Clone Name	rbaal25a04
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|AY103710.1| Zea mays PCO123562 mRNA sequence	222	7e-55
2	gb|BT016569.1| Zea mays clone Contig402 mRNA sequence	206	4e-50
3	ref|NM_193707.1| Oryza sativa (japonica cultivar-group), predic...	165	1e-37
4	ref|XM_475081.1| Oryza sativa (japonica cultivar-group), predic...	165	1e-37
5	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	165	1e-37
6	gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare str...	165	1e-37
7	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	165	1e-37
8	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	165	1e-37
9	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	165	1e-37
10	dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic D...	165	1e-37
11	dbj|AK121750.1| Oryza sativa (japonica cultivar-group) cDNA clon...	165	1e-37
12	dbj|AK074018.1| Oryza sativa (japonica cultivar-group) cDNA clon...	165	1e-37
13	gb|AC093921.2| Oryza sativa (japonica cultivar-group) chromosome...	165	1e-37
14	ref|XM_475374.1| Oryza sativa (japonica cultivar-group), predic...	161	2e-36
15	gb|AC108876.2| Oryza sativa (japonica cultivar-group) chromosome...	161	2e-36
16	gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome...	161	2e-36
17	dbj|AK099763.1| Oryza sativa (japonica cultivar-group) cDNA clon...	161	2e-36
18	dbj|AK067406.1| Oryza sativa (japonica cultivar-group) cDNA clon...	161	2e-36
19	gb|BT019008.1| Zea mays clone Contig499.F mRNA sequence	151	2e-33
20	dbj|D38090.1|WHTPH2AD Triticum aestivum mRNA for protein H2A, co...	151	2e-33
21	dbj|D38088.1|WHTPH2AB Triticum aestivum mRNA for protein H2A, co...	151	2e-33
22	dbj|D38087.1|WHTPH2AA Triticum aestivum mRNA for protein H2A, co...	151	2e-33
23	emb|X94973.1|TAH2A274 T.aestivum histone H2A gene (clone TH274)	143	5e-31
24	gb|L75802.1|WHTHIH2A Triticum aestivum histone H2A gene, complet...	143	5e-31
25	gb|BT016301.1| Zea mays clone Contig134 mRNA sequence	125	1e-25
26	gb|AY104486.1| Zea mays PCO109435 mRNA sequence	119	8e-24
27	gb|AY103585.1| Zea mays PCO123564 mRNA sequence	115	1e-22
28	gb|BT019315.1| Zea mays clone Contig989.F mRNA sequence	107	3e-20
29	gb|BT017719.1| Zea mays clone EL01N0447A04.c mRNA sequence	100	7e-18
30	dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic D...	94	4e-16
31	gb|U08225.1|ZMU08225 Zea mays W-22 histone H2A mRNA, complete cds	94	4e-16
32	gb|AF255739.1|AF255739 Bufo bufo gagarizans replication-dependen...	92	2e-15
33	dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D...	92	2e-15
34	emb|AL662960.3|OSJN00162 Oryza sativa genomic DNA, chromosome 4,...	92	2e-15
35	emb|CR700361.2|CNS0G3CL Tetraodon nigroviridis full-length cDNA	88	3e-14
36	dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D...	88	3e-14
37	dbj|AK121752.1| Oryza sativa (japonica cultivar-group) cDNA clon...	88	3e-14
38	gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome...	88	3e-14
39	emb|AL713943.3|CNS07YPC Oryza sativa chromosome 12, . BAC OSJNBa...	88	3e-14
40	emb|AL731880.3|CNS08C8J Oryza sativa chromosome 12, . BAC OSJNBa...	88	3e-14
41	gb|AF493985.1| Triticum aestivum H2A-1 gene, partial sequence	86	1e-13
42	ref|XM_482492.1| Oryza sativa (japonica cultivar-group), mRNA	72	2e-09
43	gb|BC068823.1| Xenopus laevis cDNA clone IMAGE:6635737, partial cds	72	2e-09
44	gb|AF255740.1|AF255740 Bufo bufo gagarizans histone H1 (H1) and ...	72	2e-09
45	dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D...	72	2e-09
46	dbj|AP005734.4| Oryza sativa (japonica cultivar-group) genomic D...	72	2e-09
47	dbj|AP003898.3| Oryza sativa (japonica cultivar-group) genomic D...	72	2e-09
48	gb|BC010336.1| Mus musculus H2A histone family, member X, mRNA (...	70	6e-09
49	gb|AC122428.4| Mus musculus BAC clone RP24-175C20 from chromosom...	70	6e-09
50	ref|NM_010436.2| Mus musculus H2A histone family, member X (H2af...	70	6e-09
51	emb|Z35401.1|MMHISTH2A M.musculus C3H gene for histone H2A.X	70	6e-09
52	emb|X58069.1|MMH2AX Mouse mRNA for Histone H2A.X	70	6e-09
53	gb|BC005468.1| Mus musculus H2A histone family, member X, mRNA (...	70	6e-09
54	dbj|AK088040.1| Mus musculus 2 days neonate thymus thymic cells ...	70	6e-09
55	dbj|AK008124.1| Mus musculus adult male small intestine cDNA, RI...	70	6e-09
56	ref|XM_478632.1| Oryza sativa (japonica cultivar-group), mRNA	68	3e-08
57	emb|CR673199.2|CNS0FIET Tetraodon nigroviridis full-length cDNA	68	3e-08
58	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	68	3e-08
59	dbj|AP003838.3| Oryza sativa (japonica cultivar-group) genomic D...	68	3e-08
60	dbj|AK099888.1| Oryza sativa (japonica cultivar-group) cDNA clon...	68	3e-08
61	dbj|AK071511.1| Oryza sativa (japonica cultivar-group) cDNA clon...	68	3e-08
62	dbj|AK058913.1| Oryza sativa (japonica cultivar-group) cDNA clon...	68	3e-08
63	dbj|AK058540.1| Oryza sativa (japonica cultivar-group) cDNA clon...	68	3e-08
64	emb|AL731753.2|CNS08C82 Oryza sativa chromosome 12, . BAC OJ1112...	68	3e-08
65	ref|NM_178185.1| Mus musculus histone 1, H2ao (Hist1h2ao), mRNA	66	1e-07
66	gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, co...	66	1e-07
67	ref|NG_002734.1| Mus musculus histone 1, H2aj (Hist1h2aj) pseudo...	66	1e-07
68	ref|XM_545430.1| PREDICTED: Canis familiaris similar to Histone ...	66	1e-07
69	ref|XM_849168.1| PREDICTED: Canis familiaris similar to Histone ...	66	1e-07
70	ref|XM_545413.1| PREDICTED: Canis familiaris similar to Histone ...	66	1e-07
71	ref|XM_545411.1| PREDICTED: Canis familiaris similar to Histone ...	66	1e-07
72	ref|XM_545400.2| PREDICTED: Canis familiaris similar to Histone ...	66	1e-07
73	ref|XM_545394.2| PREDICTED: Canis familiaris similar to Histone ...	66	1e-07
74	ref|XM_848774.1| PREDICTED: Canis familiaris similar to Histone ...	66	1e-07
75	ref|XM_848759.1| PREDICTED: Canis familiaris similar to Histone ...	66	1e-07
76	ref|XM_545384.2| PREDICTED: Canis familiaris similar to Histone ...	66	1e-07
77	ref|XM_848716.1| PREDICTED: Canis familiaris similar to Histone ...	66	1e-07
78	ref|XM_545376.2| PREDICTED: Canis familiaris similar to Histone ...	66	1e-07
79	ref|XM_545373.1| PREDICTED: Canis familiaris similar to histone ...	66	1e-07
80	ref|XM_854341.1| PREDICTED: Canis familiaris similar to Histone ...	66	1e-07
81	ref|XM_545390.1| PREDICTED: Canis familiaris similar to Histone ...	66	1e-07
82	ref|XM_978341.1| PREDICTED: Mus musculus similar to histone 2a, ...	66	1e-07
83	ref|XM_978296.1| PREDICTED: Mus musculus similar to histone 2a, ...	66	1e-07
84	ref|XM_539322.1| PREDICTED: Canis familiaris similar to Histone ...	66	1e-07
85	gb|BC058544.1| Mus musculus cDNA clone IMAGE:5711765, with appar...	66	1e-07
86	emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143	66	1e-07
87	emb|X59962.1|RNTH2AB R.norvegicus genes for TH2A and TH2B histones	66	1e-07
88	emb|X59961.1|RNH2AB R.norvegicus genes for H2A and H2B histones	66	1e-07
89	emb|X05863.1|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B)	66	1e-07
90	emb|X05862.1|MMHIS2BA Mouse H2B and H2A histone genes (291A)	66	1e-07
91	gb|BC099406.1| Mus musculus histone 1, H2ac, mRNA (cDNA clone MG...	66	1e-07
92	emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chr...	66	1e-07
93	ref|NM_178189.2| Mus musculus histone 1, H2ac (Hist1h2ac), mRNA	66	1e-07
94	emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chr...	66	1e-07
95	emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chrom...	66	1e-07
96	emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chr...	66	1e-07
97	emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chr...	66	1e-07
98	gb|BC065803.1| Mus musculus histone 1, H2ag, mRNA (cDNA clone MG...	66	1e-07
99	gb|BC076498.1| Mus musculus histone 1, H2ae, mRNA (cDNA clone MG...	66	1e-07
100	dbj|AK145443.1| Mus musculus 5 days embryo whole body cDNA, RIKE...	66	1e-07
101	dbj|AK146117.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length...	66	1e-07
102	dbj|AK146846.1| Mus musculus 17 days embryo heart cDNA, RIKEN fu...	66	1e-07
103	ref|NM_175660.2| Mus musculus histone 1, H2ab (Hist1h2ab), mRNA	66	1e-07
104	gb|BC090402.1| Mus musculus cDNA clone MGC:103288 IMAGE:5150365,...	66	1e-07
105	gb|BC062251.1| Mus musculus cDNA clone MGC:73635 IMAGE:1224905, ...	66	1e-07
106	gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016	66	1e-07
107	gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108	66	1e-07
108	ref|NM_178186.2| Mus musculus histone 1, H2ag (Hist1h2ag), mRNA	66	1e-07
109	ref|NM_178187.2| Mus musculus histone 1, H2ae (Hist1h2ae), mRNA	66	1e-07
110	ref|NM_178188.3| Mus musculus histone 1, H2ad (Hist1h2ad), mRNA	66	1e-07
111	gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone...	66	1e-07
112	dbj|AK028026.1| Mus musculus 18-day embryo whole body cDNA, RIKE...	66	1e-07
113	dbj|AK033518.1| Mus musculus adult male colon cDNA, RIKEN full-l...	66	1e-07
114	ref|NM_021839.1| Rattus norvegicus testis-specific histone 2a (H...	66	1e-07
115	ref|NM_178183.1| Mus musculus histone 1, H2ak (Hist1h2ak), mRNA	66	1e-07
116	ref|NM_178182.1| Mus musculus histone 1, H2ai (Hist1h2ai), mRNA	66	1e-07
117	gb|AY158920.1| Mus musculus histone protein Hist1h2ab gene, comp...	66	1e-07
118	gb|AY158919.1| Mus musculus histone protein Hist1h2ac gene, comp...	66	1e-07
119	gb|AY158918.1| Mus musculus histone protein Hist1h2ad gene, comp...	66	1e-07
120	gb|AY158917.1| Mus musculus histone protein Hist1h2ae gene, comp...	66	1e-07
121	gb|AY158915.1| Mus musculus histone protein Hist1h2ag gene, comp...	66	1e-07
122	gb|AY158914.1| Mus musculus histone protein Hist1h2ah gene, comp...	66	1e-07
123	gb|AY158913.1| Mus musculus histone protein Hist1h2ao gene, comp...	66	1e-07
124	gb|AY158911.1| Mus musculus histone protein Hist1h2ak gene, comp...	66	1e-07
125	gb|AY158910.1| Mus musculus histone protein Hist1h2aj pseudogene...	66	1e-07
126	gb|AY158909.1| Mus musculus histone protein Hist1h2ai gene, comp...	66	1e-07
127	ref|NM_175659.1| Mus musculus histone 1, H2ah (Hist1h2ah), mRNA	66	1e-07
128	gb|U95111.1|MSU95111 Mus spretus histone H2a pseudogene, complet...	66	1e-07
129	gb|M33988.1|MUSH2AX1 Mouse histone H2A.1 gene, complete cds	66	1e-07
130	gb|M37736.1|MUSHIS2AR Mouse replication-dependent histone H2A.1 ...	66	1e-07
131	gb|BC106331.1| Xenopus laevis cDNA clone MGC:130860 IMAGE:720558...	64	4e-07
132	gb|AF377946.3| Oryza sativa (japonica cultivar-group) chromosome...	64	4e-07
133	gb|AC146936.4| Oryza sativa (japonica cultivar-group) chromosome...	64	4e-07
134	gb|AC147426.2| Oryza sativa chromosome 3 B1377B10 genomic seque...	64	4e-07
135	ref|XM_868674.1| PREDICTED: Bos taurus similar to Histone H2A.1 ...	64	4e-07
136	ref|XM_543796.2| PREDICTED: Canis familiaris similar to H2A hist...	64	4e-07
137	emb|X94693.1|TAH2A254 T.aestivum histone H2A gene	64	4e-07
138	emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A...	64	4e-07
139	gb|L75824.1|WHTHIH2AA Triticum aestivum histone H2A gene, comple...	64	4e-07
140	ref|XM_576399.1| PREDICTED: Rattus norvegicus similar to Histone...	64	4e-07
141	dbj|AK064299.1| Oryza sativa (japonica cultivar-group) cDNA clon...	64	4e-07
142	gb|U70133.1|BBU70133 Bufo bufo gagarizans replication-dependent ...	64	4e-07
143	gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 gene...	64	4e-07
144	ref|NM_021840.2| Rattus norvegicus histone 2a (H2a), mRNA	62	2e-06
145	ref|XM_478633.1| Oryza sativa (japonica cultivar-group), mRNA	62	2e-06
146	gb|BC099140.1| Rattus norvegicus histone 2a, mRNA (cDNA clone MG...	62	2e-06
147	emb|BX063165.1|CNS09KWH Single read from an extremity of a full-...	62	2e-06
148	emb|BX063164.1|CNS09KWG Single read from an extremity of a full-...	62	2e-06
149	emb|BX040864.1|CNS093P0 Single read from an extremity of a full-...	62	2e-06
150	emb|BX019683.1|CNS08NCN Single read from an extremity of a full-...	62	2e-06
151	emb|BX016452.1|CNS08KUW Single read from an extremity of a full-...	62	2e-06
152	emb|BX016451.1|CNS08KUV Single read from an extremity of a full-...	62	2e-06
153	emb|BX009846.1|CNS08FRE Single read from an extremity of a full-...	62	2e-06
154	ref|XM_225386.2| PREDICTED: Rattus norvegicus histone 1, H2an (p...	62	2e-06
155	ref|XM_551996.1| Anopheles gambiae str. PEST ENSANGP00000029020 ...	62	2e-06
156	ref|XM_314447.2| Anopheles gambiae str. PEST ENSANGP00000016040 ...	62	2e-06
157	ref|XM_306256.1| Anopheles gambiae str. PEST ENSANGP00000000004 ...	62	2e-06
158	dbj|AK059228.1| Oryza sativa (japonica cultivar-group) cDNA clon...	62	2e-06
159	emb|X14730.1|CMHIST2A Duck H2A histone gene	60	6e-06
160	emb|X02622.1|MMHISHSA Mouse gene fragment for histone H2a	60	6e-06
161	gb|AY158916.1| Mus musculus histone protein Hist1h2af gene, comp...	60	6e-06
162	ref|NM_175661.1| Mus musculus histone 1, H2af (Hist1h2af), mRNA	60	6e-06
163	gb|U95112.1|MCU95112 Mus caroli histone H2a pseudogene, complete...	60	6e-06
164	ref|NM_178218.2| Mus musculus histone 3, H2a (Hist3h2a), mRNA	58	2e-05
165	ref|XM_425469.1| PREDICTED: Gallus gallus similar to histone 2, ...	58	2e-05
166	ref|XM_425465.1| PREDICTED: Gallus gallus similar to histone 2, ...	58	2e-05
167	ref|XM_425459.1| PREDICTED: Gallus gallus similar to histone 2, ...	58	2e-05
168	ref|XM_425455.1| PREDICTED: Gallus gallus similar to histone 2, ...	58	2e-05
169	ref|XM_416195.1| PREDICTED: Gallus gallus similar to histone 2, ...	58	2e-05
170	ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone pro...	58	2e-05
171	ref|XM_416192.1| PREDICTED: Gallus gallus similar to germinal hi...	58	2e-05
172	gb|BC063781.1| Mus musculus histone 3, H2a, mRNA (cDNA clone MGC...	58	2e-05
173	gb|BC058119.1| Mus musculus histone 3, H2a, mRNA (cDNA clone IMA...	58	2e-05
174	emb|BX007458.1|CNS08DX2 Single read from an extremity of a full-...	58	2e-05
175	emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4...	58	2e-05
176	emb|V00413.1|GGH2AX Chicken gene for histone H2A with flanking r...	58	2e-05
177	ref|XM_694570.1| PREDICTED: Danio rerio similar to histone H2A (...	58	2e-05
178	dbj|AK077568.1| Mus musculus 8 days embryo whole body cDNA, RIKE...	58	2e-05
179	dbj|AK051448.1| Mus musculus 12 days embryo spinal ganglion cDNA...	58	2e-05
180	dbj|AK087537.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f...	58	2e-05
181	dbj|AK015962.1| Mus musculus adult male testis cDNA, RIKEN full-...	58	2e-05
182	dbj|AK083155.1| Mus musculus adult male hippocampus cDNA, RIKEN ...	58	2e-05
183	dbj|AK082083.1| Mus musculus 0 day neonate cerebellum cDNA, RIKE...	58	2e-05
184	ref|NM_178184.1| Mus musculus histone 1, H2an (Hist1h2an), mRNA	58	2e-05
185	gb|AY158926.1| Mus musculus histone protein Hist3h2a gene, compl...	58	2e-05
186	gb|AY158912.1| Mus musculus histone protein Hist1h2an gene, comp...	58	2e-05
187	dbj|D11055.1|CHKH2A4H Gallus gallus gene for H2A histone, comple...	58	2e-05
188	gb|U38933.1|GGU38933 Gallus gallus histone H2A (H2A-VIII) gene, ...	58	2e-05
189	gb|U38932.1|GGU38932 Gallus gallus histone H2A (H2A-VII) gene, c...	58	2e-05
190	gb|U38931.1|GGU38931 Gallus gallus histone H2A (H2A-VI) gene, co...	58	2e-05
191	emb|AL662809.14| Mouse DNA sequence from clone RP23-441I8 on chr...	58	2e-05
192	gb|U95110.1|MMU95110 Mus macedonicus histone H2a pseudogene, com...	58	2e-05
193	gb|U95109.1|MSU95109 Mus spicilegus histone H2a pseudogene, comp...	58	2e-05
194	gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histo...	58	2e-05
195	gb|J00864.1|CHKH2A2B Chicken histone H2A/H2B gene pair and flanks	58	2e-05
196	gb|DQ214188.1| Taeniopygia guttata clone 0058P0024E05 histone 1 ...	56	1e-04
197	gb|DQ214187.1| Taeniopygia guttata clone 0058P0044E04 histone 1 ...	56	1e-04
198	ref|XM_865148.1| PREDICTED: Bos taurus similar to Histone H2A.1 ...	56	1e-04
199	ref|XM_545421.1| PREDICTED: Canis familiaris similar to Histone ...	56	1e-04
200	ref|XM_545419.2| PREDICTED: Canis familiaris similar to Histone ...	56	1e-04
201	ref|XM_848163.1| PREDICTED: Canis familiaris similar to Histone ...	56	1e-04
202	ref|XM_692742.1| PREDICTED: Danio rerio similar to H2A histone f...	56	1e-04
203	emb|BX933556.1| Gallus gallus finished cDNA, clone ChEST42h4	56	1e-04
204	gb|AY104828.1| Zea mays PCO072413 mRNA sequence	56	1e-04
205	dbj|D38091.1|WHTPH2AE Triticum aestivum mRNA for protein H2A, co...	56	1e-04
206	dbj|D38089.1|WHTPH2AC Triticum aestivum mRNA for protein H2A, co...	56	1e-04
207	emb|BX008487.1|CNS08EPN Single read from an extremity of a full-...	54	4e-04
208	ref|XM_577573.1| PREDICTED: Rattus norvegicus similar to Histone...	54	4e-04
209	gb|AY109370.1| Zea mays CL2029_4 mRNA sequence	54	4e-04
210	gb|BC107354.1| Mus musculus histone 1, H2aa, mRNA (cDNA clone MG...	52	0.002
211	gb|BC107355.1| Mus musculus histone 1, H2aa, mRNA (cDNA clone MG...	52	0.002
212	ref|NM_175658.1| Mus musculus histone 1, H2aa (Hist1h2aa), mRNA	52	0.002
213	gb|AY389588.1| Hyacinthus orientalis histone H2A mRNA, complete cds	52	0.002
214	emb|X01064.1|SGHIS2A3 Rainbow trout histone H2A and H3 genes	52	0.002
215	emb|AL606464.11| Mouse DNA sequence from clone RP23-462P2 on chr...	52	0.002
216	gb|AY158921.1| Mus musculus histone protein Hist1h2aa gene, comp...	52	0.002
217	ref|XM_525084.1| PREDICTED: Pan troglodytes similar to Histone H...	50	0.006
218	gb|BC001193.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC...	50	0.006
219	gb|BC082269.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC...	50	0.006
220	ref|XM_425467.1| PREDICTED: Gallus gallus similar to histone 2, ...	50	0.006
221	ref|NM_033445.2| Homo sapiens histone 3, H2a (HIST3H2A), mRNA	50	0.006
222	ref|XM_545426.2| PREDICTED: Canis familiaris similar to Histone ...	50	0.006
223	emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chr...	50	0.006
224	ref|NM_001030753.1| Gallus gallus histone H2A (H2A-IX), mRNA	50	0.006
225	ref|NM_001024282.1| Rattus norvegicus Histone H2a (predicted) (R...	50	0.006
226	ref|XM_683938.1| PREDICTED: Danio rerio similar to histone H2A (...	50	0.006
227	ref|XM_694138.1| PREDICTED: Danio rerio similar to histone H2A (...	50	0.006
228	ref|XM_688696.1| PREDICTED: Danio rerio similar to histone H2A (...	50	0.006
229	gb|AC146538.2| Gasterosteus aculeatus clone CH213-118G22, comple...	50	0.006
230	gb|BC093343.1| Danio rerio MID1 interacting protein 1, mRNA (cDN...	50	0.006
231	dbj|D11054.1|CHKH2A3H Gallus gallus gene for H2A histone, comple...	50	0.006
232	gb|U38934.1|GGU38934 Gallus gallus histone H2A (H2A-IX) gene, co...	50	0.006
233	emb|CR354435.20| Zebrafish DNA sequence from clone CH211-113A14 ...	50	0.006
234	gb|U95113.1|RNU95113 Rattus norvegicus histone H2a gene, complet...	50	0.006
235	gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-I...	50	0.006
236	gb|AY131974.1| Homo sapiens histone H2A (HIST3H2A) gene, complet...	50	0.006
237	ref|XM_522264.1| PREDICTED: Pan troglodytes similar to Histone H...	48	0.024
238	ref|XM_527249.1| PREDICTED: Pan troglodytes similar to H2A histo...	48	0.024
239	ref|NM_006632.1| Homo sapiens solute carrier family 17 (sodium p...	48	0.024
240	ref|NM_013549.1| Mus musculus histone 2, H2aa1 (Hist2h2aa1), mRNA	48	0.024
241	gb|BC077427.1| Xenopus laevis MGC82198 protein, mRNA (cDNA clone...	48	0.024
242	gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339	48	0.024
243	ref|XM_870470.1| PREDICTED: Bos taurus similar to Histone H2A.1 ...	48	0.024
244	gb|BC004915.2| Homo sapiens H2A histone family, member X, mRNA (...	48	0.024
245	gb|BC010564.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone I...	48	0.024
246	ref|XM_607721.2| PREDICTED: Bos taurus similar to Histone H2A.1 ...	48	0.024
247	ref|XM_865976.1| PREDICTED: Bos taurus similar to Histone H2A.g ...	48	0.024
248	ref|XM_981616.1| PREDICTED: Mus musculus similar to H2A histone ...	48	0.024
249	ref|XM_992084.1| PREDICTED: Mus musculus similar to H2A histone ...	48	0.024
250	ref|XM_994730.1| PREDICTED: Mus musculus similar to H2A histone ...	48	0.024
251	ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h...	48	0.024
252	gb|BC064002.1| Mus musculus cDNA clone IMAGE:6823756, partial cds	48	0.024
253	ref|XM_540292.2| PREDICTED: Canis familiaris similar to histone ...	48	0.024
254	ref|XM_845715.1| PREDICTED: Canis familiaris similar to Histone ...	48	0.024
255	ref|XM_540286.2| PREDICTED: Canis familiaris similar to Histone ...	48	0.024
256	ref|NM_002105.2| Homo sapiens H2A histone family, member X (H2AF...	48	0.024
257	emb|AL138726.12| Human DNA sequence from clone RP1-139G21 on chr...	48	0.024
258	emb|Z30940.1|MDH2AHIST M.domesticus (CD-1) mRNA for histone H2A ...	48	0.024
259	emb|X80330.1|CLH2A232 C.longicaudatus genes for histones H2a.2 a...	48	0.024
260	emb|X16148.1|MMHIS2A3 Mouse H2a and H3 histone genes	48	0.024
261	emb|X14850.1|HSH2AX Human H2A.X mRNA encoding histone H2A.X	48	0.024
262	emb|CR457079.1| Homo sapiens full open reading frame cDNA clone ...	48	0.024
263	gb|BC013416.2| Homo sapiens H2A histone family, member X, mRNA (...	48	0.024
264	emb|CR605072.1| full-length cDNA clone CS0DD007YB20 of Neuroblas...	48	0.024
265	gb|AF098457.1|AF098457 Homo sapiens H2A/t pseudogene, complete s...	48	0.024
266	gb|U90545.1|HSU90545 Human sodium phosphate transporter (NPT4) m...	48	0.024
267	ref|XM_693555.1| PREDICTED: Danio rerio similar to histone H2A (...	48	0.024
268	ref|XM_693436.1| PREDICTED: Danio rerio similar to histone H2A (...	48	0.024
269	dbj|AK006728.1| Mus musculus adult male testis cDNA, RIKEN full-...	48	0.024
270	dbj|AK077055.1| Mus musculus adult male testis cDNA, RIKEN full-...	48	0.024
271	dbj|AK002725.1| Mus musculus adult male kidney cDNA, RIKEN full-...	48	0.024
272	dbj|AK016171.1| Mus musculus adult male testis cDNA, RIKEN full-...	48	0.024
273	gb|U62674.1|MMU62674 Mus musculus histone H2a.2-615 (H2a-615), ...	48	0.024
274	dbj|AK028129.1| Mus musculus adult male stomach cDNA, RIKEN full...	48	0.024
275	ref|NG_002685.1| Homo sapiens histone 1, H2a, pseudogene 2 (HIST...	48	0.024
276	gb|BC092032.1| Xenopus laevis hypothetical protein MGC83508, mRN...	48	0.024
277	gb|DQ015918.1| Homo sapiens H2A histone family, member X (H2AFX)...	48	0.024
278	ref|NM_178212.1| Mus musculus histone 2, H2aa2 (Hist2h2aa2), mRNA	48	0.024
279	ref|XM_345255.2| PREDICTED: Rattus norvegicus histone 2, H2aa (p...	48	0.024
280	ref|XM_574998.1| PREDICTED: Rattus norvegicus similar to Hist2h2...	48	0.024
281	ref|XM_574997.1| PREDICTED: Rattus norvegicus similar to histone...	48	0.024
282	gb|AY158953.1| Mus musculus histone protein Hist2h3c2 gene, comp...	48	0.024
283	gb|AY158925.1| Mus musculus histone protein Hist2h2aa1 gene, com...	48	0.024
284	gb|AY158924.1| Mus musculus histone protein Hist2h2aa2 gene, com...	48	0.024
285	gb|BC062255.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone M...	48	0.024
286	gb|BC011694.2| Homo sapiens H2A histone family, member X, mRNA (...	48	0.024
287	gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, comp...	48	0.024
288	gb|AY104826.1| Zea mays PCO099353 mRNA sequence	48	0.024
289	dbj|AP003391.1| Homo sapiens genomic DNA, chromosome 11q clone:C...	48	0.024
290	gb|AC157656.3| Mus musculus BAC clone RP23-406A5 from chromosome...	48	0.024
291	gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, comple...	48	0.024
292	gb|BC053966.1| Mus musculus histone 2, H2aa2, mRNA (cDNA clone I...	48	0.024
293	ref|XM_667061.1| Plasmodium berghei strain ANKA histone h2a (PB3...	48	0.024
294	gb|BC089519.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone M...	48	0.024
295	gb|U16726.1|CRU16726 Chlamydomonas reinhardtii histone H1 (ch1),...	48	0.024
296	gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-I...	48	0.024
297	gb|J00950.1|NVIHIS2A Newt histone H2a gene, partial	48	0.024
298	gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, c...	48	0.024
299	gb|AC160122.2| Mus musculus BAC clone RP23-390G1 from chromosome...	48	0.024
300	ref|XM_520760.1| PREDICTED: Pan troglodytes similar to H2A histo...	46	0.094
301	ref|XM_474362.1| Oryza sativa (japonica cultivar-group), predic...	46	0.094
302	ref|NM_001030332.2| Xenopus tropicalis hypothetical protein LOC5...	46	0.094
303	ref|NM_001030325.2| Xenopus tropicalis hypothetical protein LOC5...	46	0.094
304	gb|BC074601.1| Xenopus tropicalis MGC69325 protein, mRNA (cDNA c...	46	0.094
305	gb|AY389592.1| Hyacinthus orientalis histone H2A mRNA, complete cds	46	0.094
306	gb|BC003602.1| Homo sapiens H2A histone family, member J, transc...	46	0.094
307	ref|XM_870822.1| PREDICTED: Bos taurus similar to H2A histone fa...	46	0.094
308	ref|NM_177688.2| Mus musculus H2A histone family, member J (H2af...	46	0.094
309	ref|XM_652790.1| Aspergillus nidulans FGSC A4 hypothetical prote...	46	0.094
310	ref|NM_177925.1| Homo sapiens H2A histone family, member J (H2AF...	46	0.094
311	ref|XM_906486.2| PREDICTED: Mus musculus similar to H2A histone ...	46	0.094
312	ref|XR_003029.1| PREDICTED: Mus musculus similar to H2A histone ...	46	0.094
313	ref|XR_001920.1| PREDICTED: Mus musculus similar to H2A histone ...	46	0.094
314	emb|CT025304.2| Xenopus tropicalis finished cDNA, clone TNeu074k04	46	0.094
315	gb|AC122804.4| Mus musculus BAC clone RP23-296J10 from 6, comple...	46	0.094
316	gb|AC123686.11| Mus musculus chromosome 5, clone RP23-301L9, com...	46	0.094
317	emb|AL606456.2|OSJN00017 Oryza sativa genomic DNA, chromosome 4,...	46	0.094
318	gb|BC103043.1| Bos taurus cDNA clone MGC:128401 IMAGE:7983967, c...	46	0.094
319	emb|CR625218.1| full-length cDNA clone CS0DI023YM11 of Placenta ...	46	0.094
320	gb|AC010168.6| Homo sapiens 12p12-31.7-32.2 BAC RP11-174G6 (Rose...	46	0.094
321	ref|XM_687955.1| PREDICTED: Danio rerio similar to histone H2A (...	46	0.094
322	ref|XM_686987.1| PREDICTED: Danio rerio similar to replication-d...	46	0.094
323	dbj|AK053755.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f...	46	0.094
324	ref|NM_001004821.1| Xenopus tropicalis MGC69325 protein (MGC6932...	46	0.094
325	ref|XM_225372.2| PREDICTED: Rattus norvegicus similar to Histone...	46	0.094
326	gb|AY108339.1| Zea mays PCO070432 mRNA sequence	46	0.094
327	emb|AL732353.1| Oryza sativa genomic DNA, chromosome 4, BAC clon...	46	0.094
328	emb|CR762147.2| Xenopus tropicalis finished cDNA, clone TGas072e19	46	0.094
329	emb|CR761789.2| Xenopus tropicalis finished cDNA, clone TGas125k04	46	0.094
330	gb|BC099606.1| Mus musculus H2A histone family, member J, mRNA (...	46	0.094
331	gb|BC024397.1| Mus musculus H2A histone family, member J, mRNA (...	46	0.094
332	emb|AL133626.1|HSM801493 Homo sapiens mRNA; cDNA DKFZp434K0522 (...	46	0.094
333	ref|XM_527262.1| PREDICTED: Pan troglodytes similar to histone p...	44	0.37
334	ref|NM_175662.1| Mus musculus histone 2, H2ac (Hist2h2ac), mRNA	44	0.37
335	ref|NM_001040642.1| Gallus gallus similar to Histone H1.2 (H1d) ...	44	0.37
336	ref|XM_602496.2| PREDICTED: Bos taurus similar to Histone H2A.1 ...	44	0.37
337	ref|XM_871147.1| PREDICTED: Bos taurus similar to Histone H2A.1 ...	44	0.37
338	ref|XM_869001.1| PREDICTED: Bos taurus similar to Histone H2A.1 ...	44	0.37
339	ref|XM_868899.1| PREDICTED: Bos taurus similar to Histone H2A.1 ...	44	0.37
340	ref|NG_001335.1| Homo sapiens genomic large histone family clust...	44	0.37
341	ref|NM_178213.2| Mus musculus histone 2, H2ab (Hist2h2ab), mRNA	44	0.37
342	ref|NM_021052.2| Homo sapiens histone 1, H2ae (HIST1H2AE), mRNA	44	0.37
343	gb|AY812081.1| Schistosoma japonicum SJCHGC05779 protein mRNA, p...	44	0.37
344	gb|AY223124.1| Schistosoma japonicum clone ZZD1425 mRNA sequence	44	0.37
345	gb|AY158922.2| Mus musculus histone protein Hist2h2ab gene, comp...	44	0.37
346	emb|AL031777.5|HS34B20 Human DNA sequence from clone RP1-34B20 o...	44	0.37
347	emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23	44	0.37
348	emb|X01752.1|GGHISH1 Chicken histone H1 gene	44	0.37
349	emb|AJ494852.1|ODI494852 Oikopleura dioica partial H2A.4 gene fo...	44	0.37
350	dbj|AB168678.1| Macaca fascicularis testis cDNA clone: QtsA-1409...	44	0.37
351	gb|U62673.1|MMU62673 Mus musculus histone H2a(A)-613, histone H2...	44	0.37
352	gb|BC093862.1| Homo sapiens histone 1, H2ae, mRNA (cDNA clone MG...	44	0.37
353	gb|BC093836.1| Homo sapiens histone 1, H2ae, mRNA (cDNA clone MG...	44	0.37
354	dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co...	44	0.37
355	gb|AY158923.1| Mus musculus histone protein Hist2h2ac gene, comp...	44	0.37
356	gb|M60752.1|HUMHISAG Human histone H2A.1 (H2A) gene, complete cds	44	0.37
357	gb|AY131986.1| Homo sapiens histone H2A (HIST1H2AE) gene, comple...	44	0.37
358	ref|XM_603142.2| PREDICTED: Bos taurus similar to histone 1, H2a...	42	1.5
359	ref|XM_610233.2| PREDICTED: Bos taurus similar to Histone H2AFX ...	42	1.5
360	ref|NM_018267.2| Homo sapiens H2A histone family, member J (H2AF...	42	1.5
361	gb|CP000271.1| Burkholderia xenovorans LB400 chromosome 2, compl...	42	1.5
362	gb|AF517874.1| Griffithsia japonica isolate Gj10 histone protein...	42	1.5
363	ref|XM_792460.1| PREDICTED: Strongylocentrotus purpuratus simila...	42	1.5
364	gb|DQ397869.1| Cenarchaeum symbiosum clone C04C05, complete sequ...	42	1.5
365	dbj|AK001765.1| Homo sapiens cDNA FLJ10903 fis, clone OVARC10000...	42	1.5
366	ref|XM_684593.1| PREDICTED: Danio rerio similar to histone H2A (...	42	1.5
367	ref|XM_683706.1| PREDICTED: Danio rerio similar to histone H2A (...	42	1.5
368	ref|XM_683060.1| PREDICTED: Danio rerio similar to replication-d...	42	1.5
369	ref|XM_694133.1| PREDICTED: Danio rerio similar to replication-d...	42	1.5
370	ref|XM_688274.1| PREDICTED: Danio rerio similar to histone H2A (...	42	1.5
371	gb|AF315728.1|AF315728 Carassius auratus gibelio histone H2A mRN...	42	1.5
372	gb|AY760064.1| Muntiacus muntjak vaginalis H2A histone family me...	42	1.5
373	ref|XM_344599.2| PREDICTED: Rattus norvegicus histone 1, H2ao (p...	42	1.5
374	ref|XM_318365.1| Anopheles gambiae str. PEST ENSANGP00000015967 ...	42	1.5
375	ref|XM_307083.1| Anopheles gambiae str. PEST ENSANGP00000012043 ...	42	1.5
376	ref|XM_511661.1| PREDICTED: Pan troglodytes similar to Galectin-...	40	5.8
377	ref|XM_482082.1| Oryza sativa (japonica cultivar-group), mRNA	40	5.8
378	ref|XM_527281.1| PREDICTED: Pan troglodytes similar to H2A histo...	40	5.8
379	ref|XM_518299.1| PREDICTED: Pan troglodytes similar to Histone H...	40	5.8
380	gb|BT016168.1| Zea mays clone Contig1 mRNA sequence	40	5.8
381	gb|AY730593.1| Salmonella enterica subsp. enterica serovar Urban...	40	5.8
382	gb|BT023909.1| Drosophila melanogaster GH04784 full insert cDNA	40	5.8
383	gb|AY389715.1| Hyacinthus orientalis histone H2A-like protein mR...	40	5.8
384	gb|BC062305.1| Homo sapiens cDNA clone IMAGE:3162462	40	5.8
385	ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@...	40	5.8
386	ref|NM_021066.2| Homo sapiens histone 1, H2aj (HIST1H2AJ), mRNA	40	5.8
387	ref|NM_003509.2| Homo sapiens histone 1, H2ai (HIST1H2AI), mRNA	40	5.8
388	gb|BC066234.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM...	40	5.8
389	gb|BC066232.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM...	40	5.8
390	gb|BC066233.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM...	40	5.8
391	gb|BC066237.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM...	40	5.8
392	gb|BC066236.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM...	40	5.8
393	gb|BC066235.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM...	40	5.8
394	gb|AY232048.1| Drosophila yakuba clone yak-ad_RpS6 mRNA sequence	40	5.8
395	gb|AY231781.1| Drosophila yakuba clone yak-em_RpS6 mRNA sequence	40	5.8
396	ref|XM_856111.1| PREDICTED: Canis familiaris similar to Core his...	40	5.8
397	ref|XM_856079.1| PREDICTED: Canis familiaris similar to Core his...	40	5.8
398	ref|XM_845205.1| PREDICTED: Canis familiaris similar to Core his...	40	5.8
399	ref|XM_856021.1| PREDICTED: Canis familiaris similar to Core his...	40	5.8
400	ref|XM_546142.2| PREDICTED: Canis familiaris similar to Core his...	40	5.8
401	ref|XM_855966.1| PREDICTED: Canis familiaris similar to Core his...	40	5.8
402	ref|NM_001024396.1| Danio rerio zgc:110434 (zgc:110434), mRNA	40	5.8
403	gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome	40	5.8
404	emb|AL050344.31|HSJ799D16 Human DNA sequence from clone RP4-799D...	40	5.8
405	emb|AL049822.30|HSJ160A22 Human DNA sequence from clone RP1-160A...	40	5.8
406	emb|AL009179.1|HS97D16 Human DNA sequence from clone RP1-97D16 o...	40	5.8
407	gb|AC137931.3| Oryza sativa (japonica cultivar-group) chromosome...	40	5.8
408	ref|XM_967564.1| PREDICTED: Tribolium castaneum similar to CG435...	40	5.8
409	ref|XM_962318.1| PREDICTED: Tribolium castaneum similar to H2A h...	40	5.8
410	emb|Z83742.1|HSZ83742 H.sapiens hH2A/c gene	40	5.8
411	emb|Z83736.1|HSZ83736 H.sapiens hH2A/e gene	40	5.8
412	gb|AE008793.1| Salmonella typhimurium LT2, section 97 of 220 of ...	40	5.8
413	emb|BX572603.1| Rhodopseudomonas palustris CGA009 complete genom...	40	5.8
414	emb|AL627273.1| Salmonella enterica serovar Typhi (Salmonella ty...	40	5.8
415	gb|AC118670.2| Genomic sequence for Oryza sativa, Nipponbare sta...	40	5.8
416	gb|AC103809.2| Homo sapiens chromosome 17, clone RP11-647F2, com...	40	5.8
417	ref|NM_167136.1| Drosophila melanogaster Ribosomal protein S6 CG...	40	5.8
418	ref|NM_167135.2| Drosophila melanogaster Ribosomal protein S6 CG...	40	5.8
419	ref|NM_078518.2| Drosophila melanogaster Ribosomal protein S6 CG...	40	5.8
420	gb|AC109643.1| Caenorhabditis briggsae cosmid CB033F17, complete...	40	5.8
421	ref|XM_940760.1| PREDICTED: Homo sapiens similar to Galectin-3 b...	40	5.8
422	ref|XM_371078.2| PREDICTED: Homo sapiens similar to Galectin-3 b...	40	5.8
423	gb|AY058620.1| Drosophila melanogaster LD31286 full length cDNA	40	5.8
424	gb|BC095260.1| Danio rerio zgc:110434, mRNA (cDNA clone MGC:1104...	40	5.8
425	gb|AE006470.1| Chlorobium tepidum TLS, complete genome	40	5.8
426	gb|AY012199.1| Salmonella enterica subsp. VI isolate M324 GDP-ma...	40	5.8
427	gb|AY012198.1| Salmonella enterica subsp. I isolate M286 GDP-man...	40	5.8
428	gb|AY012195.1| Salmonella enterica subsp. VI isolate M326 GDP-ma...	40	5.8
429	gb|AY012192.1| Salmonella enterica subsp. I isolate M258 GDP-man...	40	5.8
430	gb|AY012187.1| Salmonella enterica subsp. I isolate M273 GDP-man...	40	5.8
431	gb|AY012186.1| Salmonella enterica subsp. I isolate M264 GDP-man...	40	5.8
432	gb|AY012185.1| Salmonella enterica subsp. IV isolate M1654 phosp...	40	5.8
433	gb|AY012184.1| Salmonella enterica subsp. IIIa isolate M1651 pho...	40	5.8
434	gb|AY012182.1| Salmonella enterica subsp. IIIb isolate M1653 pho...	40	5.8
435	gb|AY012181.1| Salmonella enterica subsp. I isolate M1646 phosph...	40	5.8
436	gb|AY012180.1| Salmonella enterica subsp. VI isolate M324 GDP-ma...	40	5.8
437	gb|AY012177.1| Salmonella enterica subsp. I isolate M252 GDP-man...	40	5.8
438	gb|AY012176.1| Salmonella enterica subsp. I isolate M274 GDP-man...	40	5.8
439	gb|AY012175.1| Salmonella enterica subsp. I isolate M255 GDP-man...	40	5.8
440	gb|AY012174.1| Salmonella enterica subsp. I isolate M273 GDP-man...	40	5.8
441	gb|AY012173.1| Salmonella enterica subsp. I isolate M286 GDP-man...	40	5.8
442	gb|AY012172.1| Salmonella enterica subsp. I isolate M264 GDP-man...	40	5.8
443	gb|AY012171.1| Salmonella enterica subsp. VI isolate M326 phosph...	40	5.8
444	gb|AY012168.1| Salmonella enterica subsp. IV isolate M1655 phosp...	40	5.8
445	gb|AY012166.1| Salmonella enterica subsp. IIIa isolate M1651 pho...	40	5.8
446	gb|AY012165.1| Salmonella enterica subsp. IIIa isolate M1784 pho...	40	5.8
447	gb|AY012164.1| Salmonella enterica subsp. IIIa isolate M1639 pho...	40	5.8
448	gb|AC148038.3| Ovis aries clone CH243-361I2, complete sequence	40	5.8
449	gb|AY131990.1| Homo sapiens histone H2A (HIST1H2AJ) gene, comple...	40	5.8
450	gb|AY131989.1| Homo sapiens histone H2A (HIST1H2AI) gene, comple...	40	5.8
451	gb|AC055863.16| Homo sapiens chromosome 17, clone RP11-478P5, co...	40	5.8
452	gb|AC104512.11| Drosophila melanogaster BAC RP98-39C15 (Roswell...	40	5.8
453	gb|CP000026.1| Salmonella enterica subsp. enterica serovar Parat...	40	5.8
454	emb|BX119315.5| Zebrafish DNA sequence from clone CH211-215F22 i...	40	5.8
455	dbj|AP004397.3| Oryza sativa (japonica cultivar-group) genomic D...	40	5.8
456	dbj|AP003962.3| Oryza sativa (japonica cultivar-group) genomic D...	40	5.8
457	emb|X59886.1|STCPSBG S.enterica cpsB and cpsG genes for mannose-...	40	5.8
458	ref|XM_318363.2| Anopheles gambiae str. PEST ENSANGP00000015971 ...	40	5.8
459	dbj|AK107121.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	5.8
460	dbj|AK072348.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	5.8
461	gb|BC112256.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG...	40	5.8
462	gb|BC112254.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG...	40	5.8
463	emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple...	40	5.8
464	gb|AY105006.1| Zea mays PCO108932 mRNA sequence	40	5.8
465	gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi...	40	5.8
466	gb|L02074.1|DRORBS6 Drosophila melanogaster ribosomal protein S6...	40	5.8
467	gb|AE003442.3| Drosophila melanogaster chromosome X, section 26 ...	40	5.8
468	gb|AE017220.1| Salmonella enterica subsp. enterica serovar Chole...	40	5.8
469	gb|L01658.1|DRORPS6X Drosophila melanogaster ribosomal protein S...	40	5.8
470	gb|M84642.1|SERFBC1 Salmonella enterica group C1 rfb gene cluster	40	5.8
471	gb|L02075.1|DRORBSCS6 Drosophila melanogaster ribosomal protein ...	40	5.8
472	gb|M11085.1|SUPHIS2A2 Sea urchin (P.miliaris) late histone H2A-2...	40	5.8
473	gb|M11084.1|SUPHIS2A1 Sea urchin (P.miliaris) late histone H2A-1...	40	5.8
474	gb|M14140.1|SUPH2B2 P.miliaris histone H2A-2.1 gene, complete cds	40	5.8
475	gb|M14141.1|SUPH2A2 P.miliaris histone H2A-2.2 gene, complete cds	40	5.8
476	gb|L07881.1|DRORPS67BC Drosophila melanogaster ribosomal protein...	40	5.8
477	dbj|AB065914.1| Homo sapiens gene for seven transmembrane helix ...	40	5.8

---

>gb|AY103710.1| Zea mays PCO123562 mRNA sequence
          Length = 770

 Score =  222 bits (112), Expect = 7e-55
 Identities = 207/238 (86%), Gaps = 3/238 (1%)
 Strand = Plus / Minus

                                                                       
Query: 197 gccttcttgggggacttggcggccttcttgggcgacttgccctccttgggctcc---ttc 253
           ||||||||||||||||||||||||||||||||||||||| ||||||||| | ||   |||
Sbjct: 560 gccttcttgggggacttggcggccttcttgggcgacttggcctccttggccgccgccttc 501

                                                                       
Query: 254 tccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcg 313
           ||||||||| ||||||| || |||||||||||||||||||| || ||||||||||| |||
Sbjct: 500 tccgcggtcttcttgggcaggagcaccgggttgatgttggggaggacgccgccgtgggcg 441

                                                                       
Query: 314 atggtgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcagg 373
           ||||||||||||| ||||||| | |||||||||| |||||| |  | ||| ||||||| |
Sbjct: 440 atggtgacgccggacagcagcttgccgagctcctcgtcgttgcggatggcaaggagcacg 381

                                                                     
Query: 374 tgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctcca 431
           || |  || | |||||||| |||||||||||||||||| ||||| ||||| |||||||
Sbjct: 380 tggcgcgggatgatgcgggtcttcttgttgtccttggcagcgttgccggccagctcca 323

---

>gb|BT016569.1| Zea mays clone Contig402 mRNA sequence
          Length = 719

 Score =  206 bits (104), Expect = 4e-50
 Identities = 205/238 (86%), Gaps = 3/238 (1%)
 Strand = Plus / Minus

                                                                       
Query: 197 gccttcttgggggacttggcggccttcttgggcgacttgccctccttgggctcc---ttc 253
           ||||||||||||||||||| || ||||||||| |||||| ||||||||||| ||   |||
Sbjct: 560 gccttcttgggggacttggggggcttcttgggggacttggcctccttgggcgccgccttc 501

                                                                       
Query: 254 tccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcg 313
           ||||||||| ||||||| || |||||||||||||||||||| || ||||||||||| |||
Sbjct: 500 tccgcggtcttcttgggcaggagcaccgggttgatgttggggaggacgccgccgtgggcg 441

                                                                       
Query: 314 atggtgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcagg 373
           ||||||||||||| ||||||| | |||||||||| |||||| |  | ||| ||||||| |
Sbjct: 440 atggtgacgccggacagcagcttgccgagctcctcgtcgttgcggatggcaaggagcacg 381

                                                                     
Query: 374 tgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctcca 431
           || |  || | |||||||| |||||||||||||||||| ||||| ||||| |||||||
Sbjct: 380 tggcgcgggatgatgcgggtcttcttgttgtccttggcagcgttgccggccagctcca 323

---

>ref|NM_193707.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 480

 Score =  165 bits (83), Expect = 1e-37
 Identities = 158/183 (86%)
 Strand = Plus / Minus

                                                                       
Query: 249 ccttctccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgt 308
           |||||||||| ||| ||||||| |||||||||||||||||||||||||||||||| ||||
Sbjct: 412 ccttctccgccgtcttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgt 353

                                                                       
Query: 309 gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgagga 368
           |||||||||| ||||||||||||||| | |||||||||| ||||||||| |  || || |
Sbjct: 352 gcgcgatggtcacgccggccagcagcttgccgagctcctcgtcgttcctgatcgccagca 293

                                                                       
Query: 369 gcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagct 428
           ||| ||| |  || | ||| | |  ||||||||||||| |||| ||||||||||||||||
Sbjct: 292 gcacgtggcgcgggatgatcctgttcttcttgttgtccctggccgcgttcccggcgagct 233

              
Query: 429 cca 431
           |||
Sbjct: 232 cca 230



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 47/52 (90%), Gaps = 3/52 (5%)
 Strand = Plus / Minus

                                                               
Query: 196 ggccttcttgggggacttggcggcc---ttcttgggcgacttgccctccttg 244
           ||||||||||||||||||| |||||   ||||||||||||||| ||||||||
Sbjct: 477 ggccttcttgggggacttgccggccgccttcttgggcgacttggcctccttg 426

---

>ref|XM_475081.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 522

 Score =  165 bits (83), Expect = 1e-37
 Identities = 158/183 (86%)
 Strand = Plus / Minus

                                                                       
Query: 249 ccttctccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgt 308
           |||||||||||||| |||| ||||||||||||||||||||||| ||||||||||||||||
Sbjct: 454 ccttctccgcggtcttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgt 395

                                                                       
Query: 309 gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgagga 368
           ||||||||||||| ||||| |||||| |||||||||||| |||||| |  |  || || |
Sbjct: 394 gcgcgatggtgaccccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagca 335

                                                                       
Query: 369 gcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagct 428
           ||| |||||| || | ||| |||  |||||||||||||   || ||||||||||||||||
Sbjct: 334 gcacgtgcctcgggatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagct 275

              
Query: 429 cca 431
           |||
Sbjct: 274 cca 272

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  165 bits (83), Expect = 1e-37
 Identities = 158/183 (86%)
 Strand = Plus / Plus

                                                                           
Query: 249     ccttctccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgt 308
               |||||||||| ||| ||||||| |||||||||||||||||||||||||||||||| ||||
Sbjct: 9471210 ccttctccgccgtcttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgt 9471269

                                                                           
Query: 309     gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgagga 368
               |||||||||| ||||||||||||||| | |||||||||| ||||||||| |  || || |
Sbjct: 9471270 gcgcgatggtcacgccggccagcagcttgccgagctcctcgtcgttcctgatcgccagca 9471329

                                                                           
Query: 369     gcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagct 428
               ||| ||| |  || | ||| | |  ||||||||||||| |||| ||||||||||||||||
Sbjct: 9471330 gcacgtggcgcgggatgatcctgttcttcttgttgtccctggccgcgttcccggcgagct 9471389

                  
Query: 429     cca 431
               |||
Sbjct: 9471390 cca 9471392



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 48/52 (92%), Gaps = 3/52 (5%)
 Strand = Plus / Plus

                                                                   
Query: 196     ggccttcttgggggactt---ggcggccttcttgggcgacttgccctccttg 244
               ||||||||||||||||||   |||||||||||||||||||||| ||||||||
Sbjct: 9471145 ggccttcttgggggacttcccggcggccttcttgggcgacttggcctccttg 9471196



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 134/168 (79%)
 Strand = Plus / Minus

                                                                            
Query: 264      tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
                ||||||| ||||| ||| | | ||||||||||||||||||||||   ||||| |||||| 
Sbjct: 28998341 tcttgggaagcaggacctgctggatgttgggcagcacgccgccggcggcgatcgtgacgg 28998282

                                                                            
Query: 324      cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 383
                 | |||||||||| |  ||||||| |||||| | ||| || ||  | | |||||  ||||
Sbjct: 28998281 tgcccagcagcctgctcagctcctcgtcgttgcgcaccgccagctggatgtgccgcggca 28998222

                                                                
Query: 384      cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctcca 431
                |||| | |  ||||||||||||| | || ||||||||||| |||||||
Sbjct: 28998221 cgatcctgttcttcttgttgtccctcgccgcgttcccggccagctcca 28998174



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                                
Query: 211      cttggcggccttcttgggcgacttgccctcct 242
                ||||||| ||||||||||||||| || |||||
Sbjct: 10411003 cttggcgcccttcttgggcgactcgctctcct 10410972

---

>gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0002D01, from chromosome 3, complete sequence
          Length = 187589

 Score =  165 bits (83), Expect = 1e-37
 Identities = 158/183 (86%)
 Strand = Plus / Plus

                                                                          
Query: 249    ccttctccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgt 308
              |||||||||| ||| ||||||| |||||||||||||||||||||||||||||||| ||||
Sbjct: 168610 ccttctccgccgtcttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgt 168669

                                                                          
Query: 309    gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgagga 368
              |||||||||| ||||||||||||||| | |||||||||| ||||||||| |  || || |
Sbjct: 168670 gcgcgatggtcacgccggccagcagcttgccgagctcctcgtcgttcctgatcgccagca 168729

                                                                          
Query: 369    gcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagct 428
              ||| ||| |  || | ||| | |  ||||||||||||| |||| ||||||||||||||||
Sbjct: 168730 gcacgtggcgcgggatgatcctgttcttcttgttgtccctggccgcgttcccggcgagct 168789

                 
Query: 429    cca 431
              |||
Sbjct: 168790 cca 168792



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 48/52 (92%), Gaps = 3/52 (5%)
 Strand = Plus / Plus

                                                                  
Query: 196    ggccttcttgggggactt---ggcggccttcttgggcgacttgccctccttg 244
              ||||||||||||||||||   |||||||||||||||||||||| ||||||||
Sbjct: 168545 ggccttcttgggggacttcccggcggccttcttgggcgacttggcctccttg 168596

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5,
              complete sequence
          Length = 29737217

 Score =  165 bits (83), Expect = 1e-37
 Identities = 158/183 (86%)
 Strand = Plus / Minus

                                                                          
Query: 249    ccttctccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgt 308
              |||||||||||||| |||| ||||||||||||||||||||||| ||||||||||||||||
Sbjct: 707417 ccttctccgcggtcttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgt 707358

                                                                          
Query: 309    gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgagga 368
              ||||||||||||| ||||| |||||| |||||||||||| |||||| |  |  || || |
Sbjct: 707357 gcgcgatggtgaccccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagca 707298

                                                                          
Query: 369    gcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagct 428
              ||| |||||| || | ||| |||  |||||||||||||   || ||||||||||||||||
Sbjct: 707297 gcacgtgcctcgggatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagct 707238

                 
Query: 429    cca 431
              |||
Sbjct: 707237 cca 707235



 Score =  161 bits (81), Expect = 2e-36
 Identities = 93/97 (95%)
 Strand = Plus / Plus

                                                                            
Query: 258      cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
                ||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 22512323 cggtcttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatgg 22512382

                                                     
Query: 318      tgacgccggccagcagcctcccgagctcctggtcgtt 354
                ||||||||||||||||| |||||||||||| ||||||
Sbjct: 22512383 tgacgccggccagcagcttcccgagctcctcgtcgtt 22512419

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  165 bits (83), Expect = 1e-37
 Identities = 158/183 (86%)
 Strand = Plus / Plus

                                                                           
Query: 249     ccttctccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgt 308
               |||||||||| ||| ||||||| |||||||||||||||||||||||||||||||| ||||
Sbjct: 9469331 ccttctccgccgtcttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgt 9469390

                                                                           
Query: 309     gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgagga 368
               |||||||||| ||||||||||||||| | |||||||||| ||||||||| |  || || |
Sbjct: 9469391 gcgcgatggtcacgccggccagcagcttgccgagctcctcgtcgttcctgatcgccagca 9469450

                                                                           
Query: 369     gcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagct 428
               ||| ||| |  || | ||| | |  ||||||||||||| |||| ||||||||||||||||
Sbjct: 9469451 gcacgtggcgcgggatgatcctgttcttcttgttgtccctggccgcgttcccggcgagct 9469510

                  
Query: 429     cca 431
               |||
Sbjct: 9469511 cca 9469513



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 48/52 (92%), Gaps = 3/52 (5%)
 Strand = Plus / Plus

                                                                   
Query: 196     ggccttcttgggggactt---ggcggccttcttgggcgacttgccctccttg 244
               ||||||||||||||||||   |||||||||||||||||||||| ||||||||
Sbjct: 9469266 ggccttcttgggggacttcccggcggccttcttgggcgacttggcctccttg 9469317



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 134/168 (79%)
 Strand = Plus / Minus

                                                                            
Query: 264      tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
                ||||||| ||||| ||| | | ||||||||||||||||||||||   ||||| |||||| 
Sbjct: 29089763 tcttgggaagcaggacctgctggatgttgggcagcacgccgccggcggcgatcgtgacgg 29089704

                                                                            
Query: 324      cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 383
                 | |||||||||| |  ||||||| |||||| | ||| || ||  | | |||||  ||||
Sbjct: 29089703 tgcccagcagcctgctcagctcctcgtcgttgcgcaccgccagctggatgtgccgcggca 29089644

                                                                
Query: 384      cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctcca 431
                |||| | |  ||||||||||||| | || ||||||||||| |||||||
Sbjct: 29089643 cgatcctgttcttcttgttgtccctcgccgcgttcccggccagctcca 29089596



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                                
Query: 211      cttggcggccttcttgggcgacttgccctcct 242
                ||||||| ||||||||||||||| || |||||
Sbjct: 10409104 cttggcgcccttcttgggcgactcgctctcct 10409073

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  165 bits (83), Expect = 1e-37
 Identities = 158/183 (86%)
 Strand = Plus / Minus

                                                                            
Query: 249      ccttctccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgt 308
                |||||||||| ||| ||||||| |||||||||||||||||||||||||||||||| ||||
Sbjct: 17417162 ccttctccgccgtcttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgt 17417103

                                                                            
Query: 309      gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgagga 368
                |||||||||| ||||||||||||||| | |||||||||| ||||||||| |  || || |
Sbjct: 17417102 gcgcgatggtcacgccggccagcagcttgccgagctcctcgtcgttcctgatcgccagca 17417043

                                                                            
Query: 369      gcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagct 428
                ||| ||| |  || | ||| | |  ||||||||||||| |||| ||||||||||||||||
Sbjct: 17417042 gcacgtggcgcgggatgatcctgttcttcttgttgtccctggccgcgttcccggcgagct 17416983

                   
Query: 429      cca 431
                |||
Sbjct: 17416982 cca 17416980



 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                            
Query: 220      cttcttgggcgacttgccctccttgggctccttctccgcggtcctcttggggagcagcac 279
                |||||| ||||||||| ||||||||    |||||||||||| |||||| ||||| |||||
Sbjct: 43063433 cttctttggcgacttggcctccttgttggccttctccgcggccctctttgggaggagcac 43063374

                                                       
Query: 280      cgggttgatgttgggcagcacgccgccgtgcgcgatggt 318
                | ||||||||||||||||||| ||||| || ||||||||
Sbjct: 43063373 caggttgatgttgggcagcactccgccatgggcgatggt 43063335



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 47/52 (90%), Gaps = 3/52 (5%)
 Strand = Plus / Minus

                                                                    
Query: 196      ggccttcttgggggacttggcggcc---ttcttgggcgacttgccctccttg 244
                ||||||||||||||||||| |||||   ||||||||||||||| ||||||||
Sbjct: 17417227 ggccttcttgggggacttgccggccgccttcttgggcgacttggcctccttg 17417176



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                        
Query: 195      cggccttcttgggggacttggcgg 218
                ||||||||||||||||||||||||
Sbjct: 43063467 cggccttcttgggggacttggcgg 43063444

---

>dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0507H06
          Length = 136351

 Score =  165 bits (83), Expect = 1e-37
 Identities = 158/183 (86%)
 Strand = Plus / Minus

                                                                         
Query: 249   ccttctccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgt 308
             |||||||||| ||| ||||||| |||||||||||||||||||||||||||||||| ||||
Sbjct: 70554 ccttctccgccgtcttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgt 70495

                                                                         
Query: 309   gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgagga 368
             |||||||||| ||||||||||||||| | |||||||||| ||||||||| |  || || |
Sbjct: 70494 gcgcgatggtcacgccggccagcagcttgccgagctcctcgtcgttcctgatcgccagca 70435

                                                                         
Query: 369   gcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagct 428
             ||| ||| |  || | ||| | |  ||||||||||||| |||| ||||||||||||||||
Sbjct: 70434 gcacgtggcgcgggatgatcctgttcttcttgttgtccctggccgcgttcccggcgagct 70375

                
Query: 429   cca 431
             |||
Sbjct: 70374 cca 70372



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 47/52 (90%), Gaps = 3/52 (5%)
 Strand = Plus / Minus

                                                                 
Query: 196   ggccttcttgggggacttggcggcc---ttcttgggcgacttgccctccttg 244
             ||||||||||||||||||| |||||   ||||||||||||||| ||||||||
Sbjct: 70619 ggccttcttgggggacttgccggccgccttcttgggcgacttggcctccttg 70568

---

>dbj|AK121750.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033087I02, full
           insert sequence
          Length = 754

 Score =  165 bits (83), Expect = 1e-37
 Identities = 158/183 (86%)
 Strand = Plus / Minus

                                                                       
Query: 249 ccttctccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgt 308
           |||||||||| ||| ||||||| |||||||||||||||||||||||||||||||| ||||
Sbjct: 502 ccttctccgccgtcttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgt 443

                                                                       
Query: 309 gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgagga 368
           |||||||||| ||||||||||||||| | |||||||||| ||||||||| |  || || |
Sbjct: 442 gcgcgatggtcacgccggccagcagcttgccgagctcctcgtcgttcctgatcgccagca 383

                                                                       
Query: 369 gcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagct 428
           ||| ||| |  || | ||| | |  ||||||||||||| |||| ||||||||||||||||
Sbjct: 382 gcacgtggcgcgggatgatcctgttcttcttgttgtccctggccgcgttcccggcgagct 323

              
Query: 429 cca 431
           |||
Sbjct: 322 cca 320



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 48/52 (92%), Gaps = 3/52 (5%)
 Strand = Plus / Minus

                                                               
Query: 196 ggccttcttgggggactt---ggcggccttcttgggcgacttgccctccttg 244
           ||||||||||||||||||   |||||||||||||||||||||| ||||||||
Sbjct: 567 ggccttcttgggggacttcccggcggccttcttgggcgacttggcctccttg 516

---

>dbj|AK074018.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033075N03, full
           insert sequence
          Length = 797

 Score =  165 bits (83), Expect = 1e-37
 Identities = 158/183 (86%)
 Strand = Plus / Minus

                                                                       
Query: 249 ccttctccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgt 308
           |||||||||||||| |||| ||||||||||||||||||||||| ||||||||||||||||
Sbjct: 480 ccttctccgcggtcttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgt 421

                                                                       
Query: 309 gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgagga 368
           ||||||||||||| ||||| |||||| |||||||||||| |||||| |  |  || || |
Sbjct: 420 gcgcgatggtgaccccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagca 361

                                                                       
Query: 369 gcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagct 428
           ||| |||||| || | ||| |||  |||||||||||||   || ||||||||||||||||
Sbjct: 360 gcacgtgcctcgggatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagct 301

              
Query: 429 cca 431
           |||
Sbjct: 300 cca 298

---

>gb|AC093921.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBb0041A22, complete sequence
          Length = 117919

 Score =  165 bits (83), Expect = 1e-37
 Identities = 158/183 (86%)
 Strand = Plus / Minus

                                                                         
Query: 249   ccttctccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgt 308
             |||||||||||||| |||| ||||||||||||||||||||||| ||||||||||||||||
Sbjct: 52616 ccttctccgcggtcttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgt 52557

                                                                         
Query: 309   gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgagga 368
             ||||||||||||| ||||| |||||| |||||||||||| |||||| |  |  || || |
Sbjct: 52556 gcgcgatggtgaccccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagca 52497

                                                                         
Query: 369   gcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagct 428
             ||| |||||| || | ||| |||  |||||||||||||   || ||||||||||||||||
Sbjct: 52496 gcacgtgcctcgggatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagct 52437

                
Query: 429   cca 431
             |||
Sbjct: 52436 cca 52434

---

>ref|XM_475374.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 492

 Score =  161 bits (81), Expect = 2e-36
 Identities = 93/97 (95%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 397 cggtcttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatgg 338

                                                
Query: 318 tgacgccggccagcagcctcccgagctcctggtcgtt 354
           ||||||||||||||||| |||||||||||| ||||||
Sbjct: 337 tgacgccggccagcagcttcccgagctcctcgtcgtt 301

---

>gb|AC108876.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1525_A02,
            complete sequence
          Length = 93826

 Score =  161 bits (81), Expect = 2e-36
 Identities = 93/97 (95%)
 Strand = Plus / Plus

                                                                        
Query: 258  cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
            ||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 7373 cggtcttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatgg 7432

                                                 
Query: 318  tgacgccggccagcagcctcccgagctcctggtcgtt 354
            ||||||||||||||||| |||||||||||| ||||||
Sbjct: 7433 tgacgccggccagcagcttcccgagctcctcgtcgtt 7469

---

>gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1281_H05,
              complete sequence
          Length = 163130

 Score =  161 bits (81), Expect = 2e-36
 Identities = 93/97 (95%)
 Strand = Plus / Plus

                                                                          
Query: 258    cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
              ||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 101730 cggtcttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatgg 101789

                                                   
Query: 318    tgacgccggccagcagcctcccgagctcctggtcgtt 354
              ||||||||||||||||| |||||||||||| ||||||
Sbjct: 101790 tgacgccggccagcagcttcccgagctcctcgtcgtt 101826

---

>dbj|AK099763.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013094K03, full
           insert sequence
          Length = 912

 Score =  161 bits (81), Expect = 2e-36
 Identities = 93/97 (95%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 467 cggtcttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatgg 408

                                                
Query: 318 tgacgccggccagcagcctcccgagctcctggtcgtt 354
           ||||||||||||||||| |||||||||||| ||||||
Sbjct: 407 tgacgccggccagcagcttcccgagctcctcgtcgtt 371

---

>dbj|AK067406.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013099N23, full
           insert sequence
          Length = 1097

 Score =  161 bits (81), Expect = 2e-36
 Identities = 93/97 (95%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 468 cggtcttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatgg 409

                                                
Query: 318 tgacgccggccagcagcctcccgagctcctggtcgtt 354
           ||||||||||||||||| |||||||||||| ||||||
Sbjct: 408 tgacgccggccagcagcttcccgagctcctcgtcgtt 372

---

>gb|BT019008.1| Zea mays clone Contig499.F mRNA sequence
          Length = 674

 Score =  151 bits (76), Expect = 2e-33
 Identities = 158/184 (85%), Gaps = 1/184 (0%)
 Strand = Plus / Minus

                                                                       
Query: 249 ccttctccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgt 308
           |||||||||| ||| ||||||| ||||| ||||||||||||||||||| |||||||||||
Sbjct: 463 ccttctccgccgtcttcttgggcagcaggaccgggttgatgttgggcaacacgccgccgt 404

                                                                       
Query: 309 gcgcgatggtgacgccggccagcagcc-tcccgagctcctggtcgttcctcacggcgagg 367
           | |||||||| ||||||| |||||||| |||||||||||| |||||| |  |  || || 
Sbjct: 403 gggcgatggtcacgccggtcagcagccttcccgagctcctcgtcgttgcggatcgccagc 344

                                                                       
Query: 368 agcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagc 427
           |||| ||| |  || |||||||| | |||||||||||||||||| ||||| |||||||||
Sbjct: 343 agcacgtggcgcgggacgatgcgcgtcttcttgttgtccttggcagcgttgccggcgagc 284

               
Query: 428 tcca 431
           ||||
Sbjct: 283 tcca 280



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 47/48 (97%)
 Strand = Plus / Minus

                                                           
Query: 197 gccttcttgggggacttggcggccttcttgggcgacttgccctccttg 244
           ||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 527 gccttcttgggggacttggcggccttcttgggcgacttggcctccttg 480

---

>dbj|D38090.1|WHTPH2AD Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-9
          Length = 704

 Score =  151 bits (76), Expect = 2e-33
 Identities = 145/168 (86%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
           |||||||||||||||| | |||||||||||| | |||||| ||||| |||||||||||||
Sbjct: 411 tcttggggagcagcacggagttgatgttggggatcacgccaccgtgggcgatggtgacgc 352

                                                                       
Query: 324 cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 383
           | || |||||||| ||||||||||||||||| |  || ||||| |||||||| |  || |
Sbjct: 351 cagcgagcagcctgccgagctcctggtcgttgcggacagcgagcagcaggtggcgcggga 292

                                                           
Query: 384 cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctcca 431
            |||||||| |||||||||||||||||| ||||| ||||| |||||||
Sbjct: 291 tgatgcgggtcttcttgttgtccttggccgcgttgccggcaagctcca 244



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 220 cttcttgggcgacttgccctcctt 243
           |||||||||||||||| |||||||
Sbjct: 455 cttcttgggcgacttggcctcctt 432

---

>dbj|D38088.1|WHTPH2AB Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-3
          Length = 1153

 Score =  151 bits (76), Expect = 2e-33
 Identities = 145/168 (86%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
           |||||||||||||||| | |||||||||||| |  ||||||||||| |||||||||||||
Sbjct: 432 tcttggggagcagcacggagttgatgttggggatgacgccgccgtgggcgatggtgacgc 373

                                                                       
Query: 324 cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 383
           |||| |||||||| || |||||||||||||| |  ||||| || |||||||| |  || |
Sbjct: 372 cggcgagcagcctgcccagctcctggtcgttgcggacggccagcagcaggtggcgcggga 313

                                                           
Query: 384 cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctcca 431
            |||||| | |||||||||||||||||| ||||| |||||||||||||
Sbjct: 312 tgatgcgcgtcttcttgttgtccttggccgcgttgccggcgagctcca 265

---

>dbj|D38087.1|WHTPH2AA Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-2
          Length = 717

 Score =  151 bits (76), Expect = 2e-33
 Identities = 145/168 (86%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
           |||||||||||||||| | |||||||||||| |  ||||||||||| |||||||||||||
Sbjct: 434 tcttggggagcagcacggagttgatgttggggatgacgccgccgtgggcgatggtgacgc 375

                                                                       
Query: 324 cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 383
           |||| |||||||| ||||||||||||||||| |  ||||| || |||||||| |  || |
Sbjct: 374 cggcgagcagcctgccgagctcctggtcgttgcggacggccagcagcaggtggcgcggga 315

                                                           
Query: 384 cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctcca 431
            |||||| | |||||||||||||||||| ||||| ||||| |||||||
Sbjct: 314 tgatgcgcgtcttcttgttgtccttggccgcgttgccggcaagctcca 267



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 199 cttcttgggggacttggcggc 219
           |||||||||||||||||||||
Sbjct: 499 cttcttgggggacttggcggc 479

---

>emb|X94973.1|TAH2A274 T.aestivum histone H2A gene (clone TH274)
          Length = 2546

 Score =  143 bits (72), Expect = 5e-31
 Identities = 144/168 (85%)
 Strand = Plus / Minus

                                                                        
Query: 264  tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
            ||||||| |||||||| | ||||||  |||| |  ||||||||||| |||||||||||||
Sbjct: 2233 tcttgggcagcagcacggagttgattgtggggatgacgccgccgtgggcgatggtgacgc 2174

                                                                        
Query: 324  cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 383
            |||| |||||||| ||||||||||||||||| |  |||||||| |||||||| |  || |
Sbjct: 2173 cggcaagcagcctgccgagctcctggtcgttgcggacggcgagcagcaggtggcgcggga 2114

                                                            
Query: 384  cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctcca 431
             |||||||| |||||||||||||||||| ||||| ||||| |||||||
Sbjct: 2113 tgatgcgggtcttcttgttgtccttggctgcgttgccggcaagctcca 2066



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 220  cttcttgggcgacttgccctcctt 243
            |||||||||||||||| |||||||
Sbjct: 2277 cttcttgggcgacttggcctcctt 2254

---

>gb|L75802.1|WHTHIH2A Triticum aestivum histone H2A gene, complete cds
          Length = 2546

 Score =  143 bits (72), Expect = 5e-31
 Identities = 144/168 (85%)
 Strand = Plus / Minus

                                                                        
Query: 264  tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
            ||||||| |||||||| | ||||||  |||| |  ||||||||||| |||||||||||||
Sbjct: 2233 tcttgggcagcagcacggagttgattgtggggatgacgccgccgtgggcgatggtgacgc 2174

                                                                        
Query: 324  cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 383
            |||| |||||||| ||||||||||||||||| |  |||||||| |||||||| |  || |
Sbjct: 2173 cggcaagcagcctgccgagctcctggtcgttgcggacggcgagcagcaggtggcgcggga 2114

                                                            
Query: 384  cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctcca 431
             |||||||| |||||||||||||||||| ||||| ||||| |||||||
Sbjct: 2113 tgatgcgggtcttcttgttgtccttggctgcgttgccggcaagctcca 2066



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 220  cttcttgggcgacttgccctcctt 243
            |||||||||||||||| |||||||
Sbjct: 2277 cttcttgggcgacttggcctcctt 2254

---

>gb|BT016301.1| Zea mays clone Contig134 mRNA sequence
          Length = 846

 Score =  125 bits (63), Expect = 1e-25
 Identities = 84/91 (92%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
           |||||||||||||||| ||||||||||||||||| || |||||||| |||||||||||||
Sbjct: 395 tcttggggagcagcacagggttgatgttgggcagaaccccgccgtgtgcgatggtgacgc 336

                                          
Query: 324 cggccagcagcctcccgagctcctggtcgtt 354
           ||||||| ||| |||||||||||| ||||||
Sbjct: 335 cggccagtagcttcccgagctcctcgtcgtt 305

---

>gb|AY104486.1| Zea mays PCO109435 mRNA sequence
          Length = 992

 Score =  119 bits (60), Expect = 8e-24
 Identities = 78/84 (92%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
           |||||||||||||||| ||||||||||||||||| || |||||||| |||||||||||||
Sbjct: 466 tcttggggagcagcacagggttgatgttgggcagaaccccgccgtgtgcgatggtgacgc 407

                                   
Query: 324 cggccagcagcctcccgagctcct 347
           ||||||| ||| ||||||||||||
Sbjct: 406 cggccagtagcttcccgagctcct 383

---

>gb|AY103585.1| Zea mays PCO123564 mRNA sequence
          Length = 1953

 Score =  115 bits (58), Expect = 1e-22
 Identities = 94/106 (88%)
 Strand = Plus / Minus

                                                                       
Query: 249 ccttctccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgt 308
           |||||||||| | | ||||||| || ||||| | || ||||||||| || ||||||||||
Sbjct: 623 ccttctccgccgccttcttgggcaggagcacggagtggatgttggggaggacgccgccgt 564

                                                         
Query: 309 gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgtt 354
           |||||||||||||||||||||||||| |||||||||||| ||||||
Sbjct: 563 gcgcgatggtgacgccggccagcagcttcccgagctcctcgtcgtt 518



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 197 gccttcttgggggacttggcggccttcttgggcgacttgccctccttg 244
           ||||||||||||||||||||| |||||||||| ||||||  |||||||
Sbjct: 687 gccttcttgggggacttggcgcccttcttgggggacttgggctccttg 640

---

>gb|BT019315.1| Zea mays clone Contig989.F mRNA sequence
          Length = 699

 Score =  107 bits (54), Expect = 3e-20
 Identities = 93/106 (87%)
 Strand = Plus / Minus

                                                                       
Query: 249 ccttctccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgt 308
           |||||||||| | | ||||||| || ||||| | || ||||||||| || ||||| ||||
Sbjct: 474 ccttctccgccgccttcttgggcaggagcacggagtggatgttggggaggacgccaccgt 415

                                                         
Query: 309 gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgtt 354
           |||||||||||||||||||||||||| |||||||||||| ||||||
Sbjct: 414 gcgcgatggtgacgccggccagcagcttcccgagctcctcgtcgtt 369



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 197 gccttcttgggggacttggcggccttcttgggcgacttgccctccttg 244
           ||||||||||||||||||||| |||||||||| ||||||  |||||||
Sbjct: 538 gccttcttgggggacttggcgcccttcttgggggacttgggctccttg 491

---

>gb|BT017719.1| Zea mays clone EL01N0447A04.c mRNA sequence
          Length = 772

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 119/142 (83%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
           |||||||||| || || ||||| |||||||||||||| |||||||||||||||||||| |
Sbjct: 447 tcttggggaggaggacggggttaatgttgggcagcacaccgccgtgcgcgatggtgaccc 388

                                                                       
Query: 324 cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 383
           |  |||||||| | |||||||||| |||||| |  | ||||||||| ||||| |  || |
Sbjct: 387 cacccagcagcttgccgagctcctcgtcgttgcggatggcgaggaggaggtggcgcggga 328

                                 
Query: 384 cgatgcgggacttcttgttgtc 405
            ||||||||  |||||||||||
Sbjct: 327 tgatgcgggttttcttgttgtc 306



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 195 cggccttcttgggggacttgg 215
           |||||||||||||||||||||
Sbjct: 507 cggccttcttgggggacttgg 487

---

>dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0459B04
          Length = 142475

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                         
Query: 220   cttcttgggcgacttgccctccttgggctccttctccgcggtcctcttggggagcagcac 279
             |||||| ||||||||| ||||||||    |||||||||||| |||||| ||||| |||||
Sbjct: 60462 cttctttggcgacttggcctccttgttggccttctccgcggccctctttgggaggagcac 60403

                                                    
Query: 280   cgggttgatgttgggcagcacgccgccgtgcgcgatggt 318
             | ||||||||||||||||||| ||||| || ||||||||
Sbjct: 60402 caggttgatgttgggcagcactccgccatgggcgatggt 60364



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 195   cggccttcttgggggacttggcgg 218
             ||||||||||||||||||||||||
Sbjct: 60496 cggccttcttgggggacttggcgg 60473

---

>gb|U08225.1|ZMU08225 Zea mays W-22 histone H2A mRNA, complete cds
          Length = 714

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 149/183 (81%)
 Strand = Plus / Minus

                                                                       
Query: 249 ccttctccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgt 308
           |||||||||| ||| ||||||| ||||| || |||||||| ||||| ||||| |||||||
Sbjct: 480 ccttctccgccgtcttcttgggcagcagaacagggttgatattggggagcacaccgccgt 421

                                                                       
Query: 309 gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgagga 368
           | |||||||| |||||| ||| |||| |||| ||||||| ||||||||  |  || || |
Sbjct: 420 gagcgatggtcacgccgcccaacagcttcccaagctcctcgtcgttccggatcgccagaa 361

                                                                       
Query: 369 gcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagct 428
           ||| ||| |  || |  ||||| | ||||||||||||| |||| || || ||||||||||
Sbjct: 360 gcacgtggcgcggaataatgcgagtcttcttgttgtccctggcagcattaccggcgagct 301

              
Query: 429 cca 431
           |||
Sbjct: 300 cca 298



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 197 gccttcttgggggacttggcggccttcttgggcgacttgccctccttg 244
           |||||||| |||||||||||||||||||||||||||||  ||||||||
Sbjct: 544 gccttcttaggggacttggcggccttcttgggcgactttgcctccttg 497

---

>gb|AF255739.1|AF255739 Bufo bufo gagarizans replication-dependent histone H2A gene, complete
            cds
          Length = 2120

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 142/174 (81%)
 Strand = Plus / Minus

                                                                        
Query: 258  cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
            ||||| ||||||| |||||||| |  | |||||||||||| ||||| || || |||||||
Sbjct: 1169 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatgg 1110

                                                                        
Query: 318  tgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcc 377
            |||||||| |||||||| |   |||||||| |||||| | |||||| ||  ||||||| |
Sbjct: 1109 tgacgccgcccagcagcttgttgagctcctcgtcgttgcgcacggccagctgcaggtgac 1050

                                                                  
Query: 378  tgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctcca 431
             ||| | |||||||| ||||||||||||   |||||| || ||||| |||||||
Sbjct: 1049 gggggatgatgcgggtcttcttgttgtcgcgggcggcattgccggccagctcca 996

---

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
               sequence
          Length = 35498469

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 61/66 (92%)
 Strand = Plus / Minus

                                                                           
Query: 269     gggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgccggcc 328
               ||||||||||||||||||||||| |||||||| || || ||||||||||||||||| |||
Sbjct: 7508467 gggagcagcaccgggttgatgttcggcagcacaccaccatgcgcgatggtgacgccagcc 7508408

                     
Query: 329     agcagc 334
               ||||||
Sbjct: 7508407 agcagc 7508402



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 319      gacgccggccagcagcctcccga 341
                |||||||||||||||||||||||
Sbjct: 34705649 gacgccggccagcagcctcccga 34705627

---

>emb|AL662960.3|OSJN00162 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0021F22,
             complete sequence
          Length = 181498

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 61/66 (92%)
 Strand = Plus / Minus

                                                                         
Query: 269   gggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgccggcc 328
             ||||||||||||||||||||||| |||||||| || || ||||||||||||||||| |||
Sbjct: 30940 gggagcagcaccgggttgatgttcggcagcacaccaccatgcgcgatggtgacgccagcc 30881

                   
Query: 329   agcagc 334
             ||||||
Sbjct: 30880 agcagc 30875

---

>emb|CR700361.2|CNS0G3CL Tetraodon nigroviridis full-length cDNA
          Length = 547

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 137/168 (81%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
           ||||||| ||||||||||  | ||||||||||||||||||||| || |||||||| || |
Sbjct: 387 tcttgggcagcagcaccgcctggatgttgggcagcacgccgccctgggcgatggtcactc 328

                                                                       
Query: 324 cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 383
           || |||||||| |    ||||||| |||||| | |||||| ||  |||||||||  || |
Sbjct: 327 cgcccagcagcttgttcagctcctcgtcgttgcgcacggccagctgcaggtgccgcggga 268

                                                           
Query: 384 cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctcca 431
            ||| | || ||||||||||||   ||||||||||||||| |||||||
Sbjct: 267 tgatcctggtcttcttgttgtcgcgggcggcgttcccggccagctcca 220

---

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 137/168 (81%)
 Strand = Plus / Plus

                                                                            
Query: 264      tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
                ||||||||||||||  | ||| ||||||||||||||||||||||   |||||||||||| 
Sbjct: 20924435 tcttggggagcagcgtctggtggatgttgggcagcacgccgccggcggcgatggtgacgg 20924494

                                                                            
Query: 324      cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 383
                || | |||||||| |  ||||||| |||||| | ||| || ||  | | |||||| ||||
Sbjct: 20924495 cgccgagcagcctgctcagctcctcgtcgttgcgcaccgccagctggatgtgcctcggca 20924554

                                                                
Query: 384      cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctcca 431
                |||| |||  ||||||||||||| | || |||||||| || |||||||
Sbjct: 20924555 cgatccggttcttcttgttgtccctcgccgcgttccccgccagctcca 20924602



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 118/146 (80%)
 Strand = Plus / Plus

                                                                            
Query: 286      gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagcctcccgagctc 345
                |||||||||||  |||||||||   ||||||||| ||||| | |||||| |   ||||||
Sbjct: 14468549 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 14468608

                                                                            
Query: 346      ctggtcgttcctcacggcgaggagcaggtgcctgggcacgatgcgggacttcttgttgtc 405
                || |||||| | ||| |||||  | | ||| |  ||||| ||||||| ||||||||||||
Sbjct: 14468609 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 14468668

                                          
Query: 406      cttggcggcgttcccggcgagctcca 431
                | | || |||||||||||||||||||
Sbjct: 14468669 cctcgccgcgttcccggcgagctcca 14468694

---

>dbj|AK121752.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033087P07, full
           insert sequence
          Length = 747

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 137/168 (81%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
           ||||||||||||||  | ||| ||||||||||||||||||||||   |||||||||||| 
Sbjct: 477 tcttggggagcagcgtctggtggatgttgggcagcacgccgccggcggcgatggtgacgg 418

                                                                       
Query: 324 cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 383
           || | |||||||| |  ||||||| |||||| | ||| || ||  | | |||||| ||||
Sbjct: 417 cgccgagcagcctgctcagctcctcgtcgttgcgcaccgccagctggatgtgcctcggca 358

                                                           
Query: 384 cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctcca 431
           |||| |||  ||||||||||||| | || |||||||| || |||||||
Sbjct: 357 cgatccggttcttcttgttgtccctcgccgcgttccccgccagctcca 310

---

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 137/168 (81%)
 Strand = Plus / Plus

                                                                            
Query: 264      tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
                ||||||||||||||  | ||| ||||||||||||||||||||||   |||||||||||| 
Sbjct: 20850649 tcttggggagcagcgtctggtggatgttgggcagcacgccgccggcggcgatggtgacgg 20850708

                                                                            
Query: 324      cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 383
                || | |||||||| |  ||||||| |||||| | ||| || ||  | | |||||| ||||
Sbjct: 20850709 cgccgagcagcctgctcagctcctcgtcgttgcgcaccgccagctggatgtgcctcggca 20850768

                                                                
Query: 384      cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctcca 431
                |||| |||  ||||||||||||| | || |||||||| || |||||||
Sbjct: 20850769 cgatccggttcttcttgttgtccctcgccgcgttccccgccagctcca 20850816



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 118/146 (80%)
 Strand = Plus / Plus

                                                                            
Query: 286      gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagcctcccgagctc 345
                |||||||||||  |||||||||   ||||||||| ||||| | |||||| |   ||||||
Sbjct: 14422833 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 14422892

                                                                            
Query: 346      ctggtcgttcctcacggcgaggagcaggtgcctgggcacgatgcgggacttcttgttgtc 405
                || |||||| | ||| |||||  | | ||| |  ||||| ||||||| ||||||||||||
Sbjct: 14422893 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 14422952

                                          
Query: 406      cttggcggcgttcccggcgagctcca 431
                | | || |||||||||||||||||||
Sbjct: 14422953 cctcgccgcgttcccggcgagctcca 14422978

---

>emb|AL713943.3|CNS07YPC Oryza sativa chromosome 12, . BAC OSJNBa0030G16 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 182172

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 137/168 (81%)
 Strand = Plus / Plus

                                                                         
Query: 264   tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
             ||||||||||||||  | ||| ||||||||||||||||||||||   |||||||||||| 
Sbjct: 9925  tcttggggagcagcgtctggtggatgttgggcagcacgccgccggcggcgatggtgacgg 9984

                                                                         
Query: 324   cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 383
             || | |||||||| |  ||||||| |||||| | ||| || ||  | | |||||| ||||
Sbjct: 9985  cgccgagcagcctgctcagctcctcgtcgttgcgcaccgccagctggatgtgcctcggca 10044

                                                             
Query: 384   cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctcca 431
             |||| |||  ||||||||||||| | || |||||||| || |||||||
Sbjct: 10045 cgatccggttcttcttgttgtccctcgccgcgttccccgccagctcca 10092

---

>emb|AL731880.3|CNS08C8J Oryza sativa chromosome 12, . BAC OSJNBa0035E02 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 107819

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 137/168 (81%)
 Strand = Plus / Minus

                                                                         
Query: 264   tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
             ||||||||||||||  | ||| ||||||||||||||||||||||   |||||||||||| 
Sbjct: 34560 tcttggggagcagcgtctggtggatgttgggcagcacgccgccggcggcgatggtgacgg 34501

                                                                         
Query: 324   cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 383
             || | |||||||| |  ||||||| |||||| | ||| || ||  | | |||||| ||||
Sbjct: 34500 cgccgagcagcctgctcagctcctcgtcgttgcgcaccgccagctggatgtgcctcggca 34441

                                                             
Query: 384   cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctcca 431
             |||| |||  ||||||||||||| | || |||||||| || |||||||
Sbjct: 34440 cgatccggttcttcttgttgtccctcgccgcgttccccgccagctcca 34393

---

>gb|AF493985.1| Triticum aestivum H2A-1 gene, partial sequence
          Length = 538

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 64/71 (90%)
 Strand = Plus / Plus

                                                                       
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
           |||||||||||||||| | |||||||||||| | ||| |||||||| |||||||||||||
Sbjct: 266 tcttggggagcagcacggagttgatgttggggatcacaccgccgtgggcgatggtgacgc 325

                      
Query: 324 cggccagcagc 334
           |||| ||||||
Sbjct: 326 cggcgagcagc 336



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 44/51 (86%), Gaps = 6/51 (11%)
 Strand = Plus / Plus

                                                              
Query: 199 cttcttgggggacttggcggc------cttcttgggcgacttgccctcctt 243
           |||||||||||||||||||||      |||||||||||||||| |||||||
Sbjct: 195 cttcttgggggacttggcggccgtcttcttcttgggcgacttggcctcctt 245

---

>ref|XM_482492.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 405

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 117/144 (81%)
 Strand = Plus / Minus

                                                                       
Query: 286 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagcctcccgagctc 345
           |||||||||||  ||||||||||  |||||||||||| || | ||||| | |   |||||
Sbjct: 339 gatgttgggcatgacgccgccgttggcgatggtgacggcgccgagcaggcgcgacagctc 280

                                                                       
Query: 346 ctggtcgttcctcacggcgaggagcaggtgcctgggcacgatgcgggacttcttgttgtc 405
           || |||||| | |||||||||  | | |||||| |||||||| || | ||||||||||||
Sbjct: 279 ctcgtcgttgcgcacggcgagctggatgtgcctcggcacgatccgcgtcttcttgttgtc 220

                                   
Query: 406 cttggcggcgttcccggcgagctc 429
           |   || |||||||||||||||||
Sbjct: 219 ccgcgccgcgttcccggcgagctc 196

---

>gb|BC068823.1| Xenopus laevis cDNA clone IMAGE:6635737, partial cds
          Length = 763

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 129/160 (80%)
 Strand = Plus / Plus

                                                                       
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
           |||||||||||||||| |  | |||||||||||| || ||||| || ||||||||||| |
Sbjct: 291 tcttggggagcagcacagactggatgttgggcagaaccccgccctgggcgatggtgaccc 350

                                                                       
Query: 324 cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 383
           |  | |||||  |   |||||||| |||||| | |||||||||  ||||||||||||| |
Sbjct: 351 ctccgagcagtttgttgagctcctcgtcgttgcgcacggcgagctgcaggtgcctgggga 410

                                                   
Query: 384 cgatgcgggacttcttgttgtccttggcggcgttcccggc 423
            |||||| | ||||||||| |||  ||| ||||| |||||
Sbjct: 411 tgatgcgagtcttcttgttatcccgggcagcgttgccggc 450

---

>gb|AF255740.1|AF255740 Bufo bufo gagarizans histone H1 (H1) and histone H2A variant (H2AInr)
            genes, complete cds
          Length = 2396

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 117/144 (81%)
 Strand = Plus / Minus

                                                                        
Query: 258  cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
            ||||| ||||||| |||||||| |  | |||||||||||| |||||||| || |||||||
Sbjct: 1588 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgggcgatgg 1529

                                                                        
Query: 318  tgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcc 377
            |||| ||| |||||||| |   |||||||| |||||| | |||||| ||  ||||||| |
Sbjct: 1528 tgactccgcccagcagcttgttgagctcctcgtcgttgcgcacggccagctgcaggtgac 1469

                                    
Query: 378  tgggcacgatgcgggacttcttgt 401
             ||| | |||||||| ||| ||||
Sbjct: 1468 gggggatgatgcgggtcttgttgt 1445

---

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 117/144 (81%)
 Strand = Plus / Minus

                                                                            
Query: 286      gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagcctcccgagctc 345
                |||||||||||  ||||||||||  |||||||||||| || | ||||| | |   |||||
Sbjct: 20566495 gatgttgggcatgacgccgccgttggcgatggtgacggcgccgagcaggcgcgacagctc 20566436

                                                                            
Query: 346      ctggtcgttcctcacggcgaggagcaggtgcctgggcacgatgcgggacttcttgttgtc 405
                || |||||| | |||||||||  | | |||||| |||||||| || | ||||||||||||
Sbjct: 20566435 ctcgtcgttgcgcacggcgagctggatgtgcctcggcacgatccgcgtcttcttgttgtc 20566376

                                        
Query: 406      cttggcggcgttcccggcgagctc 429
                |   || |||||||||||||||||
Sbjct: 20566375 ccgcgccgcgttcccggcgagctc 20566352



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 412      ggcgttcccggcgagctcca 431
                ||||||||||||||||||||
Sbjct: 17645345 ggcgttcccggcgagctcca 17645364

---

>dbj|AP005734.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OSJNBb0032E15
          Length = 120419

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 117/144 (81%)
 Strand = Plus / Minus

                                                                         
Query: 286   gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagcctcccgagctc 345
             |||||||||||  ||||||||||  |||||||||||| || | ||||| | |   |||||
Sbjct: 70456 gatgttgggcatgacgccgccgttggcgatggtgacggcgccgagcaggcgcgacagctc 70397

                                                                         
Query: 346   ctggtcgttcctcacggcgaggagcaggtgcctgggcacgatgcgggacttcttgttgtc 405
             || |||||| | |||||||||  | | |||||| |||||||| || | ||||||||||||
Sbjct: 70396 ctcgtcgttgcgcacggcgagctggatgtgcctcggcacgatccgcgtcttcttgttgtc 70337

                                     
Query: 406   cttggcggcgttcccggcgagctc 429
             |   || |||||||||||||||||
Sbjct: 70336 ccgcgccgcgttcccggcgagctc 70313

---

>dbj|AP003898.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1663_D06
          Length = 139103

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 117/144 (81%)
 Strand = Plus / Minus

                                                                         
Query: 286   gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagcctcccgagctc 345
             |||||||||||  ||||||||||  |||||||||||| || | ||||| | |   |||||
Sbjct: 40867 gatgttgggcatgacgccgccgttggcgatggtgacggcgccgagcaggcgcgacagctc 40808

                                                                         
Query: 346   ctggtcgttcctcacggcgaggagcaggtgcctgggcacgatgcgggacttcttgttgtc 405
             || |||||| | |||||||||  | | |||||| |||||||| || | ||||||||||||
Sbjct: 40807 ctcgtcgttgcgcacggcgagctggatgtgcctcggcacgatccgcgtcttcttgttgtc 40748

                                     
Query: 406   cttggcggcgttcccggcgagctc 429
             |   || |||||||||||||||||
Sbjct: 40747 ccgcgccgcgttcccggcgagctc 40724

---

>gb|BC010336.1| Mus musculus H2A histone family, member X, mRNA (cDNA clone
           MGC:11561 IMAGE:3156946), complete cds
          Length = 1414

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
           ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||| ||||
Sbjct: 405 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 346

                      
Query: 324 cggccagcagc 334
           || ||||||||
Sbjct: 345 cgcccagcagc 335

---

>gb|AC122428.4| Mus musculus BAC clone RP24-175C20 from chromosome 9, complete sequence
          Length = 185902

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                          
Query: 264    tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
              ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||| ||||
Sbjct: 149656 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 149715

                         
Query: 324    cggccagcagc 334
              || ||||||||
Sbjct: 149716 cgcccagcagc 149726

---

>ref|NM_010436.2| Mus musculus H2A histone family, member X (H2afx), mRNA
          Length = 1414

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
           ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||| ||||
Sbjct: 405 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 346

                      
Query: 324 cggccagcagc 334
           || ||||||||
Sbjct: 345 cgcccagcagc 335

---

>emb|Z35401.1|MMHISTH2A M.musculus C3H gene for histone H2A.X
          Length = 2166

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
           ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||| ||||
Sbjct: 984 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 925

                      
Query: 324 cggccagcagc 334
           || ||||||||
Sbjct: 924 cgcccagcagc 914

---

>emb|X58069.1|MMH2AX Mouse mRNA for Histone H2A.X
          Length = 1359

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
           ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||| ||||
Sbjct: 409 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 350

                      
Query: 324 cggccagcagc 334
           || ||||||||
Sbjct: 349 cgcccagcagc 339

---

>gb|BC005468.1| Mus musculus H2A histone family, member X, mRNA (cDNA clone
           MGC:6616 IMAGE:3490058), complete cds
          Length = 1367

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
           ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||| ||||
Sbjct: 399 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 340

                      
Query: 324 cggccagcagc 334
           || ||||||||
Sbjct: 339 cgcccagcagc 329

---

>dbj|AK088040.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430002L09
           product:H2A histone family, member X, full insert
           sequence
          Length = 1379

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
           ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||| ||||
Sbjct: 428 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 369

                      
Query: 324 cggccagcagc 334
           || ||||||||
Sbjct: 368 cgcccagcagc 358

---

>dbj|AK008124.1| Mus musculus adult male small intestine cDNA, RIKEN full-length
           enriched library, clone:2010005I09 product:H2A histone
           family, member X, full insert sequence
          Length = 564

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
           ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||| ||||
Sbjct: 425 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 366

                      
Query: 324 cggccagcagc 334
           || ||||||||
Sbjct: 365 cgcccagcagc 355

---

>ref|XM_478632.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 823

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 380 ggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctc 429
           ||||||||||||| ||||||||||||| | || |||||||||||||||||
Sbjct: 394 ggcacgatgcgggtcttcttgttgtccctcgccgcgttcccggcgagctc 345

---

>emb|CR673199.2|CNS0FIET Tetraodon nigroviridis full-length cDNA
          Length = 775

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 140/174 (80%), Gaps = 1/174 (0%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| ||||||||||  | ||||||||||||||||||||| || |||||||
Sbjct: 402 cggtcttcttgggcagcagcaccgcctggatgttgggcagcacgccgccctgagcgatgg 343

                                                                       
Query: 318 tgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcc 377
           | || ||  |||||||| |   |||||||| |||||| | ||| || ||  ||||||| |
Sbjct: 342 tcactcctcccagcagcttgttgagctcctcgtcgttgcgcaccgccagctgcaggtggc 283

                                                                 
Query: 378 tgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctcca 431
            ||| | ||||||||  |||||||||||   ||| ||||| ||||| |||||||
Sbjct: 282 gggggatgatgcggg-tttcttgttgtcgcgggcagcgttgccggccagctcca 230

---

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                                  
Query: 380      ggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctc 429
                ||||||||||||| ||||||||||||| | || |||||||||||||||||
Sbjct: 21536909 ggcacgatgcgggtcttcttgttgtccctcgccgcgttcccggcgagctc 21536860



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                                   
Query: 379      gggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctc 429
                |||||| ||||||| ||||||||||||| | || |||||||||||||||||
Sbjct: 21539549 gggcactatgcgggtcttcttgttgtccctcgccgcgttcccggcgagctc 21539499

---

>dbj|AP003838.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1582_D10
          Length = 103475

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                               
Query: 380   ggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctc 429
             ||||||||||||| ||||||||||||| | || |||||||||||||||||
Sbjct: 74693 ggcacgatgcgggtcttcttgttgtccctcgccgcgttcccggcgagctc 74644



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                                
Query: 379   gggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctc 429
             |||||| ||||||| ||||||||||||| | || |||||||||||||||||
Sbjct: 77333 gggcactatgcgggtcttcttgttgtccctcgccgcgttcccggcgagctc 77283

---

>dbj|AK099888.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013112I10, full
           insert sequence
          Length = 823

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 380 ggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctc 429
           ||||||||||||| ||||||||||||| | || |||||||||||||||||
Sbjct: 394 ggcacgatgcgggtcttcttgttgtccctcgccgcgttcccggcgagctc 345

---

>dbj|AK071511.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023096P04, full
           insert sequence
          Length = 824

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 118/146 (80%)
 Strand = Plus / Minus

                                                                       
Query: 286 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagcctcccgagctc 345
           |||||||||||  |||||||||   ||||||||| ||||| | |||||| |   ||||||
Sbjct: 454 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 395

                                                                       
Query: 346 ctggtcgttcctcacggcgaggagcaggtgcctgggcacgatgcgggacttcttgttgtc 405
           || |||||| | ||| |||||  | | ||| |  ||||| ||||||| ||||||||||||
Sbjct: 394 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 335

                                     
Query: 406 cttggcggcgttcccggcgagctcca 431
           | | || |||||||||||||||||||
Sbjct: 334 cctcgccgcgttcccggcgagctcca 309

---

>dbj|AK058913.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-009-A01, full
           insert sequence
          Length = 733

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 118/146 (80%)
 Strand = Plus / Minus

                                                                       
Query: 286 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagcctcccgagctc 345
           |||||||||||  |||||||||   ||||||||| ||||| | |||||| |   ||||||
Sbjct: 453 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 394

                                                                       
Query: 346 ctggtcgttcctcacggcgaggagcaggtgcctgggcacgatgcgggacttcttgttgtc 405
           || |||||| | ||| |||||  | | ||| |  ||||| ||||||| ||||||||||||
Sbjct: 393 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 334

                                     
Query: 406 cttggcggcgttcccggcgagctcca 431
           | | || |||||||||||||||||||
Sbjct: 333 cctcgccgcgttcccggcgagctcca 308

---

>dbj|AK058540.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-017-B06, full
           insert sequence
          Length = 1718

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 380 ggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctc 429
           ||||||||||||| ||||||||||||| | || |||||||||||||||||
Sbjct: 395 ggcacgatgcgggtcttcttgttgtccctcgccgcgttcccggcgagctc 346

---

>emb|AL731753.2|CNS08C82 Oryza sativa chromosome 12, . BAC OJ1112_B07 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 118101

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 118/146 (80%)
 Strand = Plus / Minus

                                                                         
Query: 286   gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagcctcccgagctc 345
             |||||||||||  |||||||||   ||||||||| ||||| | |||||| |   ||||||
Sbjct: 48743 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 48684

                                                                         
Query: 346   ctggtcgttcctcacggcgaggagcaggtgcctgggcacgatgcgggacttcttgttgtc 405
             || |||||| | ||| |||||  | | ||| |  ||||| ||||||| ||||||||||||
Sbjct: 48683 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 48624

                                       
Query: 406   cttggcggcgttcccggcgagctcca 431
             | | || |||||||||||||||||||
Sbjct: 48623 cctcgccgcgttcccggcgagctcca 48598

---

>ref|NM_178185.1| Mus musculus histone 1, H2ao (Hist1h2ao), mRNA
          Length = 393

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence
          Length = 209720

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                         
Query: 258   cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
             ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 64633 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 64574

                              
Query: 318   tgacgccggccagcagc 334
             | |||| | ||||||||
Sbjct: 64573 tcacgcggcccagcagc 64557



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                         
Query: 258   cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
             ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 60544 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 60603

                              
Query: 318   tgacgccggccagcagc 334
             | |||| | ||||||||
Sbjct: 60604 tcacgcggcccagcagc 60620



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                          
Query: 258    cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
              ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 101104 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 101163

                    
Query: 318    tgacgc 323
              | ||||
Sbjct: 101164 tcacgc 101169

---

>ref|NG_002734.1| Mus musculus histone 1, H2aj (Hist1h2aj) pseudogene on chromosome
           13
          Length = 1357

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 846 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 787

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 786 tcacgcggcccagcagc 770

---

>ref|XM_545430.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488308), mRNA
          Length = 456

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 427 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 368

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 367 tcacgcggcccagcagc 351

---

>ref|XM_849168.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC611496), mRNA
          Length = 393

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>ref|XM_545413.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488291), mRNA
          Length = 387

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>ref|XM_545411.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488289),
           mRNA
          Length = 393

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>ref|XM_545400.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488278), mRNA
          Length = 576

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>ref|XM_545394.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488272), mRNA
          Length = 393

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>ref|XM_848774.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC611132),
           mRNA
          Length = 393

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>ref|XM_848759.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488270), mRNA
          Length = 462

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 433 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 374

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 373 tcacgcggcccagcagc 357

---

>ref|XM_545384.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488262), mRNA
          Length = 393

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>ref|XM_848716.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC611082),
           mRNA
          Length = 393

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>ref|XM_545376.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488254), mRNA
          Length = 417

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 388 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 329

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 328 tcacgcggcccagcagc 312

---

>ref|XM_545373.1| PREDICTED: Canis familiaris similar to histone H2A (LOC488251),
           mRNA
          Length = 396

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>ref|XM_854341.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l),
           transcript variant 2 (LOC488268), mRNA
          Length = 402

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>ref|XM_545390.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l),
           transcript variant 1 (LOC488268), mRNA
          Length = 393

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>ref|XM_978341.1| PREDICTED: Mus musculus similar to histone 2a, transcript variant 2
           (LOC665433), mRNA
          Length = 465

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 396 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 337

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 336 tcacgcggcccagcagc 320

---

>ref|XM_978296.1| PREDICTED: Mus musculus similar to histone 2a, transcript variant 1
           (LOC665433), mRNA
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 398 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 339

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 338 tcacgcggcccagcagc 322

---

>ref|XM_539322.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC482203),
           mRNA
          Length = 393

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>gb|BC058544.1| Mus musculus cDNA clone IMAGE:5711765, with apparent retained
           intron
          Length = 497

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 395 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 336

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 335 tcacgcggcccagcagc 319

---

>emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143
          Length = 3210

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                        
Query: 258  cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
            ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 1937 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 1878

                             
Query: 318  tgacgccggccagcagc 334
            | |||| | ||||||||
Sbjct: 1877 tcacgcggcccagcagc 1861

---

>emb|X59962.1|RNTH2AB R.norvegicus genes for TH2A and TH2B histones
          Length = 1653

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                        
Query: 258  cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
            ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 1500 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 1441

                             
Query: 318  tgacgccggccagcagc 334
            | |||| | ||||||||
Sbjct: 1440 tcacgcggcccagcagc 1424

---

>emb|X59961.1|RNH2AB R.norvegicus genes for H2A and H2B histones
          Length = 1635

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                        
Query: 258  cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
            ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 1246 cggtcttcttgggcagcagcacagcctggatgttgggcagaacgccgccctgcgcgatgg 1187

                             
Query: 318  tgacgccggccagcagc 334
            | |||| | ||||||||
Sbjct: 1186 tcacgcggcccagcagc 1170

---

>emb|X05863.1|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B)
          Length = 1826

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                        
Query: 258  cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
            ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 1312 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 1253

                             
Query: 318  tgacgccggccagcagc 334
            | |||| | ||||||||
Sbjct: 1252 tcacgcggcccagcagc 1236

---

>emb|X05862.1|MMHIS2BA Mouse H2B and H2A histone genes (291A)
          Length = 1797

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                        
Query: 258  cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
            ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 1313 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 1254

                             
Query: 318  tgacgccggccagcagc 334
            | |||| | ||||||||
Sbjct: 1253 tcacgcggcccagcagc 1237

---

>gb|BC099406.1| Mus musculus histone 1, H2ac, mRNA (cDNA clone MGC:117571
           IMAGE:30789778), complete cds
          Length = 1075

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 374 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 315

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 314 tcacgcggcccagcagc 298

---

>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a
              novel gene, the genes for three H1, four H2a, five H2b,
              four H3 and four H4 histone family members, the 3' end of a
              variant of the Hfe gene for hemochromatosis protein (Mr2)
              and ten CpG islands, complete sequence
          Length = 184730

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                          
Query: 258    cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
              ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 163969 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 164028

                               
Query: 318    tgacgccggccagcagc 334
              | |||| | ||||||||
Sbjct: 164029 tcacgcggcccagcagc 164045



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                         
Query: 258   cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
             ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 55440 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 55381

                              
Query: 318   tgacgccggccagcagc 334
             | |||| | ||||||||
Sbjct: 55380 tcacgcggcccagcagc 55364



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                         
Query: 258   cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
             ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 51351 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 51410

                              
Query: 318   tgacgccggccagcagc 334
             | |||| | ||||||||
Sbjct: 51411 tcacgcggcccagcagc 51427



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                         
Query: 258   cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
             ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 14876 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 14817

                   
Query: 318   tgacgc 323
             | ||||
Sbjct: 14816 tcacgc 14811

---

>ref|NM_178189.2| Mus musculus histone 1, H2ac (Hist1h2ac), mRNA
          Length = 2493

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 408 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 349

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 348 tcacgcggcccagcagc 332

---

>emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chromosome 13 Contains the
             genes for H2b histone family member A, two H2a, two H4 and
             an H2b histone family member, a serine/threonine protein
             kinase pseudogene, a novel pseudogene, a novel gene
             (4930500C15Rik), the gene for a novel KRAB box and C2H2
             Zinc Finger containing protein, a ribosomal protein L21
             (RPL21) pseudogene, a TU mitochondrial translation
             elongation factor (tufa) pseudogene, the 5' end of the
             gene for a novel protein similar to nuclear envelope pore
             membrane protein POM121 and four CpG islands, complete
             sequence
          Length = 182817

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                         
Query: 258   cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
             ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 33279 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 33338

                              
Query: 318   tgacgccggccagcagc 334
             | |||| | ||||||||
Sbjct: 33339 tcacgcggcccagcagc 33355



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                         
Query: 258   cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
             ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 10997 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 10938

                              
Query: 318   tgacgccggccagcagc 334
             | |||| | ||||||||
Sbjct: 10937 tcacgcggcccagcagc 10921

---

>emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chromosome 13 Contains the
             3' end of the gene for a novel protein similar to nuclear
             envelope pore membrane protein POM121, the Prss16 gene for
             thymus serine protease16, three novel genes, the genes for
             two H2a, two H2b and one H4 histone family members, a
             ribosomal protein L37A (Rpl37a) pseudogene, a novel
             pseudogene, three genes for novel vomeronasal 1 receptor H
             (V1rh) family members, the gene for a novel vomeronasal 1
             receptor I (V1ri) family member, six V1ri pseudogenes, a
             V1rh pseudogene and six CpG islands, complete sequence
          Length = 210845

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                         
Query: 258   cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
             ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 59920 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 59979

                              
Query: 318   tgacgccggccagcagc 334
             | |||| | ||||||||
Sbjct: 59980 tcacgcggcccagcagc 59996



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                         
Query: 258   cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
             ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 52545 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 52604

                              
Query: 318   tgacgccggccagcagc 334
             | |||| | ||||||||
Sbjct: 52605 tcacgcggcccagcagc 52621

---

>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five
              genes for olfactory receptors, a novel gene, the H1f5 gene
              for H1 histone family member 5, three genes and one
              pseudogene for H2a histone family members, four genes for
              H2b, two genes for H4, and two genes for H3 histone family
              members and seven CpG islands, complete sequence
          Length = 222823

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                          
Query: 258    cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
              ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 174454 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 174513

                               
Query: 318    tgacgccggccagcagc 334
              | |||| | ||||||||
Sbjct: 174514 tcacgcggcccagcagc 174530



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                          
Query: 258    cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
              ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 142446 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 142505

                               
Query: 318    tgacgccggccagcagc 334
              | |||| | ||||||||
Sbjct: 142506 tcacgcggcccagcagc 142522



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                          
Query: 258    cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
              ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 137775 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 137716

                               
Query: 318    tgacgccggccagcagc 334
              | |||| | ||||||||
Sbjct: 137715 tcacgcggcccagcagc 137699



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                               
Query: 286    gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 334
              |||||||||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 207873 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 207921

---

>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the
              Slc17a1 gene for solute carrier family 17 (vesicular
              glutamate transporter) member 1, two genes for novel solute
              carrier family 17 (Slc17) members, two novel genes, the
              gene for a novel C3HC4 type zinc finger (ring finger)
              protein, the gene for an H2a, an H2b, two genes for H3 and
              two genes for H4 histone family members, a H2a histone
              family pseudogene, the H1f1 and  H1f2 genes for H1 histone
              family members 1 and 2, the H3f2 gene for H3 histone
              family, member 2 (H3.2), a novel pseudogene, the Hfe gene
              for hemochromatosis protein (Mr2) and two CpG islands,
              complete sequence
          Length = 186062

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                          
Query: 258    cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
              ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 142184 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 142125

                               
Query: 318    tgacgccggccagcagc 334
              | |||| | ||||||||
Sbjct: 142124 tcacgcggcccagcagc 142108



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                          
Query: 258    cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
              ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 136882 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 136941

                               
Query: 318    tgacgccggccagcagc 334
              | |||| | ||||||||
Sbjct: 136942 tcacgcggcccagcagc 136958

---

>gb|BC065803.1| Mus musculus histone 1, H2ag, mRNA (cDNA clone MGC:73771
           IMAGE:1263745), complete cds
          Length = 527

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 386 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 327

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 326 tcacgcggcccagcagc 310

---

>gb|BC076498.1| Mus musculus histone 1, H2ae, mRNA (cDNA clone MGC:90847
           IMAGE:5713252), complete cds
          Length = 492

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 394 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 335

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 334 tcacgcggcccagcagc 318

---

>dbj|AK145443.1| Mus musculus 5 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:I0C0045N09 product:histone 1,
           H2ad, full insert sequence
          Length = 446

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 397 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 338

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 337 tcacgcggcccagcagc 321

---

>dbj|AK146117.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
           clone:I730004H15 product:histone 1, H2ai, full insert
           sequence
          Length = 1396

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 67/77 (87%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 375 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 316

                            
Query: 318 tgacgccggccagcagc 334
           | ||| |||||||||||
Sbjct: 315 tcacg-cggccagcagc 300

---

>dbj|AK146846.1| Mus musculus 17 days embryo heart cDNA, RIKEN full-length enriched
           library, clone:I920064A15 product:histone 1, H2ad, full
           insert sequence
          Length = 445

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 395 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 336

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 335 tcacgcggcccagcagc 319

---

>ref|NM_175660.2| Mus musculus histone 1, H2ab (Hist1h2ab), mRNA
          Length = 506

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 409 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 350

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 349 tcacgcggcccagcagc 333

---

>gb|BC090402.1| Mus musculus cDNA clone MGC:103288 IMAGE:5150365, complete cds
          Length = 447

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 376 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 317

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 316 tcacgcggcccagcagc 300

---

>gb|BC062251.1| Mus musculus cDNA clone MGC:73635 IMAGE:1224905, complete cds
          Length = 444

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 376 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 317

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 316 tcacgcggcccagcagc 300

---

>gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016
          Length = 2110

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 634 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 575

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 574 tcacgcggcccagcagc 558

---

>gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108
          Length = 2221

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 632 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 573

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 572 tcacgcggcccagcagc 556

---

>ref|NM_178186.2| Mus musculus histone 1, H2ag (Hist1h2ag), mRNA
          Length = 527

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 386 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 327

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 326 tcacgcggcccagcagc 310

---

>ref|NM_178187.2| Mus musculus histone 1, H2ae (Hist1h2ae), mRNA
          Length = 705

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 477 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 418

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 417 tcacgcggcccagcagc 401

---

>ref|NM_178188.3| Mus musculus histone 1, H2ad (Hist1h2ad), mRNA
          Length = 393

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone H2a.1-F (H2a-F), histone
            H2b-F (H2b-F) genes, complete cds
          Length = 2822

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                        
Query: 258  cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
            ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 1465 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 1524

                             
Query: 318  tgacgccggccagcagc 334
            | |||| | ||||||||
Sbjct: 1525 tcacgcggcccagcagc 1541

---

>dbj|AK028026.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
           enriched library, clone:1190022L06 product:HISTONE H2A
           homolog [Homo sapiens], full insert sequence
          Length = 705

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 477 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 418

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 417 tcacgcggcccagcagc 401

---

>dbj|AK033518.1| Mus musculus adult male colon cDNA, RIKEN full-length enriched
           library, clone:9030420B16 product:histone 1, H2ac, full
           insert sequence
          Length = 2493

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 408 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 349

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 348 tcacgcggcccagcagc 332

---

>ref|NM_021839.1| Rattus norvegicus testis-specific histone 2a (Hist1h2aa), mRNA
          Length = 393

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>ref|NM_178183.1| Mus musculus histone 1, H2ak (Hist1h2ak), mRNA
          Length = 393

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>ref|NM_178182.1| Mus musculus histone 1, H2ai (Hist1h2ai), mRNA
          Length = 393

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>gb|AY158920.1| Mus musculus histone protein Hist1h2ab gene, complete cds
          Length = 1390

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 864 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 805

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 804 tcacgcggcccagcagc 788

---

>gb|AY158919.1| Mus musculus histone protein Hist1h2ac gene, complete cds
          Length = 1390

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 864 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 805

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 804 tcacgcggcccagcagc 788

---

>gb|AY158918.1| Mus musculus histone protein Hist1h2ad gene, complete cds
          Length = 1390

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 864 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 805

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 804 tcacgcggcccagcagc 788

---

>gb|AY158917.1| Mus musculus histone protein Hist1h2ae gene, complete cds
          Length = 1390

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 864 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 805

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 804 tcacgcggcccagcagc 788

---

>gb|AY158915.1| Mus musculus histone protein Hist1h2ag gene, complete cds
          Length = 1392

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 863 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 804

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 803 tcacgcggcccagcagc 787

---

>gb|AY158914.1| Mus musculus histone protein Hist1h2ah gene, complete cds
          Length = 1381

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 861 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 802

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 801 tcacgcggcccagcagc 785

---

>gb|AY158913.1| Mus musculus histone protein Hist1h2ao gene, complete cds
          Length = 1390

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 864 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 805

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 804 tcacgcggcccagcagc 788

---

>gb|AY158911.1| Mus musculus histone protein Hist1h2ak gene, complete cds
          Length = 1201

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 898 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 839

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 838 tcacgcggcccagcagc 822

---

>gb|AY158910.1| Mus musculus histone protein Hist1h2aj pseudogene, partial sequence
          Length = 1357

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 846 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 787

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 786 tcacgcggcccagcagc 770

---

>gb|AY158909.1| Mus musculus histone protein Hist1h2ai gene, complete cds
          Length = 1387

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 861 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 802

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 801 tcacgcggcccagcagc 785

---

>ref|NM_175659.1| Mus musculus histone 1, H2ah (Hist1h2ah), mRNA
          Length = 387

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>gb|U95111.1|MSU95111 Mus spretus histone H2a pseudogene, complete sequence
          Length = 567

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 427 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 368

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 367 tcacgcggcccagcagc 351

---

>gb|M33988.1|MUSH2AX1 Mouse histone H2A.1 gene, complete cds
          Length = 929

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 527 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 468

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 467 tcacgcggcccagcagc 451

---

>gb|M37736.1|MUSHIS2AR Mouse replication-dependent histone H2A.1 gene
          Length = 668

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 487 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 428

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 427 tcacgcggcccagcagc 411

---

>gb|BC106331.1| Xenopus laevis cDNA clone MGC:130860 IMAGE:7205580, complete cds
          Length = 799

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 128/160 (80%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
           |||||||||||||||| |  | |||||||||||| || ||||| || ||||||||||| |
Sbjct: 370 tcttggggagcagcacagactggatgttgggcaggacaccgccctgggcgatggtgaccc 311

                                                                       
Query: 324 cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 383
           |  | |||||  |   |||||||| |||||| | |||||||||  ||||||||||||| |
Sbjct: 310 ctccgagcagtttgttgagctcctcgtcgttgcgcacggcgagctgcaggtgcctgggga 251

                                                   
Query: 384 cgatgcgggacttcttgttgtccttggcggcgttcccggc 423
            ||| || | ||||||||| |||  ||| ||||| |||||
Sbjct: 250 tgatccgagtcttcttgttatcccgggcagcgttgccggc 211

---

>gb|AF377946.3| Oryza sativa (japonica cultivar-group) chromosome 3, BAC clone
             OSJNBa0031O09, complete sequence
          Length = 161339

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 134/168 (79%)
 Strand = Plus / Minus

                                                                         
Query: 264   tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
             ||||||| ||||| ||| | | ||||||||||||||||||||||   ||||| |||||| 
Sbjct: 38482 tcttgggaagcaggacctgctggatgttgggcagcacgccgccggcggcgatcgtgacgg 38423

                                                                         
Query: 324   cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 383
              | |||||||||| |  ||||||| |||||| | ||| || ||  | | |||||  ||||
Sbjct: 38422 tgcccagcagcctgctcagctcctcgtcgttgcgcaccgccagctggatgtgccgcggca 38363

                                                             
Query: 384   cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctcca 431
             |||| | |  ||||||||||||| | || ||||||||||| |||||||
Sbjct: 38362 cgatcctgttcttcttgttgtccctcgccgcgttcccggccagctcca 38315

---

>gb|AC146936.4| Oryza sativa (japonica cultivar-group) chromosome 3 clone B1154F06 map
              near C10769, complete sequence
          Length = 194856

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 134/168 (79%)
 Strand = Plus / Plus

                                                                          
Query: 264    tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
              ||||||| ||||| ||| | | ||||||||||||||||||||||   ||||| |||||| 
Sbjct: 140950 tcttgggaagcaggacctgctggatgttgggcagcacgccgccggcggcgatcgtgacgg 141009

                                                                          
Query: 324    cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 383
               | |||||||||| |  ||||||| |||||| | ||| || ||  | | |||||  ||||
Sbjct: 141010 tgcccagcagcctgctcagctcctcgtcgttgcgcaccgccagctggatgtgccgcggca 141069

                                                              
Query: 384    cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctcca 431
              |||| | |  ||||||||||||| | || ||||||||||| |||||||
Sbjct: 141070 cgatcctgttcttcttgttgtccctcgccgcgttcccggccagctcca 141117

---

>gb|AC147426.2| Oryza sativa chromosome 3  B1377B10 genomic sequence, complete sequence
          Length = 184366

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 134/168 (79%)
 Strand = Plus / Minus

                                                                          
Query: 264    tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
              ||||||| ||||| ||| | | ||||||||||||||||||||||   ||||| |||||| 
Sbjct: 181636 tcttgggaagcaggacctgctggatgttgggcagcacgccgccggcggcgatcgtgacgg 181577

                                                                          
Query: 324    cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 383
               | |||||||||| |  ||||||| |||||| | ||| || ||  | | |||||  ||||
Sbjct: 181576 tgcccagcagcctgctcagctcctcgtcgttgcgcaccgccagctggatgtgccgcggca 181517

                                                              
Query: 384    cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctcca 431
              |||| | |  ||||||||||||| | || ||||||||||| |||||||
Sbjct: 181516 cgatcctgttcttcttgttgtccctcgccgcgttcccggccagctcca 181469

---

>ref|XM_868674.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC616611), mRNA
          Length = 393

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 56/64 (87%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| ||||||||||  | |||||||||||| |||||||| || |||||||
Sbjct: 364 cggtcttcttgggcagcagcaccgcctggatgttgggcaggacgccgccctgagcgatgg 305

               
Query: 318 tgac 321
           ||||
Sbjct: 304 tgac 301

---

>ref|XM_543796.2| PREDICTED: Canis familiaris similar to H2A histone family, member J
           isoform 2 (LOC486669), mRNA
          Length = 598

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 56/64 (87%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 442 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 383

               
Query: 318 tgac 321
           ||||
Sbjct: 382 tgac 379

---

>emb|X94693.1|TAH2A254 T.aestivum histone H2A gene
          Length = 2241

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                                
Query: 380  ggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctcca 431
            |||||||| |||| ||||||||||||| |||||||||| ||||| |||||||
Sbjct: 1613 ggcacgatacgggtcttcttgttgtccctggcggcgtttccggccagctcca 1562

---

>emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A with genes H1A, H2B, H3
            and H4
          Length = 8592

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 128/160 (80%)
 Strand = Plus / Minus

                                                                        
Query: 264  tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
            |||||||||||||||| |  | |||||||||||| || ||||| || ||||||||||| |
Sbjct: 4729 tcttggggagcagcacagactggatgttgggcaggacaccgccctgggcgatggtgaccc 4670

                                                                        
Query: 324  cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 383
            |  | |||||  |   |||||||| |||||| | |||||||||  ||||||||||||| |
Sbjct: 4669 ctccgagcagtttgttgagctcctcgtcgttgcgcacggcgagctgcaggtgcctgggga 4610

                                                    
Query: 384  cgatgcgggacttcttgttgtccttggcggcgttcccggc 423
             ||| || | ||||||||| |||  ||| ||||| |||||
Sbjct: 4609 tgatccgagtcttcttgttatcccgggcagcgttgccggc 4570

---

>gb|L75824.1|WHTHIH2AA Triticum aestivum histone H2A gene, complete cds
          Length = 2241

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                                
Query: 380  ggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctcca 431
            |||||||| |||| ||||||||||||| |||||||||| ||||| |||||||
Sbjct: 1613 ggcacgatacgggtcttcttgttgtccctggcggcgtttccggccagctcca 1562

---

>ref|XM_576399.1| PREDICTED: Rattus norvegicus similar to Histone H2A.x (H2a/x)
           (LOC500987), mRNA
          Length = 1569

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 259 ggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggt 318
           |||| ||||||| |||||||| |  | |||||||||||| |||||||| |||||||| ||
Sbjct: 642 ggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatagt 583

                           
Query: 319 gacgccggccagcagc 334
            |||||| ||||||||
Sbjct: 582 cacgccgcccagcagc 567

---

>dbj|AK064299.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-107-A07, full
           insert sequence
          Length = 724

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 134/168 (79%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
           ||||||| ||||| ||| | | ||||||||||||||||||||||   ||||| |||||| 
Sbjct: 474 tcttgggaagcaggacctgctggatgttgggcagcacgccgccggcggcgatcgtgacgg 415

                                                                       
Query: 324 cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 383
            | |||||||||| |  ||||||| |||||| | ||| || ||  | | |||||  ||||
Sbjct: 414 tgcccagcagcctgctcagctcctcgtcgttgcgcaccgccagctggatgtgccgcggca 355

                                                           
Query: 384 cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctcca 431
           |||| | |  ||||||||||||| | || ||||||||||| |||||||
Sbjct: 354 cgatcctgttcttcttgttgtccctcgccgcgttcccggccagctcca 307

---

>gb|U70133.1|BBU70133 Bufo bufo gagarizans replication-dependent histone H2A mRNA,
           complete cds
          Length = 466

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 134/168 (79%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
           ||||||| |||||||| |  | |||||||||||| || || || || ||||||||||| |
Sbjct: 379 tcttgggcagcagcacggcctggatgttgggcaggacccccccctgggcgatggtgactc 320

                                                                       
Query: 324 cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 383
           || |||||||| |   |||||||| |||||| | |||||| ||  ||||||| | ||| |
Sbjct: 319 cgcccagcagcttgttgagctcctcgtcgttgcgcacggccagctgcaggtgacggggga 260

                                                           
Query: 384 cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctcca 431
            |||||| | ||||||||||||   |||||| || ||||| |||||||
Sbjct: 259 tgatgcgagtcttcttgttgtcgcgggcggcattgccggccagctcca 212

---

>gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 genes, complete cds, and
            histone H3 gene, 3' end, gene cluster X1h3
          Length = 8608

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 128/160 (80%)
 Strand = Plus / Minus

                                                                        
Query: 264  tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
            |||||||||||||||| |  | |||||||||||| || ||||| || ||||||||||| |
Sbjct: 4746 tcttggggagcagcacagactggatgttgggcaggacaccgccctgggcgatggtgaccc 4687

                                                                        
Query: 324  cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 383
            |  | |||||  |   |||||||| |||||| | |||||||||  ||||||||||||| |
Sbjct: 4686 ctccgagcagtttgttgagctcctcgtcgttgcgcacggcgagctgcaggtgcctgggga 4627

                                                    
Query: 384  cgatgcgggacttcttgttgtccttggcggcgttcccggc 423
             ||| || | ||||||||| |||  ||| ||||| |||||
Sbjct: 4626 tgatccgagtcttcttgttatcccgggcagcgttgccggc 4587

---

>ref|NM_021840.2| Rattus norvegicus histone 2a (H2a), mRNA
          Length = 1579

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
           ||||||| |||| |||||  | |||||||||||| |||||||| ||||||||||| ||||
Sbjct: 363 tcttgggcagcaacaccgcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 304

                      
Query: 324 cggccagcagc 334
            | ||||||||
Sbjct: 303 ggcccagcagc 293

---

>ref|XM_478633.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 830

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 379 gggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctc 429
           |||||| ||||||| ||||||||||||| | || |||||||||||||||||
Sbjct: 401 gggcactatgcgggtcttcttgttgtccctcgccgcgttcccggcgagctc 351

---

>gb|BC099140.1| Rattus norvegicus histone 2a, mRNA (cDNA clone MGC:116285
           IMAGE:7457173), complete cds
          Length = 1579

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
           ||||||| |||| |||||  | |||||||||||| |||||||| ||||||||||| ||||
Sbjct: 363 tcttgggcagcaacaccgcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 304

                      
Query: 324 cggccagcagc 334
            | ||||||||
Sbjct: 303 ggcccagcagc 293

---

>emb|BX063165.1|CNS09KWH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 902

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
           ||||||| |||||||| |  | ||||||||||||||||||||| || |||||||| || |
Sbjct: 526 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcaccc 585

                      
Query: 324 cggccagcagc 334
           ||| |||||||
Sbjct: 586 cggacagcagc 596

---

>emb|BX063164.1|CNS09KWG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 924

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
           ||||||| |||||||| |  | ||||||||||||||||||||| || |||||||| || |
Sbjct: 475 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcaccc 416

                      
Query: 324 cggccagcagc 334
           ||| |||||||
Sbjct: 415 cggacagcagc 405

---

>emb|BX040864.1|CNS093P0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC11DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
           ||||||| |||||||| |  | ||||||||||||||||||||| || |||||||| || |
Sbjct: 468 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcaccc 409

                      
Query: 324 cggccagcagc 334
           ||| |||||||
Sbjct: 408 cggacagcagc 398

---

>emb|BX019683.1|CNS08NCN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3AB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 651

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
           ||||||| |||||||| |  | ||||||||||||||||||||| || |||||||| || |
Sbjct: 479 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcaccc 420

                      
Query: 324 cggccagcagc 334
           ||| |||||||
Sbjct: 419 cggacagcagc 409

---

>emb|BX016452.1|CNS08KUW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24CG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 594

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
           ||||||| |||||||| |  | ||||||||||||||||||||| || |||||||| || |
Sbjct: 76  tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcaccc 135

                      
Query: 324 cggccagcagc 334
           ||| |||||||
Sbjct: 136 cggacagcagc 146

---

>emb|BX016451.1|CNS08KUV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24CG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 556

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
           ||||||| |||||||| |  | ||||||||||||||||||||| || |||||||| || |
Sbjct: 402 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcaccc 343

                      
Query: 324 cggccagcagc 334
           ||| |||||||
Sbjct: 342 cggacagcagc 332

---

>emb|BX009846.1|CNS08FRE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 357

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
           ||||||| |||||||| |  | ||||||||||||||||||||| || |||||||| || |
Sbjct: 119 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcaccc 178

                      
Query: 324 cggccagcagc 334
           ||| |||||||
Sbjct: 179 cggacagcagc 189

---

>ref|XM_225386.2| PREDICTED: Rattus norvegicus histone 1, H2an (predicted)
           (Hist1h2an_predicted), mRNA
          Length = 546

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
           ||||||| ||||||||||  | |||||||||||| |||||||| || |||||||| ||||
Sbjct: 358 tcttgggcagcagcaccgcctggatgttgggcaggacgccgccctgtgcgatggtcacgc 299

                      
Query: 324 cggccagcagc 334
            | ||||||||
Sbjct: 298 ggcccagcagc 288

---

>ref|XM_551996.1| Anopheles gambiae str. PEST ENSANGP00000029020
           (ENSANGG00000023190), partial mRNA
          Length = 297

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
           ||||||| |||||||| |  | ||||||||||||||||||||| || |||||||| || |
Sbjct: 277 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcaccc 218

                      
Query: 324 cggccagcagc 334
           ||| |||||||
Sbjct: 217 cggacagcagc 207

---

>ref|XM_314447.2| Anopheles gambiae str. PEST ENSANGP00000016040
           (ENSANGG00000013551), partial mRNA
          Length = 375

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
           ||||||| |||||||| |  | ||||||||||||||||||||| || |||||||| || |
Sbjct: 355 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcaccc 296

                      
Query: 324 cggccagcagc 334
           ||| |||||||
Sbjct: 295 cggacagcagc 285

---

>ref|XM_306256.1| Anopheles gambiae str. PEST ENSANGP00000000004
           (ENSANGG00000000004), mRNA
          Length = 630

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
           ||||||| |||||||| |  | ||||||||||||||||||||| || |||||||| || |
Sbjct: 469 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcaccc 410

                      
Query: 324 cggccagcagc 334
           ||| |||||||
Sbjct: 409 cggacagcagc 399

---

>dbj|AK059228.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-024-D11, full
           insert sequence
          Length = 830

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 379 gggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctc 429
           |||||| ||||||| ||||||||||||| | || |||||||||||||||||
Sbjct: 401 gggcactatgcgggtcttcttgttgtccctcgccgcgttcccggcgagctc 351

---

>emb|X14730.1|CMHIST2A Duck H2A histone gene
          Length = 845

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgac 321
           ||||||| |||||||| |  | ||||||||||||||| ||||| ||||||||||||||
Sbjct: 508 tcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtgac 451

---

>emb|X02622.1|MMHISHSA Mouse gene fragment for histone H2a
          Length = 204

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 85  cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 26

                 
Query: 318 tgacgc 323
           | ||||
Sbjct: 25  tcacgc 20

---

>gb|AY158916.1| Mus musculus histone protein Hist1h2af gene, complete cds
          Length = 1390

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 888 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 829

                 
Query: 318 tgacgc 323
           | ||||
Sbjct: 828 tcacgc 823

---

>ref|NM_175661.1| Mus musculus histone 1, H2af (Hist1h2af), mRNA
          Length = 393

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                 
Query: 318 tgacgc 323
           | ||||
Sbjct: 304 tcacgc 299

---

>gb|U95112.1|MCU95112 Mus caroli histone H2a pseudogene, complete sequence
          Length = 468

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 330 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 271

                 
Query: 318 tgacgc 323
           | ||||
Sbjct: 270 tcacgc 265

---

>ref|NM_178218.2| Mus musculus histone 3, H2a (Hist3h2a), mRNA
          Length = 1991

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 286 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 334
           |||||||||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 390 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 342

---

>ref|XM_425469.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427895),
           mRNA
          Length = 390

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 305

            
Query: 318 t 318
           |
Sbjct: 304 t 304

---

>ref|XM_425465.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427891),
           mRNA
          Length = 390

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 305

            
Query: 318 t 318
           |
Sbjct: 304 t 304

---

>ref|XM_425459.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427885),
           mRNA
          Length = 918

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 305

            
Query: 318 t 318
           |
Sbjct: 304 t 304

---

>ref|XM_425455.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427881),
           mRNA
          Length = 534

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| ||||||||||
Sbjct: 508 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 449

            
Query: 318 t 318
           |
Sbjct: 448 t 448

---

>ref|XM_416195.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC417955), mRNA
          Length = 1220

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                        
Query: 258  cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
            ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| ||||||||||
Sbjct: 1194 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 1135

             
Query: 318  t 318
            |
Sbjct: 1134 t 1134

---

>ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1
            (LOC417953), mRNA
          Length = 2271

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 53/61 (86%)
 Strand = Plus / Plus

                                                                        
Query: 258  cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
            ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| ||||||||||
Sbjct: 1167 cggtcttcttgggcagcagcacagcctggatgttgggcagcaccccgccctgcgcgatgg 1226

             
Query: 318  t 318
            |
Sbjct: 1227 t 1227

---

>ref|XM_416192.1| PREDICTED: Gallus gallus similar to germinal histone H4 gene
           (LOC417952), mRNA
          Length = 1374

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 53/61 (86%)
 Strand = Plus / Plus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| ||||||||||
Sbjct: 726 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 785

            
Query: 318 t 318
           |
Sbjct: 786 t 786

---

>gb|BC063781.1| Mus musculus histone 3, H2a, mRNA (cDNA clone MGC:70265
           IMAGE:6493838), complete cds
          Length = 1607

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 286 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 334
           |||||||||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 356 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 308

---

>gb|BC058119.1| Mus musculus histone 3, H2a, mRNA (cDNA clone IMAGE:6819179), with
           apparent retained intron
          Length = 1490

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 286 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 334
           |||||||||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 362 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 314

---

>emb|BX007458.1|CNS08DX2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12BG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 349

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 286 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 334
           ||||||||||||||||||||| || |||||||| || |||| |||||||
Sbjct: 141 gatgttgggcagcacgccgccctgggcgatggtcaccccggacagcagc 93

---

>emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4 and a histone H3 gene
          Length = 8384

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                        
Query: 258  cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
            ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| ||||||||||
Sbjct: 5295 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 5236

             
Query: 318  t 318
            |
Sbjct: 5235 t 5235



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                        
Query: 258  cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
            ||||| ||||||| |||||||| |  | ||||||||||||||| || || ||||||||||
Sbjct: 2149 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccaccctgcgcgatgg 2208

             
Query: 318  t 318
            |
Sbjct: 2209 t 2209

---

>emb|V00413.1|GGH2AX Chicken gene for histone H2A with flanking regions
          Length = 843

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| ||||||||||
Sbjct: 697 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 638

            
Query: 318 t 318
           |
Sbjct: 637 t 637

---

>ref|XM_694570.1| PREDICTED: Danio rerio similar to histone H2A (LOC571016), partial
           mRNA
          Length = 374

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | ||||||||||||||||||||| || |||||||
Sbjct: 354 cggtcttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgagcgatgg 295

            
Query: 318 t 318
           |
Sbjct: 294 t 294

---

>dbj|AK077568.1| Mus musculus 8 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:5730450G06 product:H2A HISTONE
           FAMILY, MEMBER L homolog [Homo sapiens], full insert
           sequence
          Length = 924

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 286 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 334
           |||||||||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 390 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 342

---

>dbj|AK051448.1| Mus musculus 12 days embryo spinal ganglion cDNA, RIKEN full-length
           enriched library, clone:D130049H21 product:H2A HISTONE
           FAMILY, MEMBER L homolog [Homo sapiens], full insert
           sequence
          Length = 1991

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 286 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 334
           |||||||||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 390 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 342

---

>dbj|AK087537.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched
           library, clone:E130315C04 product:H2A HISTONE FAMILY,
           MEMBER L homolog [Homo sapiens], full insert sequence
          Length = 1500

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 286 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 334
           |||||||||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 391 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 343

---

>dbj|AK015962.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4930534G10 product:unclassifiable, full
           insert sequence
          Length = 767

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 286 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 334
           |||||||||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 217 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 265

---

>dbj|AK083155.1| Mus musculus adult male hippocampus cDNA, RIKEN full-length
           enriched library, clone:C630019H19 product:H2A HISTONE
           FAMILY, MEMBER L homolog [Homo sapiens]; RING finger
           protein TERF, full insert sequence
          Length = 3665

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 286 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 334
           |||||||||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 390 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 342

---

>dbj|AK082083.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:C230003M12 product:H2A HISTONE
           FAMILY, MEMBER L homolog [Homo sapiens], full insert
           sequence
          Length = 2150

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 286 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 334
           |||||||||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 393 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 345

---

>ref|NM_178184.1| Mus musculus histone 1, H2an (Hist1h2an), mRNA
          Length = 393

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 286 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 334
           |||||||||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 288

---

>gb|AY158926.1| Mus musculus histone protein Hist3h2a gene, complete cds
          Length = 1201

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 286 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 334
           |||||||||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 870 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 822

---

>gb|AY158912.1| Mus musculus histone protein Hist1h2an gene, complete cds
          Length = 1390

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 286 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 334
           |||||||||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 836 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 788

---

>dbj|D11055.1|CHKH2A4H Gallus gallus gene for H2A histone, complete cds
          Length = 1028

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| ||||||||||
Sbjct: 695 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 636

            
Query: 318 t 318
           |
Sbjct: 635 t 635

---

>gb|U38933.1|GGU38933 Gallus gallus histone H2A (H2A-VIII) gene, complete cds
          Length = 740

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| ||||||||||
Sbjct: 542 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 483

            
Query: 318 t 318
           |
Sbjct: 482 t 482

---

>gb|U38932.1|GGU38932 Gallus gallus histone H2A (H2A-VII) gene, complete cds
          Length = 827

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| ||||||||||
Sbjct: 525 cggtcttcttgggcagcagcacagcctggatgttgggcagcaccccgccctgcgcgatgg 466

            
Query: 318 t 318
           |
Sbjct: 465 t 465

---

>gb|U38931.1|GGU38931 Gallus gallus histone H2A (H2A-VI) gene, complete cds
          Length = 743

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| ||||||||||
Sbjct: 387 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 328

            
Query: 318 t 318
           |
Sbjct: 327 t 327

---

>emb|AL662809.14| Mouse DNA sequence from clone RP23-441I8 on chromosome 11, complete
             sequence
          Length = 103129

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                              
Query: 286   gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 334
             |||||||||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 39545 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 39497

---

>gb|U95110.1|MMU95110 Mus macedonicus histone H2a pseudogene, complete sequence
          Length = 571

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 286 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 334
           |||||||||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 403 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 355

---

>gb|U95109.1|MSU95109 Mus spicilegus histone H2a pseudogene, complete sequence
          Length = 531

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||  |||||||| ||||||||||
Sbjct: 391 cggtcttcttgggcagcagcacggcctggatgttgggcacgacgccgccctgcgcgatgg 332

                            
Query: 318 tgacgccggccagcagc 334
           | |||| | ||||||||
Sbjct: 331 tcacgcggcccagcagc 315

---

>gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histone H4, histone H2B, and
            histone H2A genes, complete cds
          Length = 4358

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 137/173 (79%)
 Strand = Plus / Minus

                                                                        
Query: 259  ggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggt 318
            |||| ||||||| |||||||||| || ||||||||||||||| |||||    || |||||
Sbjct: 4163 ggtcttcttgggcagcagcaccgcgtggatgttgggcagcacaccgcccgaagcaatggt 4104

                                                                        
Query: 319  gacgccggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcct 378
             ||  || |||||||| | || ||||||| |||||| |  | ||| ||  | | ||| | 
Sbjct: 4103 cacctcgcccagcagcttgcccagctcctcgtcgttgcggatggccagctggatgtggcg 4044

                                                                 
Query: 379  gggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctcca 431
            |||||||||||||  ||||||||||||   ||||||||| ||||| |||||||
Sbjct: 4043 gggcacgatgcggttcttcttgttgtcgcgggcggcgttgccggccagctcca 3991

---

>gb|J00864.1|CHKH2A2B Chicken histone H2A/H2B gene pair and flanks
          Length = 1564

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 53/61 (86%)
 Strand = Plus / Plus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| ||||||||||
Sbjct: 282 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 341

            
Query: 318 t 318
           |
Sbjct: 342 t 342

---

>gb|DQ214188.1| Taeniopygia guttata clone 0058P0024E05 histone 1 H2ai-like mRNA,
           complete sequence
          Length = 786

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgat 315
           ||||||| |||||||| |  | ||||||||||||||||||||| ||||||||
Sbjct: 441 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgcgcgat 390

---

>gb|DQ214187.1| Taeniopygia guttata clone 0058P0044E04 histone 1 H2ai-like mRNA,
           complete sequence
          Length = 786

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgat 315
           ||||||| |||||||| |  | ||||||||||||||||||||| ||||||||
Sbjct: 441 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgcgcgat 390

---

>ref|XM_865148.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC613926), mRNA
          Length = 393

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| |||| ||||||||||| |  | |||||||||||| |||||||| || |||||||
Sbjct: 364 cggtcttcttagggagcagcacggcctggatgttgggcaggacgccgccctgagcgatgg 305

               
Query: 318 tgac 321
           ||||
Sbjct: 304 tgac 301

---

>ref|XM_545421.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488299),
           mRNA
          Length = 387

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||  |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaagacgccgccctgcgcgatgg 305

               
Query: 318 tgac 321
           ||||
Sbjct: 304 tgac 301

---

>ref|XM_545419.2| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488297),
           mRNA
          Length = 393

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||  |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaagacgccgccctgcgcgatgg 305

               
Query: 318 tgac 321
           ||||
Sbjct: 304 tgac 301

---

>ref|XM_848163.1| PREDICTED: Canis familiaris similar to Histone H2A.x (H2a/x)
           (LOC489372), mRNA
          Length = 841

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Minus

                                                                       
Query: 259 ggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggt 318
           |||| ||||||| |||||||| |  | |||||||||||| ||||| || |||||||| ||
Sbjct: 660 ggtcttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgcgcgatcgt 601

                           
Query: 319 gacgccggccagcagc 334
            |||||| ||||||||
Sbjct: 600 cacgccgcccagcagc 585

---

>ref|XM_692742.1| PREDICTED: Danio rerio similar to H2A histone family, member X
           (LOC569361), partial mRNA
          Length = 462

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| ||||||||||  | ||||||||||||||| || || || |||||||
Sbjct: 394 cggtcttcttgggcagcagcaccgcctggatgttgggcagcacacctccctgagcgatgg 335

                           
Query: 318 tgacgccggccagcag 333
           | || ||| |||||||
Sbjct: 334 tcactccgcccagcag 319

---

>emb|BX933556.1| Gallus gallus finished cDNA, clone ChEST42h4
          Length = 895

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                           
Query: 287 atgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 334
           ||||||||||| || ||||| |||||||||||||| ||| ||||||||
Sbjct: 60  atgttgggcagtaccccgccctgcgcgatggtgacaccgcccagcagc 107

---

>gb|AY104828.1| Zea mays PCO072413 mRNA sequence
          Length = 741

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 380 ggcacgatgcgggacttcttgttgtccttggcggcgttcccggc 423
           ||||| ||||||| ||||||||||||| | ||||||||||||||
Sbjct: 302 ggcacaatgcgggtcttcttgttgtccctcgcggcgttcccggc 259

---

>dbj|D38091.1|WHTPH2AE Triticum aestivum mRNA for protein H2A, complete cds, clone
           wcH2A-10
          Length = 691

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 380 ggcacgatgcgggacttcttgttgtccttggcggcgttcccggc 423
           ||||||||||||| ||||||||||||| | || |||||||||||
Sbjct: 329 ggcacgatgcgggtcttcttgttgtccctcgccgcgttcccggc 286

---

>dbj|D38089.1|WHTPH2AC Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-4
          Length = 725

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 380 ggcacgatgcgggacttcttgttgtccttggcggcgttcccggc 423
           ||||||||||||| ||||||||||||| | || |||||||||||
Sbjct: 327 ggcacgatgcgggtcttcttgttgtccctcgccgcgttcccggc 284

---

>emb|BX008487.1|CNS08EPN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 408

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggt 318
           ||||||| |||||||| |  | ||||||||||||||||||||| || ||||||||
Sbjct: 229 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggt 175

---

>ref|XM_577573.1| PREDICTED: Rattus norvegicus similar to Histone H2A.l (H2A/l)
           (LOC502125), mRNA
          Length = 393

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggt 318
           ||||||| ||||||||||  | |||||||||||| |||||||| || ||||||||
Sbjct: 358 tcttgggcagcagcaccgcttggatgttgggcagaacgccgccctgggcgatggt 304

---

>gb|AY109370.1| Zea mays CL2029_4 mRNA sequence
          Length = 1051

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 210 acttggcggccttcttgggcgacttgccctccttg 244
           |||||||||||||||||||||||||  ||||||||
Sbjct: 550 acttggcggccttcttgggcgactttgcctccttg 516

---

>gb|BC107354.1| Mus musculus histone 1, H2aa, mRNA (cDNA clone MGC:130330
           IMAGE:40055855), complete cds
          Length = 391

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| ||||| || ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccaccctgcgcgatgg 305

                 
Query: 318 tgacgc 323
           | ||||
Sbjct: 304 tcacgc 299

---

>gb|BC107355.1| Mus musculus histone 1, H2aa, mRNA (cDNA clone MGC:130331
           IMAGE:40055860), complete cds
          Length = 391

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| ||||| || ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccaccctgcgcgatgg 305

                 
Query: 318 tgacgc 323
           | ||||
Sbjct: 304 tcacgc 299

---

>ref|NM_175658.1| Mus musculus histone 1, H2aa (Hist1h2aa), mRNA
          Length = 390

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| ||||| || ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccaccctgcgcgatgg 305

                 
Query: 318 tgacgc 323
           | ||||
Sbjct: 304 tcacgc 299

---

>gb|AY389588.1| Hyacinthus orientalis histone H2A mRNA, complete cds
          Length = 643

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 89/110 (80%)
 Strand = Plus / Minus

                                                                       
Query: 272 agcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagc 331
           |||| ||||||||||||||| ||||| || || ||||| ||||| |||||||| || || 
Sbjct: 404 agcaacaccgggttgatgttcggcaggactccaccgtgagcgatcgtgacgcctgcaagt 345

                                                             
Query: 332 agcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctggg 381
           ||| | || |  ||||  ||||||||||| || || |||| |||||||||
Sbjct: 344 agcttgcccaattcctcatcgttcctcactgccagcagcacgtgcctggg 295

---

>emb|X01064.1|SGHIS2A3 Rainbow trout histone H2A and H3 genes
          Length = 2597

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 323
           |||||||||||||||| |  | |||||||||||| || || || || |||||||||||||
Sbjct: 721 tcttggggagcagcactgcctggatgttgggcagaacaccaccctgagcgatggtgacgc 662

             
Query: 324 cg 325
           ||
Sbjct: 661 cg 660

---

>emb|AL606464.11| Mouse DNA sequence from clone RP23-462P2 on chromosome 13 Contains the
             3' end of the Slc17a1 gene for solute carrier family 17
             vesicular glutamate transporter) member 1, the gene for a
             novel solute carrier family 17 (Slc17a) member, a U1 small
             nuclear ribonucleoprotein 1C (Snrp1c) pseudogene, a H2B
             histone family (H2b) pseudogene, the gene for a novel H2A
             histone family (H2a) member, a novel gene, the gene for
             the ortholog of human secretagogin, EF-hand calcium
             binding protein SCGN and the 3' end of a novel gene,
             complete sequence
          Length = 183698

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                         
Query: 258   cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
             ||||| ||||||| |||||||| |  | |||||||||||| ||||| || ||||||||||
Sbjct: 53750 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccaccctgcgcgatgg 53691

                   
Query: 318   tgacgc 323
             | ||||
Sbjct: 53690 tcacgc 53685

---

>gb|AY158921.1| Mus musculus histone protein Hist1h2aa gene, complete cds
          Length = 1201

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | |||||||||||| ||||| || ||||||||||
Sbjct: 304 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccaccctgcgcgatgg 363

                 
Query: 318 tgacgc 323
           | ||||
Sbjct: 364 tcacgc 369

---

>ref|XM_525084.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC469700),
           mRNA
          Length = 393

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 286 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 334
           |||||||||||| ||||| || ||||||||||| |||| | ||||||||
Sbjct: 336 gatgttgggcaggacgccaccctgcgcgatggtcacgcggcccagcagc 288

---

>gb|BC001193.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC:3165
           IMAGE:3355200), complete cds
          Length = 897

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 286 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 334
           |||||||||||| ||||| || ||||||||||| |||| | ||||||||
Sbjct: 378 gatgttgggcaggacgccaccctgcgcgatggtcacgcggcccagcagc 330

---

>gb|BC082269.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC:99456
           IMAGE:6671338), complete cds
          Length = 889

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 286 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 334
           |||||||||||| ||||| || ||||||||||| |||| | ||||||||
Sbjct: 368 gatgttgggcaggacgccaccctgcgcgatggtcacgcggcccagcagc 320

---

>ref|XM_425467.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427893),
           mRNA
          Length = 390

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | ||||||||||||||| || || ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccaccctgcgcgatgg 305

            
Query: 318 t 318
           |
Sbjct: 304 t 304

---

>ref|NM_033445.2| Homo sapiens histone 3, H2a (HIST3H2A), mRNA
          Length = 496

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 286 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 334
           |||||||||||| ||||| || ||||||||||| |||| | ||||||||
Sbjct: 378 gatgttgggcaggacgccaccctgcgcgatggtcacgcggcccagcagc 330

---

>ref|XM_545426.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488304), mRNA
          Length = 588

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 286 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 334
           ||||| |||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 483 gatgtggggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 435

---

>emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chromosome 1q42.11-42.3,
              complete sequence
          Length = 151563

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                               
Query: 286    gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 334
              |||||||||||| ||||| || ||||||||||| |||| | ||||||||
Sbjct: 100883 gatgttgggcaggacgccaccctgcgcgatggtcacgcggcccagcagc 100835

---

>ref|NM_001030753.1| Gallus gallus histone H2A (H2A-IX), mRNA
          Length = 390

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 286 gatgttgggcagcacgccgccgtgcgcgatggt 318
           ||||||||||||||| ||||| |||||||||||
Sbjct: 336 gatgttgggcagcaccccgccctgcgcgatggt 304

---

>ref|NM_001024282.1| Rattus norvegicus Histone H2a (predicted) (RGD1564767_predicted),
           mRNA
          Length = 393

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 286 gatgttgggcagcacgccgccgtgcgcgatggt 318
           |||||||||||| |||||||| |||||||||||
Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggt 304

---

>ref|XM_683938.1| PREDICTED: Danio rerio similar to histone H2A (LOC560527), mRNA
          Length = 387

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| || |||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcagcacaccgccctgagcgatgg 305

            
Query: 318 t 318
           |
Sbjct: 304 t 304

---

>ref|XM_694138.1| PREDICTED: Danio rerio similar to histone H2A (LOC570634), mRNA
          Length = 387

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| || |||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcagcacaccgccctgagcgatgg 305

            
Query: 318 t 318
           |
Sbjct: 304 t 304

---

>ref|XM_688696.1| PREDICTED: Danio rerio similar to histone H2A (LOC565417), mRNA
          Length = 384

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 286 gatgttgggcagcacgccgccgtgcgcgatggt 318
           ||||||||||||||||||||| || ||||||||
Sbjct: 336 gatgttgggcagcacgccgccctgagcgatggt 304

---

>gb|AC146538.2| Gasterosteus aculeatus clone CH213-118G22, complete sequence
          Length = 211945

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                          
Query: 290   ttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 334
             ||||||||||||||||| || |||||||| || ||| ||||||||
Sbjct: 98624 ttgggcagcacgccgccctgagcgatggtcactccgcccagcagc 98580

---

>gb|BC093343.1| Danio rerio MID1 interacting protein 1, mRNA (cDNA clone MGC:112497
           IMAGE:7411962), complete cds
          Length = 1726

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| || |||||||
Sbjct: 402 cggtcttcttgggcagcagcacggcctggatgttgggcagcacaccgccctgagcgatgg 343

            
Query: 318 t 318
           |
Sbjct: 342 t 342

---

>dbj|D11054.1|CHKH2A3H Gallus gallus gene for H2A histone, complete cds
          Length = 1495

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||| |  | ||||||||||||||| || || ||||||||||
Sbjct: 717 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccaccctgcgcgatgg 658

            
Query: 318 t 318
           |
Sbjct: 657 t 657

---

>gb|U38934.1|GGU38934 Gallus gallus histone H2A (H2A-IX) gene, complete cds
          Length = 575

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 286 gatgttgggcagcacgccgccgtgcgcgatggt 318
           ||||||||||||||| ||||| |||||||||||
Sbjct: 354 gatgttgggcagcaccccgccctgcgcgatggt 322

---

>emb|CR354435.20| Zebrafish DNA sequence from clone CH211-113A14 in linkage group 25,
             complete sequence
          Length = 167326

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                         
Query: 258   cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
             ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| || |||||||
Sbjct: 87534 cggtcttcttgggcagcagcacggcctggatgttgggcagcacaccgccctgagcgatgg 87593

              
Query: 318   t 318
             |
Sbjct: 87594 t 87594



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                               
Query: 286    gatgttgggcagcacgccgccgtgcgcgatggt 318
              ||||||||||||||| ||||| || ||||||||
Sbjct: 117585 gatgttgggcagcacaccgccctgagcgatggt 117617



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 286   gatgttgggcagcacgccgccgtgcgcgatggt 318
             ||||||||||||||| ||||| || ||||||||
Sbjct: 91998 gatgttgggcagcacaccgccctgagcgatggt 92030



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                              
Query: 286   gatgttgggcagcacgccgccgtgcgcgatggt 318
             ||||||||||||||| ||||| || ||||||||
Sbjct: 62065 gatgttgggcagcacaccgccctgagcgatggt 62033

---

>gb|U95113.1|RNU95113 Rattus norvegicus histone H2a gene, complete cds
          Length = 575

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 286 gatgttgggcagcacgccgccgtgcgcgatggt 318
           |||||||||||| |||||||| |||||||||||
Sbjct: 400 gatgttgggcaggacgccgccctgcgcgatggt 368

---

>gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-II), histone H4 (ch4-II),
            histone H2B (ch2b-II) and histone H2A (ch2a-II) genes,
            complete cds
          Length = 3777

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 379  gggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctcca 431
            |||||||||||||  ||||||||||||   ||||||||| ||||| |||||||
Sbjct: 3462 gggcacgatgcggttcttcttgttgtcgcgggcggcgttgccggccagctcca 3410

---

>gb|AY131974.1| Homo sapiens histone H2A (HIST3H2A) gene, complete cds
          Length = 1173

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 286 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 334
           |||||||||||| ||||| || ||||||||||| |||| | ||||||||
Sbjct: 728 gatgttgggcaggacgccaccctgcgcgatggtcacgcggcccagcagc 680

---

>ref|XM_522264.1| PREDICTED: Pan troglodytes similar to Histone H2A.x (H2a/x)
           (LOC466864), mRNA
          Length = 432

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                       
Query: 259 ggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggt 318
           |||| ||||||| |||||||| |  | |||||||||||| ||||| || || ||||| ||
Sbjct: 363 ggtcttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgt 304

                           
Query: 319 gacgccggccagcagc 334
            |||||| ||||||||
Sbjct: 303 cacgccgcccagcagc 288

---

>ref|XM_527249.1| PREDICTED: Pan troglodytes similar to H2A histone family, member P
           (LOC471871), mRNA
          Length = 660

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 287 atgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 334
           ||||||||||| || ||||| ||||||||||||||  || ||||||||
Sbjct: 497 atgttgggcaggacaccgccctgcgcgatggtgacttcgcccagcagc 450

---

>ref|NM_006632.1| Homo sapiens solute carrier family 17 (sodium phosphate), member 3
           (SLC17A3), mRNA
          Length = 1795

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 287 atgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 334
           ||||||||||| || ||||| ||||||||||||||  || ||||||||
Sbjct: 236 atgttgggcaggacaccgccctgcgcgatggtgacttcgcccagcagc 189

---

>ref|NM_013549.1| Mus musculus histone 2, H2aa1 (Hist2h2aa1), mRNA
          Length = 578

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgat 315
           ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||
Sbjct: 401 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgat 350

---

>gb|BC077427.1| Xenopus laevis MGC82198 protein, mRNA (cDNA clone MGC:82198
           IMAGE:3402168), complete cds
          Length = 1591

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 69/84 (82%)
 Strand = Plus / Minus

                                                                       
Query: 340 gagctcctggtcgttcctcacggcgaggagcaggtgcctgggcacgatgcgggacttctt 399
           ||||||||  ||||| | ||| |||||  ||||||||||||| | |||||||| ||||||
Sbjct: 290 gagctcctcatcgttgcgcacagcgagctgcaggtgcctggggatgatgcgggtcttctt 231

                                   
Query: 400 gttgtccttggcggcgttcccggc 423
           ||| |||  ||| ||||| |||||
Sbjct: 230 gttatcccgggcagcgttgccggc 207

---

>gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339
          Length = 2972

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgat 315
           ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||
Sbjct: 385 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgat 334

---

>ref|XM_870470.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC618143), mRNA
          Length = 270

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 54/64 (84%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| |||||||||   | |||||||||||| |||||||| || || ||||
Sbjct: 241 cggtcttcttgggcagcagcaccccctggatgttgggcaggacgccgccctgggctatgg 182

               
Query: 318 tgac 321
           ||||
Sbjct: 181 tgac 178

---

>gb|BC004915.2| Homo sapiens H2A histone family, member X, mRNA (cDNA clone
           MGC:4759 IMAGE:3537648), complete cds
          Length = 1580

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                       
Query: 259 ggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggt 318
           |||| ||||||| |||||||| |  | |||||||||||| ||||| || || ||||| ||
Sbjct: 406 ggtcttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgt 347

                           
Query: 319 gacgccggccagcagc 334
            |||||| ||||||||
Sbjct: 346 cacgccgcccagcagc 331

---

>gb|BC010564.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone IMAGE:3582122),
           partial cds
          Length = 543

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgat 315
           ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||
Sbjct: 385 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgat 334

---

>ref|XM_607721.2| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC529277), mRNA
          Length = 522

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 54/64 (84%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| ||||||||||  | |||||||||||| || || || || |||||||
Sbjct: 365 cggtcttcttgggcagcagcaccgcctggatgttgggcaggacaccaccctgagcgatgg 306

               
Query: 318 tgac 321
           ||||
Sbjct: 305 tgac 302

---

>ref|XM_865976.1| PREDICTED: Bos taurus similar to Histone H2A.g (H2A/g) (H2A.3)
           (LOC614970), mRNA
          Length = 447

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 54/64 (84%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 317
           ||||| ||||||| ||||||||||  | |||||||||||| || || || || |||||||
Sbjct: 364 cggtcttcttgggcagcagcaccgcctggatgttgggcaggacaccaccctgagcgatgg 305

               
Query: 318 tgac 321
           ||||
Sbjct: 304 tgac 301

---

>ref|XM_981616.1| PREDICTED: Mus musculus similar to H2A histone family, member O
           (LOC670497), mRNA
          Length = 3003

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgat 315
           ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||
Sbjct: 364 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgat 313

---

>ref|XM_992084.1| PREDICTED: Mus musculus similar to H2A histone family, member O
           (LOC667728), mRNA
          Length = 3054

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgat 315
           ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||
Sbjct: 415 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgat 364

---

>ref|XM_994730.1| PREDICTED: Mus musculus similar to H2A histone family, member O
           (LOC677006), mRNA
          Length = 2991

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 264 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgat 315
           ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||
Sbjct: 352 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgat 301


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,150,275
Number of Sequences: 3902068
Number of extensions: 3150275
Number of successful extensions: 59941
Number of sequences better than 10.0: 478
Number of HSP's better than 10.0 without gapping: 487
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 58313
Number of HSP's gapped (non-prelim): 1583
length of query: 431
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 409
effective length of database: 17,147,199,772
effective search space: 7013204706748
effective search space used: 7013204706748
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---