| Clone Name | rbaal24h20 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_467920.1| Oryza sativa (japonica cultivar-group), mRNA Length = 675 Score = 222 bits (112), Expect = 1e-54 Identities = 202/232 (87%) Strand = Plus / Minus Query: 363 tcacaggcacttcttgatgtctgaaaataacgacttctctttgtttgctgcctcgacgtc 422 ||||||||||||||||| ||||||||| || | || || ||||||||||| |||||||| Sbjct: 372 tcacaggcacttcttgacgtctgaaaacaagggattttccttgtttgctgcttcgacgtc 313 Query: 423 gtcaggcgatgctacagccaccacaaccccattgtcgttgatcgtctcgacggcatcagc 482 ||||| ||||| || || ||||| || || |||||||| || || ||||| |||||||| Sbjct: 312 ctcaggtgatgcaacggcaaccacgacaccgttgtcgttaattgtttcgacagcatcagc 253 Query: 483 aaactccttgaaatccttcacgctggttgcgagtatctcttcacgcctttgctggcgttc 542 |||||||||||||||||||| |||||||| |||||||||||||| |||||||||||||| Sbjct: 252 aaactccttgaaatccttcaagctggttgatagtatctcttcacgtctttgctggcgttc 193 Query: 543 ctcctcagtgatgcccaacaaataccgcatcagactgctgtaacctttagca 594 |||| | |||||||||| ||| || ||||| ||||||||||||||||||||| Sbjct: 192 ctccaccgtgatgcccagcaagtatcgcattagactgctgtaacctttagca 141
>dbj|AK060417.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-010-F01, full insert sequence Length = 675 Score = 222 bits (112), Expect = 1e-54 Identities = 202/232 (87%) Strand = Plus / Minus Query: 363 tcacaggcacttcttgatgtctgaaaataacgacttctctttgtttgctgcctcgacgtc 422 ||||||||||||||||| ||||||||| || | || || ||||||||||| |||||||| Sbjct: 372 tcacaggcacttcttgacgtctgaaaacaagggattttccttgtttgctgcttcgacgtc 313 Query: 423 gtcaggcgatgctacagccaccacaaccccattgtcgttgatcgtctcgacggcatcagc 482 ||||| ||||| || || ||||| || || |||||||| || || ||||| |||||||| Sbjct: 312 ctcaggtgatgcaacggcaaccacgacaccgttgtcgttaattgtttcgacagcatcagc 253 Query: 483 aaactccttgaaatccttcacgctggttgcgagtatctcttcacgcctttgctggcgttc 542 |||||||||||||||||||| |||||||| |||||||||||||| |||||||||||||| Sbjct: 252 aaactccttgaaatccttcaagctggttgatagtatctcttcacgtctttgctggcgttc 193 Query: 543 ctcctcagtgatgcccaacaaataccgcatcagactgctgtaacctttagca 594 |||| | |||||||||| ||| || ||||| ||||||||||||||||||||| Sbjct: 192 ctccaccgtgatgcccagcaagtatcgcattagactgctgtaacctttagca 141
>gb|AY105969.1| Zea mays PCO131995 mRNA sequence Length = 1779 Score = 153 bits (77), Expect = 8e-34 Identities = 134/153 (87%) Strand = Plus / Minus Query: 442 accacaaccccattgtcgttgatcgtctcgacggcatcagcaaactccttgaaatccttc 501 ||||| ||||||||||| ||||| || || || |||||||| |||||||||||||||||| Sbjct: 1657 accacgaccccattgtccttgatggtttcaacagcatcagcgaactccttgaaatccttc 1598 Query: 502 acgctggttgcgagtatctcttcacgcctttgctggcgttcctcctcagtgatgcccaac 561 ||| ||||| |||||||||||||| ||||||||||||||||| || |||||||||| | Sbjct: 1597 gggcttgttgctagtatctcttcacgtctttgctggcgttcctcatccgtgatgcccagc 1538 Query: 562 aaataccgcatcagactgctgtaacctttagca 594 ||||| | ||| || |||||||||||||||||| Sbjct: 1537 aaatatctcattaggctgctgtaacctttagca 1505
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 121 bits (61), Expect = 3e-24 Identities = 124/145 (85%) Strand = Plus / Minus Query: 363 tcacaggcacttcttgatgtctgaaaataacgacttctctttgtttgctgcctcgacgtc 422 ||||||||||||||||| ||||||||| || | || || ||||||||||| |||||||| Sbjct: 32087614 tcacaggcacttcttgacgtctgaaaacaagggattttccttgtttgctgcttcgacgtc 32087555 Query: 423 gtcaggcgatgctacagccaccacaaccccattgtcgttgatcgtctcgacggcatcagc 482 ||||| ||||| || || ||||| || || |||||||| || || ||||| |||||||| Sbjct: 32087554 ctcaggtgatgcaacggcaaccacgacaccgttgtcgttaattgtttcgacagcatcagc 32087495 Query: 483 aaactccttgaaatccttcacgctg 507 |||||||||||||||||||| |||| Sbjct: 32087494 aaactccttgaaatccttcaagctg 32087470 Score = 77.8 bits (39), Expect = 4e-11 Identities = 66/75 (88%) Strand = Plus / Minus Query: 505 ctggttgcgagtatctcttcacgcctttgctggcgttcctcctcagtgatgcccaacaaa 564 ||||||| |||||||||||||| |||||||||||||||||| | |||||||||| ||| Sbjct: 32087370 ctggttgatagtatctcttcacgtctttgctggcgttcctccaccgtgatgcccagcaag 32087311 Query: 565 taccgcatcagactg 579 || ||||| |||||| Sbjct: 32087310 tatcgcattagactg 32087296
>dbj|AP005002.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0486G03 Length = 146713 Score = 121 bits (61), Expect = 3e-24 Identities = 124/145 (85%) Strand = Plus / Minus Query: 363 tcacaggcacttcttgatgtctgaaaataacgacttctctttgtttgctgcctcgacgtc 422 ||||||||||||||||| ||||||||| || | || || ||||||||||| |||||||| Sbjct: 24270 tcacaggcacttcttgacgtctgaaaacaagggattttccttgtttgctgcttcgacgtc 24211 Query: 423 gtcaggcgatgctacagccaccacaaccccattgtcgttgatcgtctcgacggcatcagc 482 ||||| ||||| || || ||||| || || |||||||| || || ||||| |||||||| Sbjct: 24210 ctcaggtgatgcaacggcaaccacgacaccgttgtcgttaattgtttcgacagcatcagc 24151 Query: 483 aaactccttgaaatccttcacgctg 507 |||||||||||||||||||| |||| Sbjct: 24150 aaactccttgaaatccttcaagctg 24126 Score = 77.8 bits (39), Expect = 4e-11 Identities = 66/75 (88%) Strand = Plus / Minus Query: 505 ctggttgcgagtatctcttcacgcctttgctggcgttcctcctcagtgatgcccaacaaa 564 ||||||| |||||||||||||| |||||||||||||||||| | |||||||||| ||| Sbjct: 24026 ctggttgatagtatctcttcacgtctttgctggcgttcctccaccgtgatgcccagcaag 23967 Query: 565 taccgcatcagactg 579 || ||||| |||||| Sbjct: 23966 tatcgcattagactg 23952
>emb|AL589862.28| Human DNA sequence from clone GS1-165F21 on chromosome 10 Contains the 5' end of the PAX2 gene for paired box gene 2 and fifteen CpG islands, complete sequence Length = 187101 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 255 tacagcgccagaccattcttctt 277 ||||||||||||||||||||||| Sbjct: 139014 tacagcgccagaccattcttctt 138992
>gb|AF326573.1| Dengue virus type 4 strain 814669, complete genome Length = 10649 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 481 gcaaactccttgaaatccttca 502 |||||||||||||||||||||| Sbjct: 6364 gcaaactccttgaaatccttca 6343
>gb|AY243469.1| Chimeric Dengue virus vector p4(Delta30)-D2-CME, complete sequence Length = 15237 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 481 gcaaactccttgaaatccttca 502 |||||||||||||||||||||| Sbjct: 6362 gcaaactccttgaaatccttca 6341
>gb|AY243468.1| Chimeric Dengue virus vector p4-D2-CME, complete sequence Length = 15268 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 481 gcaaactccttgaaatccttca 502 |||||||||||||||||||||| Sbjct: 6362 gcaaactccttgaaatccttca 6341
>gb|AY243467.1| Chimeric Dengue virus vector p4(Delta30)-D2-ME, complete sequence Length = 15239 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 481 gcaaactccttgaaatccttca 502 |||||||||||||||||||||| Sbjct: 6364 gcaaactccttgaaatccttca 6343
>gb|AY243466.1| Chimeric Dengue virus vector p4-D2-ME, complete sequence Length = 15270 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 481 gcaaactccttgaaatccttca 502 |||||||||||||||||||||| Sbjct: 6364 gcaaactccttgaaatccttca 6343
>gb|AY376438.1| Dengue virus vector p4(Delta30), complete sequence Length = 15239 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 481 gcaaactccttgaaatccttca 502 |||||||||||||||||||||| Sbjct: 6364 gcaaactccttgaaatccttca 6343
>gb|AF375822.1|AF375822 Dengue virus type 4 recombinant clone 2A, complete genome Length = 10649 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 481 gcaaactccttgaaatccttca 502 |||||||||||||||||||||| Sbjct: 6364 gcaaactccttgaaatccttca 6343
>gb|AF326827.1| Dengue virus type 4 recombinant clone rDEN4del30, complete sequence Length = 10618 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 481 gcaaactccttgaaatccttca 502 |||||||||||||||||||||| Sbjct: 6364 gcaaactccttgaaatccttca 6343
>gb|AF326826.1| Dengue virus type 4 recombinant clone 2Adel30, complete sequence Length = 10618 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 481 gcaaactccttgaaatccttca 502 |||||||||||||||||||||| Sbjct: 6364 gcaaactccttgaaatccttca 6343
>gb|AF326825.1| Dengue virus type 4 recombinant clone rDEN4, complete sequence Length = 10649 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 481 gcaaactccttgaaatccttca 502 |||||||||||||||||||||| Sbjct: 6364 gcaaactccttgaaatccttca 6343
>gb|AF289029.1|AF289029 dengue virus type 4 China Guangzhou B5 strain genomic RNA,complete cds Length = 10665 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 481 gcaaactccttgaaatccttca 502 |||||||||||||||||||||| Sbjct: 6364 gcaaactccttgaaatccttca 6343
>gb|AC114763.6| Homo sapiens BAC clone RP11-369K2 from 2, complete sequence Length = 87248 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Minus Query: 57 acagcagcttggcgtacaaccgtctt 82 ||||||||||||| |||||||||||| Sbjct: 13338 acagcagcttggcttacaaccgtctt 13313
>gb|AY947539.1| Dengue virus type 4 strain H241, complete genome Length = 10643 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 481 gcaaactccttgaaatccttca 502 |||||||||||||||||||||| Sbjct: 6356 gcaaactccttgaaatccttca 6335
>gb|M14931.2|DENSTRA Dengue virus type 4 polyprotein precursor, gene, complete cds Length = 10648 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 481 gcaaactccttgaaatccttca 502 |||||||||||||||||||||| Sbjct: 6364 gcaaactccttgaaatccttca 6343
>gb|AY776330.1| Dengue virus type 4 strain Taiwan-2K0713 polyprotein gene, complete cds Length = 10353 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 481 gcaaactccttgaaatccttca 502 |||||||||||||||||||||| Sbjct: 6341 gcaaactccttgaaatccttca 6320
>gb|AY618993.1| Dengue virus type 4 strain ThD4_0734_00, complete genome Length = 10653 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 481 gcaaactccttgaaatccttca 502 |||||||||||||||||||||| Sbjct: 6365 gcaaactccttgaaatccttca 6344
>gb|AY618992.1| Dengue virus type 4 strain ThD4_0485_01, complete genome Length = 10649 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 481 gcaaactccttgaaatccttca 502 |||||||||||||||||||||| Sbjct: 6364 gcaaactccttgaaatccttca 6343
>gb|AY618991.1| Dengue virus type 4 strain ThD4_0087_77, complete genome Length = 10650 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 481 gcaaactccttgaaatccttca 502 |||||||||||||||||||||| Sbjct: 6364 gcaaactccttgaaatccttca 6343
>gb|AY618990.1| Dengue virus type 4 strain ThD4_0348_91, complete genome Length = 10650 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 481 gcaaactccttgaaatccttca 502 |||||||||||||||||||||| Sbjct: 6364 gcaaactccttgaaatccttca 6343
>gb|AY858050.1| Dengue virus type 4 strain SW38i polyprotein gene, partial cds Length = 10516 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 481 gcaaactccttgaaatccttca 502 |||||||||||||||||||||| Sbjct: 6253 gcaaactccttgaaatccttca 6232
>gb|AY858049.1| Dengue virus type 4 strain SW36i polyprotein gene, partial cds Length = 10114 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 481 gcaaactccttgaaatccttca 502 |||||||||||||||||||||| Sbjct: 5851 gcaaactccttgaaatccttca 5830
>gb|AY656168.1| Chimeric dengue virus vector p4(delta30)-D3L-ME, complete sequence Length = 15256 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 481 gcaaactccttgaaatccttca 502 |||||||||||||||||||||| Sbjct: 6381 gcaaactccttgaaatccttca 6360
>gb|AY656167.1| Chimeric dengue virus vector p4-D3L-ME, complete sequence Length = 15287 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 481 gcaaactccttgaaatccttca 502 |||||||||||||||||||||| Sbjct: 6381 gcaaactccttgaaatccttca 6360
>gb|AY648301.1| Dengue virus type 4 vector p4, complete sequence Length = 15270 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 481 gcaaactccttgaaatccttca 502 |||||||||||||||||||||| Sbjct: 6364 gcaaactccttgaaatccttca 6343
>gb|AC115834.8| Mus musculus chromosome 3, clone RP24-159L1, complete sequence Length = 175998 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 395 acttctctttgtttgctgcct 415 ||||||||||||||||||||| Sbjct: 101268 acttctctttgtttgctgcct 101248
>emb|Z81036.1|CEC16C2 Caenorhabditis elegans Cosmid C16C2, complete sequence Length = 21917 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 372 cttcttgatgtctgaaaataa 392 ||||||||||||||||||||| Sbjct: 15091 cttcttgatgtctgaaaataa 15111
>ref|XM_763279.1| Giardia lamblia ATCC 50803 hypothetical protein (GLP_15_12905_13390) partial mRNA Length = 486 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 ttgagcaggttctcatcagct 44 ||||||||||||||||||||| Sbjct: 443 ttgagcaggttctcatcagct 423
>ref|XM_763280.1| Giardia lamblia ATCC 50803 hypothetical protein (GLP_15_13494_12943) partial mRNA Length = 552 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 ttgagcaggttctcatcagct 44 ||||||||||||||||||||| Sbjct: 148 ttgagcaggttctcatcagct 168
>emb|Z99119.2|BSUB0016 Bacillus subtilis complete genome (section 16 of 21): from 3013458 to 3213379 Length = 199922 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 380 tgtctgaaaataacgacttct 400 ||||||||||||||||||||| Sbjct: 2059 tgtctgaaaataacgacttct 2039
>emb|X92428.1|ZMHOX1BGN Z.mays mRNA for Hox1b protein Length = 2790 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 262 ccagaccattcttcttcatca 282 ||||||||||||||||||||| Sbjct: 1632 ccagaccattcttcttcatca 1612
>emb|AL731817.11| Mouse DNA sequence from clone RP23-3J16 on chromosome 11 Contains a novel gene and the 3' end of a novel gene, complete sequence Length = 103582 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 285 gaagcaaaactctgaagaacc 305 ||||||||||||||||||||| Sbjct: 23966 gaagcaaaactctgaagaacc 23986
>gb|AC005375.4|AC005375 Homo sapiens chromosome 17, clone hRPK.388_F_14, complete sequence Length = 149030 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 162 taattatttcccctaaaaatg 182 ||||||||||||||||||||| Sbjct: 90915 taattatttcccctaaaaatg 90895
>gb|L17320.1|BACACKA Bacillus subtilis acetate kinase (ackA) gene, complete cds Length = 1951 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 380 tgtctgaaaataacgacttct 400 ||||||||||||||||||||| Sbjct: 519 tgtctgaaaataacgacttct 539
>gb|AF008220.1|AF008220 Bacillus subtilis rrnB-dnaB genomic region Length = 220060 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 380 tgtctgaaaataacgacttct 400 ||||||||||||||||||||| Sbjct: 162648 tgtctgaaaataacgacttct 162668
>ref|NM_152884.2| Danio rerio caspase b (caspb), mRNA Length = 1812 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 286 aagcaaaactctgaagaacc 305 |||||||||||||||||||| Sbjct: 329 aagcaaaactctgaagaacc 348
>gb|CP000233.1| Lactobacillus salivarius subsp. salivarius UCC118, complete genome Length = 1827111 Score = 40.1 bits (20), Expect = 8.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 53 cctaacagcagcttggcgtacaac 76 ||||||||| |||||||||||||| Sbjct: 609609 cctaacagctgcttggcgtacaac 609632
>gb|AC132339.3| Mus musculus BAC clone RP24-165O21 from chromosome 5, complete sequence Length = 152574 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 543 ctcctcagtgatgcccaaca 562 |||||||||||||||||||| Sbjct: 113551 ctcctcagtgatgcccaaca 113570
>gb|CP000243.1| Escherichia coli UTI89, complete genome Length = 5065741 Score = 40.1 bits (20), Expect = 8.1 Identities = 29/32 (90%) Strand = Plus / Minus Query: 456 gtcgttgatcgtctcgacggcatcagcaaact 487 |||||| || ||||||||| |||||||||||| Sbjct: 3791993 gtcgttcattgtctcgacgccatcagcaaact 3791962
>gb|AC091726.2| Gallus gallus clone WAG-126P17, complete sequence Length = 129285 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 86 tgagcactgattgcagaggg 105 |||||||||||||||||||| Sbjct: 58108 tgagcactgattgcagaggg 58127
>emb|AL078612.8|HSDJ65P5 Human DNA sequence from clone RP1-65P5 on chromosome 11p13 Contains the RCN1 gene for EF-hand calcium binding domain protein reticulocalbin 1, a seudogene similar to part of EIF4A (Eukaryotic Initiation Factor 4A), ESTs, STSs, GSSs and a putative CpG island, complete sequence Length = 94497 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 370 cacttcttgatgtctgaaaa 389 |||||||||||||||||||| Sbjct: 46257 cacttcttgatgtctgaaaa 46276
>emb|AL021069.1|HS970D1 Human DNA sequence from clone RP5-970D1 on chromosome 1q24 Contains the 3' end of a variant of the gene for expressed in hematopoietic cells (heart, liver) (HLL), complete sequence Length = 100496 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aactaattatttcccctaaa 178 |||||||||||||||||||| Sbjct: 64950 aactaattatttcccctaaa 64969
>emb|BX469930.13| Zebrafish DNA sequence from clone CH211-114L13 in linkage group 1, complete sequence Length = 183380 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 286 aagcaaaactctgaagaacc 305 |||||||||||||||||||| Sbjct: 49785 aagcaaaactctgaagaacc 49804
>gb|DQ022755.1| Danio rerio caspase b (caspb) mRNA, complete cds Length = 1215 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 286 aagcaaaactctgaagaacc 305 |||||||||||||||||||| Sbjct: 292 aagcaaaactctgaagaacc 311
>gb|BC095000.1| Danio rerio caspase b, mRNA (cDNA clone MGC:109807 IMAGE:7255283), complete cds Length = 1812 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 286 aagcaaaactctgaagaacc 305 |||||||||||||||||||| Sbjct: 329 aagcaaaactctgaagaacc 348
>gb|AF327410.1|AF327410 Danio rerio Caspy2 (caspy2) mRNA, complete cds Length = 1215 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 286 aagcaaaactctgaagaacc 305 |||||||||||||||||||| Sbjct: 292 aagcaaaactctgaagaacc 311
>gb|BC094169.1| Xenopus laevis cDNA clone MGC:115330 IMAGE:6948906, complete cds Length = 4388 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 538 cgttcctcctcagtgatgcc 557 |||||||||||||||||||| Sbjct: 1179 cgttcctcctcagtgatgcc 1160
>gb|AC129207.4| Mus musculus chromosome 5 clone RP24-280N5, complete sequence Length = 165994 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 543 ctcctcagtgatgcccaaca 562 |||||||||||||||||||| Sbjct: 117889 ctcctcagtgatgcccaaca 117870
>emb|Z34802.1|CEM88 Caenorhabditis elegans Cosmid M88, complete sequence Length = 32723 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 373 ttcttgatgtctgaaaataa 392 |||||||||||||||||||| Sbjct: 8409 ttcttgatgtctgaaaataa 8428 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,306,464 Number of Sequences: 3902068 Number of extensions: 5306464 Number of successful extensions: 105774 Number of sequences better than 10.0: 54 Number of HSP's better than 10.0 without gapping: 54 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 105619 Number of HSP's gapped (non-prelim): 155 length of query: 594 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 571 effective length of database: 17,143,297,704 effective search space: 9788822988984 effective search space used: 9788822988984 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)