ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbaal24i16 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_470257.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2151 Score = 50.1 bits (25), Expect = 0.011 Identities = 46/53 (86%) Strand = Plus / Minus Query: 523 cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 575 |||||| | ||||||||||||||| ||||| || || ||||||||| |||||| Sbjct: 2115 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 2063
>gb|BT018844.1| Zea mays clone EL01N0554B10.d mRNA sequence Length = 2441 Score = 50.1 bits (25), Expect = 0.011 Identities = 28/29 (96%) Strand = Plus / Minus Query: 535 tgctgtttgggccacctttgccgcgtagg 563 ||||| ||||||||||||||||||||||| Sbjct: 1961 tgctgcttgggccacctttgccgcgtagg 1933
>gb|BT016816.1| Zea mays clone Contig649 mRNA sequence Length = 1830 Score = 50.1 bits (25), Expect = 0.011 Identities = 28/29 (96%) Strand = Plus / Minus Query: 535 tgctgtttgggccacctttgccgcgtagg 563 ||||| ||||||||||||||||||||||| Sbjct: 1317 tgctgcttgggccacctttgccgcgtagg 1289
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 50.1 bits (25), Expect = 0.011 Identities = 46/53 (86%) Strand = Plus / Plus Query: 523 cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 575 |||||| | ||||||||||||||| ||||| || || ||||||||| |||||| Sbjct: 3108402 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 3108454
>gb|AC099401.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1134F05, complete sequence Length = 101799 Score = 50.1 bits (25), Expect = 0.011 Identities = 46/53 (86%) Strand = Plus / Plus Query: 523 cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 575 |||||| | ||||||||||||||| ||||| || || ||||||||| |||||| Sbjct: 31415 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 31467
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 50.1 bits (25), Expect = 0.011 Identities = 46/53 (86%) Strand = Plus / Plus Query: 523 cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 575 |||||| | ||||||||||||||| ||||| || || ||||||||| |||||| Sbjct: 3108513 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 3108565
>dbj|AK119641.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-F09, full insert sequence Length = 2166 Score = 50.1 bits (25), Expect = 0.011 Identities = 46/53 (86%) Strand = Plus / Minus Query: 523 cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 575 |||||| | ||||||||||||||| ||||| || || ||||||||| |||||| Sbjct: 1763 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 1711
>dbj|AK111578.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075E22, full insert sequence Length = 2862 Score = 50.1 bits (25), Expect = 0.011 Identities = 46/53 (86%) Strand = Plus / Minus Query: 523 cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 575 |||||| | ||||||||||||||| ||||| || || ||||||||| |||||| Sbjct: 2352 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 2300
>dbj|AK111489.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000A14, full insert sequence Length = 2762 Score = 50.1 bits (25), Expect = 0.011 Identities = 46/53 (86%) Strand = Plus / Minus Query: 523 cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 575 |||||| | ||||||||||||||| ||||| || || ||||||||| |||||| Sbjct: 2300 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 2248
>dbj|AK103405.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033128D05, full insert sequence Length = 1271 Score = 50.1 bits (25), Expect = 0.011 Identities = 46/53 (86%) Strand = Plus / Minus Query: 523 cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 575 |||||| | ||||||||||||||| ||||| || || ||||||||| |||||| Sbjct: 928 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 876
>dbj|AK062076.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-044-F04, full insert sequence Length = 1771 Score = 50.1 bits (25), Expect = 0.011 Identities = 46/53 (86%) Strand = Plus / Minus Query: 523 cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 575 |||||| | ||||||||||||||| ||||| || || ||||||||| |||||| Sbjct: 1264 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 1212
>emb|BX035467.1|CNS08ZJ3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA6DC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 595 Score = 46.1 bits (23), Expect = 0.16 Identities = 26/27 (96%) Strand = Plus / Plus Query: 513 ccgcaggcttcttctcggccgctgctg 539 |||| |||||||||||||||||||||| Sbjct: 381 ccgccggcttcttctcggccgctgctg 407
>emb|BX066712.1|CNS09NN0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50AE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 804 Score = 44.1 bits (22), Expect = 0.65 Identities = 22/22 (100%) Strand = Plus / Plus Query: 518 ggcttcttctcggccgctgctg 539 |||||||||||||||||||||| Sbjct: 701 ggcttcttctcggccgctgctg 722
>emb|BX058217.1|CNS09H31 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC38BH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 848 Score = 44.1 bits (22), Expect = 0.65 Identities = 22/22 (100%) Strand = Plus / Plus Query: 518 ggcttcttctcggccgctgctg 539 |||||||||||||||||||||| Sbjct: 349 ggcttcttctcggccgctgctg 370
>emb|BX055758.1|CNS09F6Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34CA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 820 Score = 44.1 bits (22), Expect = 0.65 Identities = 22/22 (100%) Strand = Plus / Plus Query: 518 ggcttcttctcggccgctgctg 539 |||||||||||||||||||||| Sbjct: 366 ggcttcttctcggccgctgctg 387
>emb|BX050629.1|CNS09B89 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC27AH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 491 Score = 44.1 bits (22), Expect = 0.65 Identities = 22/22 (100%) Strand = Plus / Plus Query: 518 ggcttcttctcggccgctgctg 539 |||||||||||||||||||||| Sbjct: 343 ggcttcttctcggccgctgctg 364
>emb|BX048891.1|CNS099VZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC24BE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 582 Score = 44.1 bits (22), Expect = 0.65 Identities = 22/22 (100%) Strand = Plus / Plus Query: 518 ggcttcttctcggccgctgctg 539 |||||||||||||||||||||| Sbjct: 352 ggcttcttctcggccgctgctg 373
>emb|BX048575.1|CNS099N7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC23DC08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 692 Score = 44.1 bits (22), Expect = 0.65 Identities = 22/22 (100%) Strand = Plus / Minus Query: 518 ggcttcttctcggccgctgctg 539 |||||||||||||||||||||| Sbjct: 692 ggcttcttctcggccgctgctg 671
>emb|BX047759.1|CNS0990J Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC22BH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 333 Score = 44.1 bits (22), Expect = 0.65 Identities = 22/22 (100%) Strand = Plus / Plus Query: 518 ggcttcttctcggccgctgctg 539 |||||||||||||||||||||| Sbjct: 154 ggcttcttctcggccgctgctg 175
>emb|BX047713.1|CNS098Z9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC22BE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 888 Score = 44.1 bits (22), Expect = 0.65 Identities = 22/22 (100%) Strand = Plus / Plus Query: 518 ggcttcttctcggccgctgctg 539 |||||||||||||||||||||| Sbjct: 354 ggcttcttctcggccgctgctg 375
>emb|BX039669.1|CNS092RT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC10AC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 765 Score = 44.1 bits (22), Expect = 0.65 Identities = 22/22 (100%) Strand = Plus / Plus Query: 518 ggcttcttctcggccgctgctg 539 |||||||||||||||||||||| Sbjct: 377 ggcttcttctcggccgctgctg 398
>emb|BX037240.1|CNS090WC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA9CE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 759 Score = 44.1 bits (22), Expect = 0.65 Identities = 22/22 (100%) Strand = Plus / Plus Query: 518 ggcttcttctcggccgctgctg 539 |||||||||||||||||||||| Sbjct: 377 ggcttcttctcggccgctgctg 398
>emb|BX036580.1|CNS090E0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA8CD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 541 Score = 44.1 bits (22), Expect = 0.65 Identities = 22/22 (100%) Strand = Plus / Plus Query: 518 ggcttcttctcggccgctgctg 539 |||||||||||||||||||||| Sbjct: 199 ggcttcttctcggccgctgctg 220
>emb|BX036124.1|CNS0901C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA7DC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 816 Score = 44.1 bits (22), Expect = 0.65 Identities = 22/22 (100%) Strand = Plus / Plus Query: 518 ggcttcttctcggccgctgctg 539 |||||||||||||||||||||| Sbjct: 367 ggcttcttctcggccgctgctg 388
>emb|BX029509.1|CNS08UXL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA44AD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 879 Score = 44.1 bits (22), Expect = 0.65 Identities = 22/22 (100%) Strand = Plus / Plus Query: 518 ggcttcttctcggccgctgctg 539 |||||||||||||||||||||| Sbjct: 356 ggcttcttctcggccgctgctg 377
>emb|BX028945.1|CNS08UHX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA43BA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 469 Score = 44.1 bits (22), Expect = 0.65 Identities = 22/22 (100%) Strand = Plus / Plus Query: 518 ggcttcttctcggccgctgctg 539 |||||||||||||||||||||| Sbjct: 368 ggcttcttctcggccgctgctg 389
>emb|BX028103.1|CNS08TUJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA42AB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 459 Score = 44.1 bits (22), Expect = 0.65 Identities = 22/22 (100%) Strand = Plus / Plus Query: 518 ggcttcttctcggccgctgctg 539 |||||||||||||||||||||| Sbjct: 361 ggcttcttctcggccgctgctg 382
>emb|BX027649.1|CNS08THX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA41BE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 977 Score = 44.1 bits (22), Expect = 0.65 Identities = 22/22 (100%) Strand = Plus / Plus Query: 518 ggcttcttctcggccgctgctg 539 |||||||||||||||||||||| Sbjct: 289 ggcttcttctcggccgctgctg 310
>emb|BX027278.1|CNS08T7M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA40DE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 912 Score = 44.1 bits (22), Expect = 0.65 Identities = 22/22 (100%) Strand = Plus / Plus Query: 518 ggcttcttctcggccgctgctg 539 |||||||||||||||||||||| Sbjct: 361 ggcttcttctcggccgctgctg 382
>emb|BX026134.1|CNS08SBU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA4BC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 651 Score = 44.1 bits (22), Expect = 0.65 Identities = 22/22 (100%) Strand = Plus / Plus Query: 518 ggcttcttctcggccgctgctg 539 |||||||||||||||||||||| Sbjct: 281 ggcttcttctcggccgctgctg 302
>emb|BX020909.1|CNS08OAP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA30DE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 711 Score = 44.1 bits (22), Expect = 0.65 Identities = 22/22 (100%) Strand = Plus / Plus Query: 518 ggcttcttctcggccgctgctg 539 |||||||||||||||||||||| Sbjct: 332 ggcttcttctcggccgctgctg 353
>emb|BX019905.1|CNS08NIT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA3BD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1030 Score = 44.1 bits (22), Expect = 0.65 Identities = 22/22 (100%) Strand = Plus / Plus Query: 518 ggcttcttctcggccgctgctg 539 |||||||||||||||||||||| Sbjct: 370 ggcttcttctcggccgctgctg 391
>emb|BX017103.1|CNS08LCZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA25CG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 574 Score = 44.1 bits (22), Expect = 0.65 Identities = 22/22 (100%) Strand = Plus / Plus Query: 518 ggcttcttctcggccgctgctg 539 |||||||||||||||||||||| Sbjct: 353 ggcttcttctcggccgctgctg 374
>emb|BX016863.1|CNS08L6B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA25BD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 657 Score = 44.1 bits (22), Expect = 0.65 Identities = 22/22 (100%) Strand = Plus / Plus Query: 518 ggcttcttctcggccgctgctg 539 |||||||||||||||||||||| Sbjct: 304 ggcttcttctcggccgctgctg 325
>emb|BX010707.1|CNS08GFB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA17AG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 749 Score = 44.1 bits (22), Expect = 0.65 Identities = 22/22 (100%) Strand = Plus / Plus Query: 518 ggcttcttctcggccgctgctg 539 |||||||||||||||||||||| Sbjct: 350 ggcttcttctcggccgctgctg 371
>emb|BX010159.1|CNS08G03 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA16BD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 524 Score = 44.1 bits (22), Expect = 0.65 Identities = 22/22 (100%) Strand = Plus / Plus Query: 518 ggcttcttctcggccgctgctg 539 |||||||||||||||||||||| Sbjct: 369 ggcttcttctcggccgctgctg 390
>emb|BX010158.1|CNS08G02 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA16BD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 731 Score = 44.1 bits (22), Expect = 0.65 Identities = 22/22 (100%) Strand = Plus / Minus Query: 518 ggcttcttctcggccgctgctg 539 |||||||||||||||||||||| Sbjct: 669 ggcttcttctcggccgctgctg 648
>emb|BX009177.1|CNS08F8T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA14DG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 901 Score = 44.1 bits (22), Expect = 0.65 Identities = 22/22 (100%) Strand = Plus / Plus Query: 518 ggcttcttctcggccgctgctg 539 |||||||||||||||||||||| Sbjct: 368 ggcttcttctcggccgctgctg 389
>emb|BX007586.1|CNS08E0M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA12CE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 505 Score = 44.1 bits (22), Expect = 0.65 Identities = 22/22 (100%) Strand = Plus / Plus Query: 518 ggcttcttctcggccgctgctg 539 |||||||||||||||||||||| Sbjct: 362 ggcttcttctcggccgctgctg 383
>gb|AY596616.1| Saccharum officinarum clone SCCCCL3005B06, complete sequence Length = 2129 Score = 42.1 bits (21), Expect = 2.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 535 tgctgtttgggccacctttgc 555 ||||||||||||||||||||| Sbjct: 1655 tgctgtttgggccacctttgc 1635
>gb|AC119853.9| Mus musculus chromosome 16, clone RP23-231E23, complete sequence Length = 236274 Score = 42.1 bits (21), Expect = 2.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 594 ctttctctgccggaaccttca 614 ||||||||||||||||||||| Sbjct: 107700 ctttctctgccggaaccttca 107720
>emb|AL031847.17|HS120G22 Human DNA sequence from clone RP1-120G22 on chromosome 1p36.21-36.33 Contains the 5' end of the CHD5 gene for chromodomain helicase DNA binding protein 5, the RPL22 gene for ribosomal protein L22, eight novel genes, the ICMT gene for isoprenylcysteine carboxyl methyltransferase, possible ortholog of rodent transcription factor HES-3, the 3' end of the gene for brain acyl-CoA hydrolase (BACH) and seven CpG islands, complete sequence Length = 166518 Score = 42.1 bits (21), Expect = 2.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 659 ttgatggcatcctgttgtttc 679 ||||||||||||||||||||| Sbjct: 94318 ttgatggcatcctgttgtttc 94298
>ref|XM_695555.1| PREDICTED: Danio rerio similar to Farnesyl-diphosphate farnesyltransferase (Squalene synthetase) (SQS) (SS) (FPP:FPP farnesyltransferase) (LOC571911), partial mRNA Length = 752 Score = 42.1 bits (21), Expect = 2.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 570 ctggaggaccagcagcagggg 590 ||||||||||||||||||||| Sbjct: 292 ctggaggaccagcagcagggg 312
>gb|AE016816.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome III, complete sequence Length = 907057 Score = 42.1 bits (21), Expect = 2.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 567 cggctggaggaccagcagcag 587 ||||||||||||||||||||| Sbjct: 616609 cggctggaggaccagcagcag 616629
>ref|NM_208906.1| Eremothecium gossypii ACR151Wp (ACR151W), mRNA Length = 2649 Score = 42.1 bits (21), Expect = 2.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 567 cggctggaggaccagcagcag 587 ||||||||||||||||||||| Sbjct: 265 cggctggaggaccagcagcag 285 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,674,735 Number of Sequences: 3902068 Number of extensions: 5674735 Number of successful extensions: 121404 Number of sequences better than 10.0: 45 Number of HSP's better than 10.0 without gapping: 45 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 121224 Number of HSP's gapped (non-prelim): 180 length of query: 738 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 715 effective length of database: 17,143,297,704 effective search space: 12257457858360 effective search space used: 12257457858360 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 21 (42.1 bits)
