>gb|AY065971.1| Triticum aestivum phosphoethanolamine methyltransferase mRNA,
            complete cds
          Length = 1782

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 42/45 (93%), Gaps = 2/45 (4%)
 Strand = Plus / Minus

                                                         
Query: 56   acgtacgtacacatcat--tatcttacagatccgggtgcccggcc 98
            |||||||||||||| ||  ||||||||||||||||||||||||||
Sbjct: 1691 acgtacgtacacattatcttatcttacagatccgggtgcccggcc 1647



 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 57/65 (87%), Gaps = 4/65 (6%)
 Strand = Plus / Minus

                                                                        
Query: 163  gcaccgatcctctttatttaattcttaaccgaagccgaagccgctctgcttccggatcat 222
            |||||||||||||||||||| |||||||    | | ||||| ||||||||||||||||||
Sbjct: 1635 gcaccgatcctctttattta-ttcttaat---aacagaagcggctctgcttccggatcat 1580

                 
Query: 223  cgcgt 227
            |||||
Sbjct: 1579 cgcgt 1575

>gb|AC108554.8| Rattus norvegicus 7 BAC CH230-81L13 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 157107

 Score = 48.1 bits (24), Expect = 0.013
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 167   cgatcctctttatttaattcttaa 190
             ||||||||||||||||||||||||
Sbjct: 32346 cgatcctctttatttaattcttaa 32369

>emb|AL953859.7| Zebrafish DNA sequence from clone DKEY-53P21, complete sequence
          Length = 203360

 Score = 42.1 bits (21), Expect = 0.78
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 32  acaaagttcagggnaacacacagcacgtacgt 63
           |||||||||| |  ||||||||||||||||||
Sbjct: 119 acaaagttcacgcaaacacacagcacgtacgt 150

>gb|AE007294.1| Sinorhizobium meliloti 1021 plasmid pSymA section 100 of 121 of the
            complete plasmid sequence
          Length = 9983

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 192  cgaagccgaagccgctctgc 211
            ||||||||||||||||||||
Sbjct: 5324 cgaagccgaagccgctctgc 5305

>ref|XM_757246.1| Ustilago maydis 521 hypothetical protein (UM06192.1) partial mRNA
          Length = 3558

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 137 ccaacacacggccacagcat 156
           ||||||||||||||||||||
Sbjct: 632 ccaacacacggccacagcat 651

>gb|AY223048.1| Schistosoma japonicum clone ZZD120 mRNA sequence
          Length = 1179

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 106 gcagccactgcaacaacaaa 125
           ||||||||||||||||||||
Sbjct: 878 gcagccactgcaacaacaaa 897

>emb|AL953854.21| Human DNA sequence from clone RP11-211P14 on chromosome 9 Contains a
             pseudogene similar to part of a vomeronasal 2 family
             protein and a novel protein similar to contactin
             associated protein-like 3 (CNTNAP3), complete sequence
          Length = 157546

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 173   tctttatttaattcttaacc 192
             ||||||||||||||||||||
Sbjct: 41424 tctttatttaattcttaacc 41405

>emb|BX664730.2| Human DNA sequence from clone RP11-118H15 on chromosome 9 Contains a
              novel gene, complete sequence
          Length = 171251

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 173    tctttatttaattcttaacc 192
              ||||||||||||||||||||
Sbjct: 158902 tctttatttaattcttaacc 158883

>emb|AL935212.11| Human DNA sequence from clone RP11-160N1 on chromosome 9 Contains
           eight novel pseudogenes, two novel genes and three CpG
           islands, complete sequence
          Length = 181647

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 173 tctttatttaattcttaacc 192
           ||||||||||||||||||||
Sbjct: 548 tctttatttaattcttaacc 567

>emb|AL954685.6| Human DNA sequence from clone RP11-237M21 on chromosome 9, complete
             sequence
          Length = 130124

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 173   tctttatttaattcttaacc 192
             ||||||||||||||||||||
Sbjct: 70560 tctttatttaattcttaacc 70579

>emb|AL953883.5| Human DNA sequence from clone RP11-246P17 on chromosome 9, complete
             sequence
          Length = 102894

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 173   tctttatttaattcttaacc 192
             ||||||||||||||||||||
Sbjct: 81891 tctttatttaattcttaacc 81872

>emb|AL590311.5| Human DNA sequence from clone RP11-20F16 on chromosome 9 Contains the
             5' end of the GDA gene for guanine deaminase and a CpG
             island, complete sequence
          Length = 131933

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 170   tcctctttatttaattctta 189
             ||||||||||||||||||||
Sbjct: 24338 tcctctttatttaattctta 24319

>emb|AL353791.7| Human DNA sequence from clone RP11-475B17 on chromosome 9 Contains the 3'
              end of novel protein similar to contactin associated
              protein-like 3 (CNTNAP3) and a pseudogene similar to part
              of vomeronasal 2 family, complete sequence
          Length = 208233

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 173    tctttatttaattcttaacc 192
              ||||||||||||||||||||
Sbjct: 104698 tctttatttaattcttaacc 104717

>emb|AL683804.15| Mouse DNA sequence from clone RP23-17F2 on chromosome 1 Contains  a
             SEC61 gamma subunit (Sec61g) pseudogene, a limb expression
             1 homolog (chicken) (Lix1) pseudogene, a novel pseudogene,
             the 5' end of the gene for an ortholog of human Ras
             association (RalGDS/AF-6) and pleckstrin homology domains
             1 RAPH1 and a CpG island, complete sequence
          Length = 198631

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 66    acatcattatcttacagatc 85
             ||||||||||||||||||||
Sbjct: 85216 acatcattatcttacagatc 85235

>gb|AC012049.8| Homo sapiens chromosome 10 clone RP11-76F22, complete sequence
          Length = 142656

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 169    atcctctttatttaattctt 188
              ||||||||||||||||||||
Sbjct: 125275 atcctctttatttaattctt 125294

>gb|AC022537.8| Homo sapiens chromosome 10 clone RP11-40C11, complete sequence
          Length = 154939

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 169   atcctctttatttaattctt 188
             ||||||||||||||||||||
Sbjct: 76263 atcctctttatttaattctt 76282

>gb|AC006207.5| Homo sapiens 12 PAC RPCI3-488H23 (Roswell Park Cancer Institute Human
             PAC Library) complete sequence
          Length = 109003

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 212   ttccggatcatcgcgtagcgtggc 235
             |||| |||||||||||||||||||
Sbjct: 92074 ttcctgatcatcgcgtagcgtggc 92051

>emb|BX545849.7| Mouse DNA sequence from clone RP23-232N16 on chromosome 4, complete
             sequence
          Length = 114104

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 115   gcaacaacaaatcacaccac 134
             ||||||||||||||||||||
Sbjct: 44262 gcaacaacaaatcacaccac 44243

>dbj|AP001803.4| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-100N3, complete
              sequences
          Length = 159372

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 170    tcctctttatttaattctta 189
              ||||||||||||||||||||
Sbjct: 103987 tcctctttatttaattctta 104006

>emb|AL591855.11| Human DNA sequence from clone RP11-4C12 on chromosome 9, complete
            sequence
          Length = 153214

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 173  tctttatttaattcttaacc 192
            ||||||||||||||||||||
Sbjct: 6785 tctttatttaattcttaacc 6804


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,068,503
Number of Sequences: 3902068
Number of extensions: 2068503
Number of successful extensions: 36464
Number of sequences better than 10.0: 20
Number of HSP's better than 10.0 without gapping: 20
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 36433
Number of HSP's gapped (non-prelim): 30
length of query: 241
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 219
effective length of database: 17,147,199,772
effective search space: 3755236750068
effective search space used: 3755236750068
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)