ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal25f23
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|L36959.1|BLYCA Hordeum vulgare carbonic anhydrase mRNA, compl... 454 e-125
2dbj|AP002373.3| Homo sapiens genomic DNA, chromosome 11q, clone:... 42 0.87
3gb|AE014841.1| Plasmodium falciparum 3D7 chromosome 11 section 6... 40 3.4
4emb|AL079341.19|HSDJ319M7 Human DNA sequence from clone RP1-319M... 40 3.4
5gb|AC018887.10| Homo sapiens BAC clone RP11-419E14 from 2, compl... 40 3.4

>gb|L36959.1|BLYCA Hordeum vulgare carbonic anhydrase mRNA, complete cds
          Length = 1529

 Score =  454 bits (229), Expect = e-125
 Identities = 255/265 (96%), Gaps = 1/265 (0%)
 Strand = Plus / Minus

                                                                        
Query: 1    tctttcgatcacaagnacgatcaaattatgcatcacatagcagtacaattcctcgtcaga 60
            ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1454 tctttcgatcacaag-acgatcaaattatgcatcacatagcagtacaattcctcgtcaga 1396

                                                                        
Query: 61   aaatggtgaagnnnnnnnggttctattgcttatggcaaattcacatcgggccatccggca 120
            |||||||||||       ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1395 aaatggtgaagaaaaaaaggttctattgcttatggcaaattcacatcgggccatccggca 1336

                                                                        
Query: 121  tccagtactgggcaataacgggtacgcactcccatggcattgcattcacatcgatcggac 180
            ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1335 tccagtactggacaataacgggtacgcactcccatggcattgcattcacatcgatcggac 1276

                                                                        
Query: 181  gatatcttgatatatgtacgtttgtatatgtcggagttaaccggtggggaaganttactg 240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 1275 gatatcttgatatatgtacgtttgtatatgtcggagttaaccggtggggaagatttactg 1216

                                     
Query: 241  ctcccatgtttcgaacttgccggag 265
            |||||||||||||||||||||||||
Sbjct: 1215 ctcccatgtttcgaacttgccggag 1191



to top

>dbj|AP002373.3| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-212D19, complete
             sequence
          Length = 138197

 Score = 42.1 bits (21), Expect = 0.87
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 191   tatatgtacgtttgtatatgt 211
             |||||||||||||||||||||
Sbjct: 80852 tatatgtacgtttgtatatgt 80872



to top

>gb|AE014841.1| Plasmodium falciparum 3D7 chromosome 11 section 6 of 8 of the complete
              sequence
          Length = 252420

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 188    tgatatatgtacgtttgtatatgt 211
              |||||||||||| |||||||||||
Sbjct: 127219 tgatatatgtacatttgtatatgt 127196



to top

>emb|AL079341.19|HSDJ319M7 Human DNA sequence from clone RP1-319M7 on chromosome 6p21.1-21.3
             Contains the 5' end of the gene for a novel protein
             (contains KIAA1880 and FLJ32945), a TRK-fused gene (TFG)
             pseudogene and a CpG island, complete sequence
          Length = 128216

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 81    ttctattgcttatggcaaat 100
             ||||||||||||||||||||
Sbjct: 55862 ttctattgcttatggcaaat 55881



to top

>gb|AC018887.10| Homo sapiens BAC clone RP11-419E14 from 2, complete sequence
          Length = 189466

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 190    atatatgtacgtttgtatat 209
              ||||||||||||||||||||
Sbjct: 169067 atatatgtacgtttgtatat 169048


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,427,666
Number of Sequences: 3902068
Number of extensions: 1427666
Number of successful extensions: 20120
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 20110
Number of HSP's gapped (non-prelim): 8
length of query: 265
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 243
effective length of database: 17,147,199,772
effective search space: 4166769544596
effective search space used: 4166769544596
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top