ca... 40 6.1
72gb|AC161384.4| Gallus gallus BAC clone CH261-69B2 from chromosom... 40 6.1
73gb|AC167334.3| Gallus gallus BAC clone CH261-18C17 from chromoso... 40 6.1
74gb|AE015924.1| Porphyromonas gingivalis W83, complete genome 40 6.1
75gb|AF002656.1|AF002656 Asparagus officinalis acid invertase mRNA... 40 6.1
76gb|AF241638.1| Danio rerio neurotrimin mRNA, complete cds 40 6.1

>emb|AJ623275.1| Hordeum vulgare mRNA for soluble acid invertase (sai gene)
          Length = 2038

 Score =  579 bits (292), Expect = e-162
 Identities = 334/347 (96%), Gaps = 2/347 (0%)
 Strand = Plus / Minus

                                                                        
Query: 107  aggcttggttg--taggaagaatccatctcgtggaccacgagtctagtggtggtgacccg 164
            |||||||||||  |||||||||||||| |||||||||||||||||||||||||||||| |
Sbjct: 2032 aggcttggttggttaggaagaatccatttcgtggaccacgagtctagtggtggtgacctg 1973

                                                                        
Query: 165  aattccagtggcattgttgaagaggtacaccccagcgttggcgtagatggcctccgtcgg 224
            |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1972 aattcccgtggcattgttgaagaggtacaccccagcgttggcgtagatggcctccgtcgg 1913

                                                                        
Query: 225  gtacactcgtgatgttgcggtcaacctaccacccatcgcaaagctctcaacgatcgaatg 284
            |||||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||
Sbjct: 1912 gtacactcgtgatgttgccgtcaacctcccacccatcgcaaagctttcaacgatcgaatg 1853

                                                                        
Query: 285  atccaccagcaccctcactgacagctcttcggcatcaagcaccggcacggtattgcctac 344
            |||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 1852 atccactagcaccctcactgacagctcttcgccatcaagcaccggcacggtattgcctac 1793

                                                                        
Query: 345  aaccctcttgacaatgtcgttggcatgagatgagcgcgtctcatcatggcagaagtgtgt 404
            ||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||
Sbjct: 1792 aaccctcttgacaatgtcgttggcatgagatgagcgcatctcatcgtggcagaagtgtgt 1733

                                                           
Query: 405  atgcaagccaccgtcaaggcccctggcgacatagaagtagacggcgg 451
            ||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1732 atgcaagccaccgtcgaggcccctggcgacatagaagtagacggcgg 1686



to top

>emb|AJ635225.1| Triticum aestivum mRNA for acid beta-fructofuranosidase precursor
            (inv1 gene)
          Length = 2250

 Score =  274 bits (138), Expect = 2e-70
 Identities = 308/364 (84%), Gaps = 3/364 (0%)
 Strand = Plus / Minus

                                                                        
Query: 83   cattttgtttttacagt---gccatgtaggcttggttgtaggaagaatccatctcgtgga 139
            |||||| ||||||||||   | ||||||||| || |||||||| || |||||||||||||
Sbjct: 2073 cattttctttttacagtgaggtcatgtaggcctgattgtaggaggagtccatctcgtgga 2014

                                                                        
Query: 140  ccacgagtctagtggtggtgacccgaattccagtggcattgttgaagaggtacaccccag 199
            | ||||| || |||  | |||||||    |  ||||| |||||||||||||| |||||||
Sbjct: 2013 cgacgagcctcgtgacgttgacccgggcgctggtggcgttgttgaagaggtagaccccag 1954

                                                                        
Query: 200  cgttggcgtagatggcctccgtcgggtacactcgtgatgttgcggtcaacctaccaccca 259
            ||||||| |||||||||||||| |||||||| ||||| || || |||||||| || ||||
Sbjct: 1953 cgttggcatagatggcctccgttgggtacacccgtgacgtcgccgtcaacctcccgccca 1894

                                                                        
Query: 260  tcgcaaagctctcaacgatcgaatgatccaccagcaccctcactgacagctcttcggcat 319
            | |||||||||||||| || ||||| ||||| |||||||||||||| | ||| ||| |||
Sbjct: 1893 ttgcaaagctctcaacaatggaatggtccactagcaccctcactgaaaactcctcgccat 1834

                                                                        
Query: 320  caagcaccggcacggtattgcctacaaccctcttgacaatgtcgttggcatgagatgagc 379
            | ||||| || ||  |||||||||| ||| |||||||||| |||||||||||||||||||
Sbjct: 1833 cgagcacggggacaatattgcctacgaccttcttgacaatatcgttggcatgagatgagc 1774

                                                                        
Query: 380  gcgtctcatcatggcagaagtgtgtatgcaagccaccgtcaaggcccctggcgacataga 439
            ||||||| || ||||| ||||||||  ||||||||||||| ||||| |||||||| ||||
Sbjct: 1773 gcgtctcgtcgtggcaaaagtgtgtgcgcaagccaccgtcgaggcctctggcgacgtaga 1714

                
Query: 440  agta 443
            ||||
Sbjct: 1713 agta 1710



to top

>gb|DQ267825.1| Dendrocalamopsis oldhamii vacuolar invertase BObetaFRUCT3 mRNA,
            complete cds
          Length = 2155

 Score =  198 bits (100), Expect = 1e-47
 Identities = 289/352 (82%)
 Strand = Plus / Minus

                                                                        
Query: 100  gccatgtaggcttggttgtaggaagaatccatctcgtggaccacgagtctagtggtggtg 159
            ||||||||||||||||||||||| || |||||||||||||| ||||| ||  ||| ||||
Sbjct: 1973 gccatgtaggcttggttgtaggaggagtccatctcgtggacgacgaggctcttggcggtg 1914

                                                                        
Query: 160  acccgaattccagtggcattgttgaagaggtacaccccagcgttggcgtagatggcctcc 219
            || ||       |||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 1913 acgcgggcgttggtggcattgttgaagaggtacacccctgcgttggcgtagatggcctcc 1854

                                                                        
Query: 220  gtcgggtacactcgtgatgttgcggtcaacctaccacccatcgcaaagctctcaacgatc 279
            || |||||||| || || || || ||| |||| || |||  ||| |||||||| ||||| 
Sbjct: 1853 gttgggtacacgcgcgacgtcgccgtcgacctcccgccctgcgcgaagctctcgacgatg 1794

                                                                        
Query: 280  gaatgatccaccagcaccctcactgacagctcttcggcatcaagcaccggcacggtattg 339
            || ||||||||||| |||||||| || |||   ||| |||| ||||| ||||||  ||||
Sbjct: 1793 gagtgatccaccaggaccctcaccgagagcgtctcgccatcgagcacgggcacgacattg 1734

                                                                        
Query: 340  cctacaaccctcttgacaatgtcgttggcatgagatgagcgcgtctcatcatggcagaag 399
            || || ||||||||||| |||||||||||||  || || | |||||| || |||||||||
Sbjct: 1733 ccgacgaccctcttgacgatgtcgttggcatatgacgacctcgtctcgtcctggcagaag 1674

                                                                
Query: 400  tgtgtatgcaagccaccgtcaaggcccctggcgacatagaagtagacggcgg 451
            || ||  ||| ||  || ||||| || |||| ||| ||||||||||||||||
Sbjct: 1673 tgagtgcgcaggctgccatcaagccctctggagacgtagaagtagacggcgg 1622



to top

>emb|AJ532549.1|LTE532549 Lolium temulentum mRNA for putative soluble acid invertase (inv1:4
            gene)
          Length = 2407

 Score =  165 bits (83), Expect = 2e-37
 Identities = 281/347 (80%)
 Strand = Plus / Minus

                                                                        
Query: 100  gccatgtaggcttggttgtaggaagaatccatctcgtggaccacgagtctagtggtggtg 159
            ||||||||||| || ||||||||  | |||||||| || ||  |||| ||||||| ||||
Sbjct: 2157 gccatgtaggcctgattgtaggagaagtccatctcatgtactgcgaggctagtggcggtg 2098

                                                                        
Query: 160  acccgaattccagtggcattgttgaagaggtacaccccagcgttggcgtagatggcctcc 219
            || ||    || |||||||||||||||||||||||||| | |||||||||||||||||| 
Sbjct: 2097 acgcgggcaccggtggcattgttgaagaggtacaccccggtgttggcgtagatggcctcg 2038

                                                                        
Query: 220  gtcgggtacactcgtgatgttgcggtcaacctaccacccatcgcaaagctctcaacgatc 279
            || ||||||||||| || ||  | ||| |||| ||||||   ||||||||||| || || 
Sbjct: 2037 gttgggtacactcgcgaagtcactgtcgacctcccaccctgtgcaaagctctcgacaatg 1978

                                                                        
Query: 280  gaatgatccaccagcaccctcactgacagctcttcggcatcaagcaccggcacggtattg 339
            || || |||||||| || || |  || ||  | ||| |||||||||||||||||   || 
Sbjct: 1977 gagtggtccaccagtactctgatggatagtgcctcgccatcaagcaccggcacgacgtta 1918

                                                                        
Query: 340  cctacaaccctcttgacaatgtcgttggcatgagatgagcgcgtctcatcatggcagaag 399
            || ||||||||||| ||||||||||||||| | || || || | ||||||||||||||||
Sbjct: 1917 ccgacaaccctcttcacaatgtcgttggcacgcgacgaccgtgactcatcatggcagaag 1858

                                                           
Query: 400  tgtgtatgcaagccaccgtcaaggcccctggcgacatagaagtagac 446
            || ||  ||| ||| ||||||||||| ||||| || |||||||||||
Sbjct: 1857 tgcgtgcgcaggccgccgtcaaggcctctggcaacgtagaagtagac 1811



to top

>gb|AY082350.1| Lolium perenne fructosyltransferase (FT2) mRNA, complete cds
          Length = 2337

 Score =  143 bits (72), Expect = 6e-31
 Identities = 273/340 (80%)
 Strand = Plus / Minus

                                                                        
Query: 112  tggttgtaggaagaatccatctcgtggaccacgagtctagtggtggtgacccgaattcca 171
            ||||||||||| |  |||||||| ||||| ||||| || |||| |||||||||    || 
Sbjct: 2077 tggttgtaggaggggtccatctcatggacgacgagactggtggcggtgacccgggcaccg 2018

                                                                        
Query: 172  gtggcattgttgaagaggtacaccccagcgttggcgtagatggcctccgtcgggtacact 231
            ||||| |||||||||||||| ||||| || ||||||||||||||||| |||||||| |||
Sbjct: 2017 gtggcgttgttgaagaggtataccccggcattggcgtagatggcctcagtcgggtaaact 1958

                                                                        
Query: 232  cgtgatgttgcggtcaacctaccacccatcgcaaagctctcaacgatcgaatgatccacc 291
            ||||| ||  |   | |||| ||||||   || |||||||| || || || || ||||||
Sbjct: 1957 cgtgaagtcaccaccgacctcccaccctgtgcgaagctctcgacaatggagtggtccacc 1898

                                                                        
Query: 292  agcaccctcactgacagctcttcggcatcaagcaccggcacggtattgcctacaaccctc 351
            || ||||| || |||||| | ||  | || ||||| |||||| | ||||| || ||||||
Sbjct: 1897 agaaccctaacagacagcgcctctccgtcgagcactggcacgatgttgccaacgaccctc 1838

                                                                        
Query: 352  ttgacaatgtcgttggcatgagatgagcgcgtctcatcatggcagaagtgtgtatgcaag 411
            |||||||||||||||||| | ||||| || | ||| |||||||||||||| ||  ||| |
Sbjct: 1837 ttgacaatgtcgttggcacgggatgaccgtgactcgtcatggcagaagtgcgtgcgcagg 1778

                                                    
Query: 412  ccaccgtcaaggcccctggcgacatagaagtagacggcgg 451
               || || |||||||| ||||| ||||||||||||||||
Sbjct: 1777 ttgccatcgaggcccctcgcgacgtagaagtagacggcgg 1738



to top

>dbj|AB186920.1| Lolium perenne mRNA for putative fructosyltransferase1, complete cds
          Length = 2268

 Score =  115 bits (58), Expect = 1e-22
 Identities = 112/130 (86%)
 Strand = Plus / Minus

                                                                        
Query: 172  gtggcattgttgaagaggtacaccccagcgttggcgtagatggcctccgtcgggtacact 231
            ||||| |||||||| ||||||||||||||  |||||||||||||||||||||||||||||
Sbjct: 1858 gtggcgttgttgaacaggtacaccccagccctggcgtagatggcctccgtcgggtacact 1799

                                                                        
Query: 232  cgtgatgttgcggtcaacctaccacccatcgcaaagctctcaacgatcgaatgatccacc 291
            || || || || || | ||| ||||||||||| |||||||  ||||| || || ||||| 
Sbjct: 1798 cgcgacgtcgccgtgaccctcccacccatcgcgaagctctgcacgatggagtggtccacg 1739

                      
Query: 292  agcaccctca 301
            ||||||||||
Sbjct: 1738 agcaccctca 1729



to top

>gb|AF494041.1| Lolium perenne fructan 6-fructosyltransferase mRNA, complete cds
          Length = 2279

 Score =  107 bits (54), Expect = 3e-20
 Identities = 111/130 (85%)
 Strand = Plus / Minus

                                                                        
Query: 172  gtggcattgttgaagaggtacaccccagcgttggcgtagatggcctccgtcgggtacact 231
            ||||| |||||||| ||||||||||||||  |||||||||||||||||||||||||||||
Sbjct: 1864 gtggcgttgttgaacaggtacaccccagccctggcgtagatggcctccgtcgggtacact 1805

                                                                        
Query: 232  cgtgatgttgcggtcaacctaccacccatcgcaaagctctcaacgatcgaatgatccacc 291
            || || || || || | ||| ||||||||||| ||||| |  ||||| || || ||||| 
Sbjct: 1804 cgcgacgtcgccgtgaccctcccacccatcgcgaagctttgcacgatggagtggtccacg 1745

                      
Query: 292  agcaccctca 301
            ||||||||||
Sbjct: 1744 agcaccctca 1735



to top

>gb|AF069309.1| Triticum aestivum vacuolar invertase (WIVRV) mRNA, partial cds
          Length = 1840

 Score =  105 bits (53), Expect = 1e-19
 Identities = 111/129 (86%), Gaps = 1/129 (0%)
 Strand = Plus / Minus

                                                                        
Query: 172  gtggcattgttgaagaggtacaccccagcgttggcgtagatggcctccgtcgggtacact 231
            ||||| |||||||| |||||||| ||||||  ||||||||||||||||||||| ||||| 
Sbjct: 1374 gtggcgttgttgaaaaggtacacgccagcggcggcgtagatggcctccgtcggatacacc 1315

                                                                        
Query: 232  cgtgatgtt-gcggtcaacctaccacccatcgcaaagctctcaacgatcgaatgatccac 290
            |  |||||| |||||  |||| |||||||| || |||||||| |||||||| || |||||
Sbjct: 1314 ctcgatgttcgcggtggaccttccacccatggcgaagctctccacgatcgagtggtccac 1255

                     
Query: 291  cagcaccct 299
            |||||||||
Sbjct: 1254 cagcaccct 1246



to top

>gb|AY575717.1| Triticum monococcum vacuolar invertase1 (vin1) mRNA, complete cds
          Length = 2414

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 107/128 (83%)
 Strand = Plus / Minus

                                                                        
Query: 172  gtggcattgttgaagaggtacaccccagcgttggcgtagatggcctccgtcgggtacact 231
            ||||| |||||||| |||||||| ||||||  ||||||||||||||||||||| ||||| 
Sbjct: 1923 gtggcgttgttgaaaaggtacacgccagcggcggcgtagatggcctccgtcggatacacc 1864

                                                                        
Query: 232  cgtgatgttgcggtcaacctaccacccatcgcaaagctctcaacgatcgaatgatccacc 291
            |  || || |||||  |||| |||||||| || |||||||| || ||||| || ||||||
Sbjct: 1863 ctcgacgtcgcggtggacctcccacccatggcgaagctctccacaatcgagtggtccacc 1804

                    
Query: 292  agcaccct 299
            | ||||||
Sbjct: 1803 aacaccct 1796



to top

>emb|AJ532550.1|LTE532550 Lolium temulentum mRNA for putative fructan 6-fructosyltransferase
            (6ft gene)
          Length = 2331

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 108/130 (83%)
 Strand = Plus / Minus

                                                                        
Query: 172  gtggcattgttgaagaggtacaccccagcgttggcgtagatggcctccgtcgggtacact 231
            |||||||||||||| ||||||||||| ||  | ||||||||||||||||| |||||||| 
Sbjct: 1873 gtggcattgttgaacaggtacacccctgccctagcgtagatggcctccgttgggtacacc 1814

                                                                        
Query: 232  cgtgatgttgcggtcaacctaccacccatcgcaaagctctcaacgatcgaatgatccacc 291
            |  ||||| || || | ||| || |||||||| |||||||  ||||| || || ||||| 
Sbjct: 1813 ctcgatgtcgccgtgaccctccctcccatcgcgaagctctgcacgatggagtggtccacg 1754

                      
Query: 292  agcaccctca 301
            ||||||||||
Sbjct: 1753 agcaccctca 1744



to top

>gb|AY245431.1| Lolium perenne sucrose:sucrose 1-fructosyltransferase mRNA, complete
            cds
          Length = 1962

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 108/131 (82%)
 Strand = Plus / Minus

                                                                        
Query: 172  gtggcattgttgaagaggtacaccccagcgttggcgtagatggcctccgtcgggtacact 231
            ||||| |||||||||||||| ||||| |||   |||||||||||||||||||||||| | 
Sbjct: 1877 gtggcgttgttgaagaggtagacccccgcggccgcgtagatggcctccgtcgggtacgcc 1818

                                                                        
Query: 232  cgtgatgttgcggtcaacctaccacccatcgcaaagctctcaacgatcgaatgatccacc 291
            || || || || || | ||| || |||||||| |||||||  ||||| || || ||||| 
Sbjct: 1817 cgcgacgtcgccgtgatcctcccgcccatcgcgaagctctgcacgatggagtggtccact 1758

                       
Query: 292  agcaccctcac 302
            |||||||||||
Sbjct: 1757 agcaccctcac 1747



to top

>gb|DQ073970.1| Lolium perenne fructosyltransferase-like protein mRNA, complete cds
          Length = 1962

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 80/94 (85%)
 Strand = Plus / Minus

                                                                        
Query: 206  cgtagatggcctccgtcgggtacactcgtgatgttgcggtcaacctaccacccatcgcaa 265
            |||||||||||||||||||||| || || || ||  | ||  |||| || |||||||| |
Sbjct: 1864 cgtagatggcctccgtcgggtatacccgcgacgtcaccgttgacctcccgcccatcgcga 1805

                                              
Query: 266  agctctcaacgatcgaatgatccaccagcaccct 299
            ||||||| ||||||||||||||||| ||||||||
Sbjct: 1804 agctctctacgatcgaatgatccacgagcaccct 1771



to top

>gb|AF083856.1|AF083856 Saccharum hybrid cultivar H65-7052 soluble acid invertase (scinvh3'2)
            mRNA, partial cds
          Length = 1402

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 97/117 (82%)
 Strand = Plus / Minus

                                                                        
Query: 101  ccatgtaggcttggttgtaggaagaatccatctcgtggaccacgagtctagtggtggtga 160
            |||||||| | ||||||||||| || |||||||||||||| |||||  |  ||| |||||
Sbjct: 1017 ccatgtagtcgtggttgtaggacgagtccatctcgtggacgacgagcttcttggcggtga 958

                                                                     
Query: 161  cccgaattccagtggcattgttgaagaggtacaccccagcgttggcgtagatggcct 217
            | || |   | ||||| |||||||||||| |||| || |||||||||||||||||||
Sbjct: 957  cgcgcacggcggtggcgttgttgaagaggaacacgccggcgttggcgtagatggcct 901



to top

>gb|AY023475.1| Oryza sativa microsatellite MRG5800 containing (TCT)X8, closest to
           marker C1357, genomic sequence
          Length = 224

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                          
Query: 100 gccatgtaggcttggttgtaggaagaatccatctcgtggaccacgag 146
           ||||||||||||||||||||||| || |||||||||||||| |||||
Sbjct: 89  gccatgtaggcttggttgtaggaggagtccatctcgtggacgacgag 43



to top

>gb|AY575557.1| Oryza sativa (indica cultivar-group) cultivar IR64 vacuolar
           invertase 2 mRNA, partial cds
          Length = 503

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                          
Query: 100 gccatgtaggcttggttgtaggaagaatccatctcgtggaccacgag 146
           ||||||||||||||||||||||| || |||||||||||||| |||||
Sbjct: 263 gccatgtaggcttggttgtaggaggagtccatctcgtggacgacgag 217



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 172 gtggcattgttgaagaggtacaccccagcgttggcgtagatggcctccgtcgggtacac 230
           ||||| |||||||||||| | || || ||||||||||||||||||||||| ||||||||
Sbjct: 191 gtggcgttgttgaagaggaagacgccggcgttggcgtagatggcctccgtggggtacac 133



to top

>emb|AJ563384.1|ZMA563384 Zea mays partial ivr2 gene for vacuolar invertase, exons 1-2
          Length = 1978

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 143/179 (79%)
 Strand = Plus / Minus

                                                                        
Query: 100  gccatgtaggcttggttgtaggaagaatccatctcgtggaccacgagtctagtggtggtg 159
            ||||||||| | |||||||| || || |||||||||||||| |||||  | ||||  |||
Sbjct: 1685 gccatgtagtcgtggttgtatgacgagtccatctcgtggacgacgagcttcgtggccgtg 1626

                                                                        
Query: 160  acccgaattccagtggcattgttgaagaggtacaccccagcgttggcgtagatggcctcc 219
            |||||     | ||||| |||||||||||| | || || |||||||||||||||||||| 
Sbjct: 1625 acccgcgcggcggtggcgttgttgaagaggaagacgccggcgttggcgtagatggcctcg 1566

                                                                       
Query: 220  gtcgggtacactcgtgatgttgcggtcaacctaccacccatcgcaaagctctcaacgat 278
            || ||||| || || ||||| |||||  |||| || |||  ||| |||||||| |||||
Sbjct: 1565 gtggggtagacgcgcgatgtggcggtggacctcccgccctgcgcgaagctctcgacgat 1507



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2,
              complete sequence
          Length = 35954743

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                             
Query: 100    gccatgtaggcttggttgtaggaagaatccatctcgtggaccacgag 146
              ||||||||||||||||||||||| || |||||||||||||| |||||
Sbjct: 346515 gccatgtaggcttggttgtaggaggagtccatctcgtggacgacgag 346469



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                         
Query: 172    gtggcattgttgaagaggtacaccccagcgttggcgtagatggcctccgtcgggtacac 230
              ||||| |||||||||||| | || || ||||||||||||||||||||||| ||||||||
Sbjct: 346443 gtggcgttgttgaagaggaagacgccggcgttggcgtagatggcctccgtggggtacac 346385



to top

>gb|AF276704.1|AF276704 Oryza sativa vacuolar acid invertase (INV3) gene, complete cds
          Length = 3725

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                           
Query: 100  gccatgtaggcttggttgtaggaagaatccatctcgtggaccacgag 146
            ||||||||||||||||||||||| || |||||||||||||| |||||
Sbjct: 3562 gccatgtaggcttggttgtaggaggagtccatctcgtggacgacgag 3516



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                       
Query: 172  gtggcattgttgaagaggtacaccccagcgttggcgtagatggcctccgtcgggtacac 230
            ||||| |||||||||||| | || || ||||||||||||||||||||||| ||||||||
Sbjct: 3490 gtggcgttgttgaagaggaagacgccggcgttggcgtagatggcctccgtggggtacac 3432



to top

>dbj|AP004851.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1359_D06
          Length = 146805

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                            
Query: 100   gccatgtaggcttggttgtaggaagaatccatctcgtggaccacgag 146
             ||||||||||||||||||||||| || |||||||||||||| |||||
Sbjct: 75299 gccatgtaggcttggttgtaggaggagtccatctcgtggacgacgag 75253



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                        
Query: 172   gtggcattgttgaagaggtacaccccagcgttggcgtagatggcctccgtcgggtacac 230
             ||||| |||||||||||| | || || ||||||||||||||||||||||| ||||||||
Sbjct: 75227 gtggcgttgttgaagaggaagacgccggcgttggcgtagatggcctccgtggggtacac 75169



to top

>dbj|AK072245.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023002K22, full
            insert sequence
          Length = 2443

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                           
Query: 100  gccatgtaggcttggttgtaggaagaatccatctcgtggaccacgag 146
            ||||||||||||||||||||||| || |||||||||||||| |||||
Sbjct: 2083 gccatgtaggcttggttgtaggaggagtccatctcgtggacgacgag 2037



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                       
Query: 172  gtggcattgttgaagaggtacaccccagcgttggcgtagatggcctccgtcgggtacac 230
            ||||| |||||||||||| | || || ||||||||||||||||||||||| ||||||||
Sbjct: 2011 gtggcgttgttgaagaggaagacgccggcgttggcgtagatggcctccgtggggtacac 1953



to top

>gb|AY107166.1| Zea mays PCO109921 mRNA sequence
          Length = 1901

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 143/179 (79%)
 Strand = Plus / Minus

                                                                        
Query: 100  gccatgtaggcttggttgtaggaagaatccatctcgtggaccacgagtctagtggtggtg 159
            ||||||||| | |||||||| || || |||||||||||||| |||||  | ||||  |||
Sbjct: 1525 gccatgtagtcgtggttgtatgacgagtccatctcgtggacgacgagcttcgtggccgtg 1466

                                                                        
Query: 160  acccgaattccagtggcattgttgaagaggtacaccccagcgttggcgtagatggcctcc 219
            |||||     | ||||| |||||||||||| | || || |||||||||||||||||||| 
Sbjct: 1465 acccgcgcggcggtggcgttgttgaagaggaagacgccggcgttggcgtagatggcctcg 1406

                                                                       
Query: 220  gtcgggtacactcgtgatgttgcggtcaacctaccacccatcgcaaagctctcaacgat 278
            || ||||| || || ||||| |||||  |||| || |||  ||| |||||||| |||||
Sbjct: 1405 gtggggtagacgcgcgatgtggcggtggacctcccgccctgcgcgaagctctcgacgat 1347



to top

>gb|U31451.1|ZMU31451 Zea mays invertase mRNA, partial cds
          Length = 1530

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 143/179 (79%)
 Strand = Plus / Minus

                                                                        
Query: 100  gccatgtaggcttggttgtaggaagaatccatctcgtggaccacgagtctagtggtggtg 159
            ||||||||| | |||||||| || || |||||||||||||| |||||  | ||||  |||
Sbjct: 1511 gccatgtagtcgtggttgtatgacgagtccatctcgtggacgacgagcttcgtggccgtg 1452

                                                                        
Query: 160  acccgaattccagtggcattgttgaagaggtacaccccagcgttggcgtagatggcctcc 219
            |||||     | ||||| |||||||||||| | || || |||||||||||||||||||| 
Sbjct: 1451 acccgcgcggcggtggcgttgttgaagaggaagacgccggcgttggcgtagatggcctcg 1392

                                                                       
Query: 220  gtcgggtacactcgtgatgttgcggtcaacctaccacccatcgcaaagctctcaacgat 278
            || ||||| || || ||||| |||||  |||| || |||  ||| |||||||| |||||
Sbjct: 1391 gtggggtagacgcgcgatgtggcggtggacctcccgccctgcgcgaagctctcgacgat 1333



to top

>gb|AY302083.1| Saccharum hybrid cultivar soluble acid invertase (ShinvA) mRNA,
            partial cds
          Length = 2274

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 96/117 (82%)
 Strand = Plus / Minus

                                                                        
Query: 101  ccatgtaggcttggttgtaggaagaatccatctcgtggaccacgagtctagtggtggtga 160
            |||||||| | ||||||||||| || |||||||||||||| |||||  |  ||| |||||
Sbjct: 1909 ccatgtagtcgtggttgtaggacgagtccatctcgtggacgacgagcttcttggcggtga 1850

                                                                     
Query: 161  cccgaattccagtggcattgttgaagaggtacaccccagcgttggcgtagatggcct 217
            | ||     | ||||| |||||||||||| |||| || |||||||||||||||||||
Sbjct: 1849 cgcgcgcggcggtggcgttgttgaagaggaacacgccggcgttggcgtagatggcct 1793



to top

>gb|AF062735.1|AF062735 Saccharum officinarum soluble acid invertase mRNA, partial cds
          Length = 1808

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 96/117 (82%)
 Strand = Plus / Minus

                                                                        
Query: 101  ccatgtaggcttggttgtaggaagaatccatctcgtggaccacgagtctagtggtggtga 160
            |||||||| | ||||||||||| || |||||||||||||| |||||  |  ||| |||||
Sbjct: 1690 ccatgtagtcgtggttgtaggacgagtccatctcgtggacgacgagcttcttggcggtga 1631

                                                                     
Query: 161  cccgaattccagtggcattgttgaagaggtacaccccagcgttggcgtagatggcct 217
            | ||     | ||||| |||||||||||| |||| || |||||||||||||||||||
Sbjct: 1630 cgcgcgcggcggtggcgttgttgaagaggaacacgccggcgttggcgtagatggcct 1574



to top

>gb|AF492836.1| Lolium perenne putative sucrose:sucrose 1-fructosyltransferase mRNA,
            complete cds
          Length = 2508

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                        
Query: 178  ttgttgaagaggtacaccccagcgttggcgtagatggcctccgtcgggtacactcgtgat 237
            |||||||| ||||||||||| ||   ||||||||||||||||||||||||  | || |||
Sbjct: 1894 ttgttgaacaggtacacccctgccgcggcgtagatggcctccgtcgggtatgcccgcgat 1835

                                                                        
Query: 238  gttgcggtcaacctaccacccatcgcaaagctctcaacgatcgaatgatccaccagcacc 297
            ||  | ||   ||| ||||||||| | |||||||  ||||| || || ||||| ||||||
Sbjct: 1834 gtcaccgtggtcctcccacccatcacgaagctctgcacgatggagtggtccactagcacc 1775

                    
Query: 298  ctcactga 305
            ||||||||
Sbjct: 1774 ctcactga 1767



to top

>dbj|AB125218.1| Lolium perenne mRNA for putative fructosyltransferase2, complete cds
          Length = 2462

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                        
Query: 178  ttgttgaagaggtacaccccagcgttggcgtagatggcctccgtcgggtacactcgtgat 237
            |||||||| ||||||||||| ||   ||||||||||||||||||||||||  | || |||
Sbjct: 1879 ttgttgaacaggtacacccctgccgcggcgtagatggcctccgtcgggtatgcccgcgat 1820

                                                                        
Query: 238  gttgcggtcaacctaccacccatcgcaaagctctcaacgatcgaatgatccaccagcacc 297
            ||  | ||   ||| ||||||||| | |||||||  ||||| || || ||||| ||||||
Sbjct: 1819 gtcaccgtggtcctcccacccatcacgaagctctgcacgatggagtggtccactagcacc 1760

                    
Query: 298  ctcactga 305
            ||||||||
Sbjct: 1759 ctcactga 1752



to top

>gb|AF062734.1|AF062734 Saccharum robustum soluble acid invertase mRNA, partial cds
          Length = 1808

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 95/117 (81%)
 Strand = Plus / Minus

                                                                        
Query: 101  ccatgtaggcttggttgtaggaagaatccatctcgtggaccacgagtctagtggtggtga 160
            |||||||| | ||||||||||| || |||||||||||||| |||||  |  ||| |||||
Sbjct: 1690 ccatgtagtcgtggttgtaggacgagtccatctcgtggacgacgagcttcttggcggtga 1631

                                                                     
Query: 161  cccgaattccagtggcattgttgaagaggtacaccccagcgttggcgtagatggcct 217
            | ||     | ||||| |||||||||||| |||| || ||||||||||| |||||||
Sbjct: 1630 cgcgcgcggcggtggcgttgttgaagaggaacacgccggcgttggcgtaaatggcct 1574



to top

>gb|AF481763.1| Lolium perenne fructosyltransferase (FT1) mRNA, complete cds
          Length = 2386

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                        
Query: 208  tagatggcctccgtcgggtacactcgtgatgttgcggtcaacctaccacccatcgcaaag 267
            |||||||||||||| |||||||| |  |||||||| ||  |||| || ||||| || |||
Sbjct: 1870 tagatggcctccgttgggtacaccctcgatgttgccgtggacctgccgcccatggcgaag 1811

                                            
Query: 268  ctctcaacgatcgaatgatccaccagcaccct 299
            ||||| ||||| || || ||||| ||||||||
Sbjct: 1810 ctctccacgattgagtggtccacgagcaccct 1779



to top

>dbj|AB088409.1| Triticum aestivum 1-FFT-A mRNA for fructan:fructan
            1-fructosyltransferase, complete cds
          Length = 2304

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 103/128 (80%)
 Strand = Plus / Minus

                                                                        
Query: 172  gtggcattgttgaagaggtacaccccagcgttggcgtagatggcctccgtcgggtacact 231
            |||||||||||||| ||||| ||||| ||    ||||| |||||||||||||||||  | 
Sbjct: 1934 gtggcattgttgaacaggtagacccccgccgccgcgtaaatggcctccgtcgggtaggcc 1875

                                                                        
Query: 232  cgtgatgttgcggtcaacctaccacccatcgcaaagctctcaacgatcgaatgatccacc 291
            | |||||| || |||| ||| || |||||| | |||||||  ||||| || || ||||| 
Sbjct: 1874 cttgatgtcgccgtcatcctcccgcccatcacgaagctctgcacgatggagtggtccacg 1815

                    
Query: 292  agcaccct 299
            ||||||||
Sbjct: 1814 agcaccct 1807



to top

>dbj|AB159786.1| Triticum aestivum 1-SST gene for sucrose:sucrose
            1-fructosyltransferase, complete cds
          Length = 3326

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 57/67 (85%)
 Strand = Plus / Minus

                                                                        
Query: 205  gcgtagatggcctccgtcgggtacactcgtgatgttgcggtcaacctaccacccatcgca 264
            |||||||||||||| ||||||||| | |  || ||||| |||||||| || |||||||| 
Sbjct: 3196 gcgtagatggcctcggtcgggtacgccctcgacgttgctgtcaacctcccgcccatcgcg 3137

                   
Query: 265  aagctct 271
            |||||||
Sbjct: 3136 aagctct 3130



to top

>dbj|AB029888.1| Triticum aestivum 1-SST mRNA for sucrose:sucrose
            1-fructosytransferase, complete cds
          Length = 2330

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 57/67 (85%)
 Strand = Plus / Minus

                                                                        
Query: 205  gcgtagatggcctccgtcgggtacactcgtgatgttgcggtcaacctaccacccatcgca 264
            |||||||||||||| ||||||||| | |  || ||||| |||||||| || |||||||| 
Sbjct: 1914 gcgtagatggcctcggtcgggtacgccctcgacgttgctgtcaacctcccgcccatcgcg 1855

                   
Query: 265  aagctct 271
            |||||||
Sbjct: 1854 aagctct 1848



to top

>dbj|AB088410.1| Triticum aestivum 1-FFT-B mRNA for fructan:fructan
            1-fructosyltransferase, complete cds
          Length = 2251

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                     
Query: 172  gtggcattgttgaagaggtacaccccagcgttggcgtagatggcctccgtcgggtac 228
            |||||||||||||| ||||| ||||| ||    ||||| ||||||||||||||||||
Sbjct: 1895 gtggcattgttgaacaggtagacccccgccgccgcgtaaatggcctccgtcgggtac 1839



to top

>gb|AF192394.1|AF192394 Poa secunda sucrose:fructan 6-fructosyltransferase (6-SFT) mRNA,
            complete cds
          Length = 2057

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 99/124 (79%)
 Strand = Plus / Minus

                                                                        
Query: 178  ttgttgaagaggtacaccccagcgttggcgtagatggcctccgtcgggtacactcgtgat 237
            |||||||| | ||||||||| |||   |||||||| ||||| ||||||||||| || || 
Sbjct: 1811 ttgttgaaaacgtacacccctgcggccgcgtagatagcctctgtcgggtacacccgcgac 1752

                                                                        
Query: 238  gttgcggtcaacctaccacccatcgcaaagctctcaacgatcgaatgatccaccagcacc 297
            || || || | ||| || |||||||| |||||||  ||||| || || || || ||||||
Sbjct: 1751 gtcgccgtgaccctcccgcccatcgcgaagctctgcacgatggagtggtctacgagcacc 1692

                
Query: 298  ctca 301
            ||||
Sbjct: 1691 ctca 1688



to top

>emb|AJ297369.1|FAR297369 Festuca arundinacea mRNA for sucrose:sucrose 1-fructosyltransferase
            (1-SST gene)
          Length = 2045

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 81/100 (81%)
 Strand = Plus / Minus

                                                                        
Query: 172  gtggcattgttgaagaggtacaccccagcgttggcgtagatggcctccgtcgggtacact 231
            ||||| |||||||||||||| || || ||    |||||||| ||||| ||||||||| | 
Sbjct: 1880 gtggcgttgttgaagaggtagactcccgccgctgcgtagatagcctcagtcgggtacgcc 1821

                                                    
Query: 232  cgtgatgttgcggtcaacctaccacccatcgcaaagctct 271
            || ||||| || || | ||| ||||||||||| |||||||
Sbjct: 1820 cgcgatgtcgccgtaatcctcccacccatcgcgaagctct 1781



to top

>emb|AL445238.12| Human DNA sequence from clone RP11-394A14 on chromosome 13 Contains a
              protein phosphatase 1, regulatory (inhibitor) subunit 2
              (PPP1R2) pseudogene, a novel gene and an olfactory receptor
              pseudogene, complete sequence
          Length = 174801

 Score = 46.1 bits (23), Expect = 0.099
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 77     ttttcccattttgtttttacagt 99
              |||||||||||||||||||||||
Sbjct: 127445 ttttcccattttgtttttacagt 127423



to top

>emb|AJ567377.2|HVU567377 Hordeum vulgare partial mRNA for
            sucrose-sucrose-1-fructosyltransferase (1-sst gene)
          Length = 2157

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 79/98 (80%)
 Strand = Plus / Minus

                                                                        
Query: 172  gtggcattgttgaagaggtacaccccagcgttggcgtagatggcctccgtcgggtacact 231
            |||||||||||||| ||||| ||||| ||    || ||||||||||| ||||||||| | 
Sbjct: 1820 gtggcattgttgaacaggtagacccccgccgccgcatagatggcctcggtcgggtacgcc 1761

                                                  
Query: 232  cgtgatgttgcggtcaacctaccacccatcgcaaagct 269
            |  || || |  |||||||| ||||||||||| |||||
Sbjct: 1760 ctcgacgtcgtcgtcaacctcccacccatcgcgaagct 1723



to top

>emb|BX842566.4| Mouse DNA sequence from clone RP23-174M7 on chromosome X, complete
             sequence
          Length = 180961

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 383   tctcatcatggcagaagtgtgt 404
             ||||||||||||||||||||||
Sbjct: 91822 tctcatcatggcagaagtgtgt 91843



to top

>emb|AL929107.14| Mouse DNA sequence from clone RP23-6C6 on chromosome X, complete
             sequence
          Length = 59720

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 383   tctcatcatggcagaagtgtgt 404
             ||||||||||||||||||||||
Sbjct: 59307 tctcatcatggcagaagtgtgt 59328



to top

>gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome
          Length = 5650368

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 319     tcaagcaccggcacggtattg 339
               |||||||||||||||||||||
Sbjct: 2752246 tcaagcaccggcacggtattg 2752226



to top

>emb|AL136982.11| Human DNA sequence from clone RP11-96C23 on chromosome 10 Contains a
             KIAA0187 pseudogene, the gene for adipose specific 2
             (APM2), the FAM25A gene for family with sequence
             similarity 25, member A, five novel genes, the GLUD1 gene
             for glutamate dehydrogenase 1, the 5' end of a novel gene
             and four CpG islands, complete sequence
          Length = 182959

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 77    ttttcccattttgtttttaca 97
             |||||||||||||||||||||
Sbjct: 44090 ttttcccattttgtttttaca 44070



to top

>gb|AC025268.8| Homo sapiens chromosome 10 clone RP11-411A19, complete sequence
          Length = 149668

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 77   ttttcccattttgtttttaca 97
            |||||||||||||||||||||
Sbjct: 6620 ttttcccattttgtttttaca 6640



to top

>ref|XM_937229.1| PREDICTED: Homo sapiens KIAA1975 protein similar to MRIP2, transcript
            variant 3 (KIAA1975), mRNA
          Length = 3170

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 77   ttttcccattttgtttttaca 97
            |||||||||||||||||||||
Sbjct: 2903 ttttcccattttgtttttaca 2883



to top

>ref|XM_943227.1| PREDICTED: Homo sapiens KIAA1975 protein similar to MRIP2, transcript
            variant 4 (KIAA1975), mRNA
          Length = 1690

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 77   ttttcccattttgtttttaca 97
            |||||||||||||||||||||
Sbjct: 1423 ttttcccattttgtttttaca 1403



to top

>ref|XM_370567.4| PREDICTED: Homo sapiens KIAA1975 protein similar to MRIP2, transcript
            variant 1 (KIAA1975), mRNA
          Length = 3170

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 77   ttttcccattttgtttttaca 97
            |||||||||||||||||||||
Sbjct: 2903 ttttcccattttgtttttaca 2883



to top

>ref|XM_931482.1| PREDICTED: Homo sapiens KIAA1975 protein similar to MRIP2, transcript
            variant 2 (KIAA1975), mRNA
          Length = 1690

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 77   ttttcccattttgtttttaca 97
            |||||||||||||||||||||
Sbjct: 1423 ttttcccattttgtttttaca 1403



to top

>emb|AJ532551.1|LTE532551 Lolium temulentum partial mRNA for putative soluble acid invertase
            (inv1:2 gene)
          Length = 1998

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 206  cgtagatggcctccgtcgggtacac 230
            ||||||| |||||||||||||||||
Sbjct: 1484 cgtagatagcctccgtcgggtacac 1460



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 415  ccgtcaaggcccctggcgacatagaagta 443
            |||||||||||| |||| |||||||||||
Sbjct: 1275 ccgtcaaggcccttggccacatagaagta 1247



to top

>emb|Y11124.1|CIPINVERT C.intybus mRNA for putative invertase
          Length = 1796

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 263  caaagctctcaacgatcgaatgatc 287
            ||||||||||||||||||| |||||
Sbjct: 1539 caaagctctcaacgatcgagtgatc 1515



to top

>emb|AJ006067.1|ACE6067 Allium cepa mRNA for invertase
          Length = 2438

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 265  aagctctcaacgatcgaatgatccaccag 293
            ||||||||||| ||||||||||| |||||
Sbjct: 1948 aagctctcaacaatcgaatgatcaaccag 1920



to top

>dbj|AB075855.1| Homo sapiens mRNA for KIAA1975 protein
          Length = 4559

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 77   ttttcccattttgtttttaca 97
            |||||||||||||||||||||
Sbjct: 4313 ttttcccattttgtttttaca 4293



to top

>ref|XM_526649.1| PREDICTED: Pan troglodytes similar to cytochrome P450, family 2,
           subfamily U, polypeptide 1; cytochrome P450 P450TEC
           (LOC471267), mRNA
          Length = 1533

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 3   aatgagagaacttcctttgt 22
           ||||||||||||||||||||
Sbjct: 757 aatgagagaacttcctttgt 738



to top

>gb|AY343323.1| Homo sapiens cytochrome P450 mRNA, complete cds
          Length = 3544

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 3   aatgagagaacttcctttgt 22
           ||||||||||||||||||||
Sbjct: 586 aatgagagaacttcctttgt 567



to top

>ref|NM_183075.2| Homo sapiens cytochrome P450, family 2, subfamily U, polypeptide 1
           (CYP2U1), mRNA
          Length = 4760

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 3   aatgagagaacttcctttgt 22
           ||||||||||||||||||||
Sbjct: 630 aatgagagaacttcctttgt 611



to top

>ref|XM_610191.2| PREDICTED: Bos taurus similar to HECT, C2 and WW domain containing E3
            ubiquitin protein ligase 2 (LOC531691), mRNA
          Length = 3069

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 298  ctcactgacagctcttcggc 317
            ||||||||||||||||||||
Sbjct: 1821 ctcactgacagctcttcggc 1802



to top

>ref|NM_001040293.1| Danio rerio zgc:136455 (zgc:136455), mRNA
          Length = 1160

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 299  tcactgacagctcttcggcatcaa 322
            ||||||| ||||||||||||||||
Sbjct: 1140 tcactgaaagctcttcggcatcaa 1117



to top

>gb|BC046671.1| Xenopus laevis similar to spleen focus forming virus (SFFV) proviral
            integration oncogene spi1, mRNA (cDNA clone MGC:53020
            IMAGE:5537169), complete cds
          Length = 2079

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 66   acaaaaatacgttttcccattttg 89
            ||||||| ||||||||||||||||
Sbjct: 1732 acaaaaaaacgttttcccattttg 1755



to top

>gb|BC115141.1| Danio rerio cDNA clone MGC:136455 IMAGE:7433898, complete cds
          Length = 1160

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 299  tcactgacagctcttcggcatcaa 322
            ||||||| ||||||||||||||||
Sbjct: 1140 tcactgaaagctcttcggcatcaa 1117



to top

>emb|AL136089.15| Human DNA sequence from clone RP1-278E11 on chromosome 6 Contains the
             3' end of the novel gene KIAA0381, the MOCS1 gene for
             molybdenum cofactor synthesis 1, a pseudogene similar to
             60S ribosomal protein L23 (RPL23) and a pseudogene similar
             to tubulin beta chain (TUBB), complete sequence
          Length = 99479

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 1     aaaatgagagaacttccttt 20
             ||||||||||||||||||||
Sbjct: 75030 aaaatgagagaacttccttt 75011



to top

>emb|AL161573.2|ATCHRIV69 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 69
          Length = 197655

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 78     tttcccattttgtttttaca 97
              ||||||||||||||||||||
Sbjct: 176058 tttcccattttgtttttaca 176077



to top

>emb|AL078469.2|ATF25O24 Arabidopsis thaliana DNA chromosome 4, BAC clone F25O24 (ESSA
            project)
          Length = 97714

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 78   tttcccattttgtttttaca 97
            ||||||||||||||||||||
Sbjct: 8434 tttcccattttgtttttaca 8453



to top

>emb|AL035353.1|ATF16A16 Arabidopsis thaliana DNA chromosome 4, BAC clone  F16A16 (ESSAII
            project)
          Length = 97155

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 78   tttcccattttgtttttaca 97
            ||||||||||||||||||||
Sbjct: 1010 tttcccattttgtttttaca 991



to top

>gb|U40819.1|RNU40819 Rattus norvegicus 5'-AMP-activated protein kinase alpha-1 catalytic
            subunit mRNA, complete cds
          Length = 1647

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 386  catcatggcagaagtgtgta 405
            ||||||||||||||||||||
Sbjct: 1224 catcatggcagaagtgtgta 1243



to top

>gb|AF222932.1| Psathyrostachys fragilis sucrose:fructan 6-fructosyltransferase
           (6-SFT) gene, partial cds
          Length = 311

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 213 ggcctccgtcgggtacactcgtga 236
           ||||||| ||||||||||||||||
Sbjct: 221 ggcctccatcgggtacactcgtga 198



to top

>gb|AC096564.3| Homo sapiens BAC clone RP11-286E11 from 4, complete sequence
          Length = 163317

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 3      aatgagagaacttcctttgt 22
              ||||||||||||||||||||
Sbjct: 158471 aatgagagaacttcctttgt 158452



to top

>ref|XM_687067.1| PREDICTED: Danio rerio similar to GFHL3075 (LOC563710), mRNA
          Length = 1947

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 284  gatccaccagcaccctcact 303
            ||||||||||||||||||||
Sbjct: 1916 gatccaccagcaccctcact 1935



to top

>emb|BX571694.10| Zebrafish DNA sequence from clone CH211-159E21 in linkage group 10,
             complete sequence
          Length = 163542

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 284   gatccaccagcaccctcact 303
             ||||||||||||||||||||
Sbjct: 99325 gatccaccagcaccctcact 99344



to top

>dbj|AB168699.1| Macaca fascicularis testis cDNA clone: QtsA-14239, similar to human
           cytochrome P450, family 2, subfamily U, polypeptide
           1(CYP2U1), mRNA, RefSeq: NM_183075.1
          Length = 2096

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 3   aatgagagaacttcctttgt 22
           ||||||||||||||||||||
Sbjct: 630 aatgagagaacttcctttgt 611



to top

>ref|NM_019142.1| Rattus norvegicus protein kinase, AMP-activated, alpha 1 catalytic
            subunit (Prkaa1), mRNA
          Length = 1647

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 386  catcatggcagaagtgtgta 405
            ||||||||||||||||||||
Sbjct: 1224 catcatggcagaagtgtgta 1243



to top

>ref|NM_001003852.1| Danio rerio Iglon2 (LOC445375), mRNA
          Length = 1941

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 299  tcactgacagctcttcggcatcaa 322
            ||||||| ||||||||||||||||
Sbjct: 1218 tcactgaaagctcttcggcatcaa 1195



to top

>gb|BC095250.1| Danio rerio Iglon2, mRNA (cDNA clone IMAGE:7222481), partial cds
          Length = 1436

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 299  tcactgacagctcttcggcatcaa 322
            ||||||| ||||||||||||||||
Sbjct: 1047 tcactgaaagctcttcggcatcaa 1024



to top

>gb|AC104081.2| Homo sapiens BAC clone RP11-559A1 from 2, complete sequence
          Length = 142118

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 138  gaccacgagtctagtggtgg 157
            ||||||||||||||||||||
Sbjct: 4363 gaccacgagtctagtggtgg 4344



to top

>gb|AC018659.35| Homo sapiens 12 BAC RP11-528M18 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 178145

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 11    aacttcctttgtataaaaca 30
             ||||||||||||||||||||
Sbjct: 54352 aacttcctttgtataaaaca 54333



to top

>gb|AC161384.4| Gallus gallus BAC clone CH261-69B2 from chromosome ul, complete
             sequence
          Length = 186366

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 390   atggcagaagtgtgtatgca 409
             ||||||||||||||||||||
Sbjct: 66613 atggcagaagtgtgtatgca 66632



to top

>gb|AC167334.3| Gallus gallus BAC clone CH261-18C17 from chromosome unknown, complete
            sequence
          Length = 220538

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 390  atggcagaagtgtgtatgca 409
            ||||||||||||||||||||
Sbjct: 8679 atggcagaagtgtgtatgca 8660



to top

>gb|AE015924.1| Porphyromonas gingivalis W83, complete genome
          Length = 2343476

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                               
Query: 311     cttcggcatcaagcaccggcacggtattgcct 342
               ||||||||||  ||| ||||||||||||||||
Sbjct: 1395947 cttcggcatcgcgcatcggcacggtattgcct 1395978



to top

>gb|AF002656.1|AF002656 Asparagus officinalis acid invertase mRNA, complete cds
          Length = 2388

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 261  cgcaaagctctcaacgatcgaatgatccacca 292
            |||||||||||| |||||||| || |||||||
Sbjct: 1848 cgcaaagctctccacgatcgagtggtccacca 1817



to top

>gb|AF241638.1| Danio rerio neurotrimin mRNA, complete cds
          Length = 1941

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 299  tcactgacagctcttcggcatcaa 322
            ||||||| ||||||||||||||||
Sbjct: 1218 tcactgaaagctcttcggcatcaa 1195


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,492,343
Number of Sequences: 3902068
Number of extensions: 3492343
Number of successful extensions: 60555
Number of sequences better than 10.0: 76
Number of HSP's better than 10.0 without gapping: 75
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 60346
Number of HSP's gapped (non-prelim): 201
length of query: 453
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 431
effective length of database: 17,147,199,772
effective search space: 7390443101732
effective search space used: 7390443101732
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top