ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbaal23k12 |
|---|---|
| Clone Library Name | barley_pub |
>emb|Z37115.1|HVLTPPB H.vulgare (clone pKG285) mRNA for lipid transfer protein precursor Length = 691 Score = 266 bits (134), Expect = 4e-68 Identities = 146/151 (96%) Strand = Plus / Minus Query: 207 agtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtangggacgct 266 |||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 371 agtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 312 Query: 267 gacgccgcacatggaggggatgccggcggccttgccagcgttaagcccacccncancgct 326 |||||||||||||||||||||||||||||||||||||||||| ||||||||| || |||| Sbjct: 311 gacgccgcacatggaggggatgccggcggccttgccagcgtttagcccacccgcagcgct 252 Query: 327 cttgatgcacttgcacgccgcttgcttgtca 357 ||||||||||||||||||||||||||||||| Sbjct: 251 cttgatgcacttgcacgccgcttgcttgtca 221
>emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene Length = 1862 Score = 258 bits (130), Expect = 1e-65 Identities = 145/151 (96%) Strand = Plus / Minus Query: 207 agtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtangggacgct 266 |||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 1386 agtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 1327 Query: 267 gacgccgcacatggaggggatgccggcggccttgccagcgttaagcccacccncancgct 326 ||||||||||||||||||||| |||||||||||||||||||| ||||||||| || |||| Sbjct: 1326 gacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgct 1267 Query: 327 cttgatgcacttgcacgccgcttgcttgtca 357 ||||||||||||||||||||||||||||||| Sbjct: 1266 cttgatgcacttgcacgccgcttgcttgtca 1236
>emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA Length = 705 Score = 258 bits (130), Expect = 1e-65 Identities = 145/151 (96%) Strand = Plus / Minus Query: 207 agtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtangggacgct 266 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 416 agtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 357 Query: 267 gacgccgcacatggaggggatgccggcggccttgccagcgttaagcccacccncancgct 326 |||||||||||||||||||||||||||||||||||||||||| |||||||| || |||| Sbjct: 356 gacgccgcacatggaggggatgccggcggccttgccagcgtttagcccaccagcagcgct 297 Query: 327 cttgatgcacttgcacgccgcttgcttgtca 357 |||||||||||||||||||||||| |||||| Sbjct: 296 cttgatgcacttgcacgccgcttgtttgtca 266
>emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene Length = 1567 Score = 250 bits (126), Expect = 3e-63 Identities = 144/151 (95%) Strand = Plus / Minus Query: 207 agtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtangggacgct 266 |||||||||||||||||||||||||||||| |||||||| ||||||||||| |||||||| Sbjct: 1021 agtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtaggggacgct 962 Query: 267 gacgccgcacatggaggggatgccggcggccttgccagcgttaagcccacccncancgct 326 ||||||||||||||||||||| |||||||||||||||||||| ||||||||| || |||| Sbjct: 961 gacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgct 902 Query: 327 cttgatgcacttgcacgccgcttgcttgtca 357 ||||||||||||||||||||||||||||||| Sbjct: 901 cttgatgcacttgcacgccgcttgcttgtca 871
>gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt4.9) gene, complete cds Length = 3238 Score = 250 bits (126), Expect = 3e-63 Identities = 144/151 (95%) Strand = Plus / Minus Query: 207 agtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtangggacgct 266 |||||||||||||||||||||||||||||| |||||||| ||||||||||| |||||||| Sbjct: 2417 agtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtaggggacgct 2358 Query: 267 gacgccgcacatggaggggatgccggcggccttgccagcgttaagcccacccncancgct 326 ||||||||||||||||||||| |||||||||||||||||||| ||||||||| || |||| Sbjct: 2357 gacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgct 2298 Query: 327 cttgatgcacttgcacgccgcttgcttgtca 357 ||||||||||||||||||||||||||||||| Sbjct: 2297 cttgatgcacttgcacgccgcttgcttgtca 2267
>gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer protein precursor gene, complete cds Length = 573 Score = 202 bits (102), Expect = 6e-49 Identities = 138/151 (91%) Strand = Plus / Minus Query: 207 agtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtangggacgct 266 |||||| |||||| |||||||||||||||||||||||| |||||||| ||| |||||||| Sbjct: 442 agtggtcgatcagtgaatcttagagcagtcgacggaagtgctgatggagtaggggacgct 383 Query: 267 gacgccgcacatggaggggatgccggcggccttgccagcgttaagcccacccncancgct 326 |||||||||| ||||||||||||||||||||||||||||||| | |||| | || |||| Sbjct: 382 gacgccgcacttggaggggatgccggcggccttgccagcgtttaacccagcggcagcgct 323 Query: 327 cttgatgcacttgcacgccgcttgcttgtca 357 |||||||||||||||| |||||||||||||| Sbjct: 322 cttgatgcacttgcacaccgcttgcttgtca 292
>emb|AJ784903.1| Triticum turgidum subsp. durum partial mRNA for type 1 non-specific lipid transfer protein precursor (ltp9.2 gene) Length = 604 Score = 196 bits (99), Expect = 3e-47 Identities = 132/144 (91%) Strand = Plus / Minus Query: 214 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtangggacgctgacgccg 273 |||||||||||||||||||||||||| |||| |||||||||||| |||||||| |||||| Sbjct: 315 gatcagcgaatcttagagcagtcgaccgaagagctgatggcgtaagggacgctaacgccg 256 Query: 274 cacatggaggggatgccggcggccttgccagcgttaagcccacccncancgctcttgatg 333 ||| | | ||||||||||||||||||||||||||| |||||| | || ||||||||||| Sbjct: 255 cactttgtggggatgccggcggccttgccagcgttgagcccagcagcagcgctcttgatg 196 Query: 334 cacttgcacgccgcttgcttgtca 357 |||||||||||||||||||||||| Sbjct: 195 cacttgcacgccgcttgcttgtca 172
>emb|AJ852555.1| Triticum aestivum ltp9.2c gene for type 1 non specific lipid transfer protein precursor Length = 2122 Score = 196 bits (99), Expect = 3e-47 Identities = 132/144 (91%) Strand = Plus / Minus Query: 214 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtangggacgctgacgccg 273 |||||||||||||||||||||||||| |||| |||||||||||| |||||||| |||||| Sbjct: 1619 gatcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccg 1560 Query: 274 cacatggaggggatgccggcggccttgccagcgttaagcccacccncancgctcttgatg 333 ||| | | ||||||||||||||||||||||||||| |||||| | || ||||||||||| Sbjct: 1559 cactttgtggggatgccggcggccttgccagcgttgagcccagcagcagcgctcttgatg 1500 Query: 334 cacttgcacgccgcttgcttgtca 357 |||||||||||||||||||||||| Sbjct: 1499 cacttgcacgccgcttgcttgtca 1476
>emb|AJ784901.1| Triticum aestivum mRNA for type 1 non-specific lipid transfer protein precursor (ltp9.2 gene) Length = 708 Score = 180 bits (91), Expect = 2e-42 Identities = 130/144 (90%) Strand = Plus / Minus Query: 214 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtangggacgctgacgccg 273 |||||||||||||||||||||||||| |||| |||||||||||| |||| ||| |||||| Sbjct: 416 gatcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggatgctaacgccg 357 Query: 274 cacatggaggggatgccggcggccttgccagcgttaagcccacccncancgctcttgatg 333 ||| | | ||||||||||||||||||||||||||| |||||| | || |||||||||| Sbjct: 356 cactttgtggggatgccggcggccttgccagcgttgagcccagcagcagcgctcttgata 297 Query: 334 cacttgcacgccgcttgcttgtca 357 |||||||||||||||||||||||| Sbjct: 296 cacttgcacgccgcttgcttgtca 273
>gb|DQ465676.1| Triticum aestivum clone Lt10F9 non-specific lipid transfer protein 1 precursor, mRNA, complete cds Length = 348 Score = 176 bits (89), Expect = 3e-41 Identities = 128/142 (90%) Strand = Plus / Minus Query: 216 tcagcgaatcttagagcagtcgacggaagcgctgatggcgtangggacgctgacgccgca 275 |||||||||||||||||||||||| |||| |||||||||||| |||||||| |||||||| Sbjct: 348 tcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgca 289 Query: 276 catggaggggatgccggcggccttgccagcgttaagcccacccncancgctcttgatgca 335 | | | ||||||||| ||||||||||||||||| |||||| | || |||||||||| || Sbjct: 288 ctttgtggggatgcccgcggccttgccagcgttgagcccagcagcagcgctcttgataca 229 Query: 336 cttgcacgccgcttgcttgtca 357 |||||||||||||||||||||| Sbjct: 228 cttgcacgccgcttgcttgtca 207
>gb|DQ465678.1| Triticum aestivum clone Lt10E10 non-specific lipid transfer protein 1 precursor, mRNA, complete cds Length = 348 Score = 176 bits (89), Expect = 3e-41 Identities = 128/142 (90%) Strand = Plus / Minus Query: 216 tcagcgaatcttagagcagtcgacggaagcgctgatggcgtangggacgctgacgccgca 275 |||||||||||||||||||||||| |||| |||||||||||| |||||||| |||||||| Sbjct: 348 tcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgca 289 Query: 276 catggaggggatgccggcggccttgccagcgttaagcccacccncancgctcttgatgca 335 | | | ||||||||| ||||||||||||||||| |||||| | || |||||||||| || Sbjct: 288 ctttgtggggatgcccgcggccttgccagcgttgagcccagcagcagcgctcttgataca 229 Query: 336 cttgcacgccgcttgcttgtca 357 |||||||||||||||||||||| Sbjct: 228 cttgcacgccgcttgcttgtca 207
>emb|AJ852556.1| Triticum aestivum ltp9.2d gene for type 1 non specific lipid transfer protein precursor Length = 2087 Score = 172 bits (87), Expect = 5e-40 Identities = 129/144 (89%) Strand = Plus / Minus Query: 214 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtangggacgctgacgccg 273 |||||| ||||||||||||||||||| |||| |||||||||||| |||||||| |||||| Sbjct: 1607 gatcagtgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccg 1548 Query: 274 cacatggaggggatgccggcggccttgccagcgttaagcccacccncancgctcttgatg 333 ||| | | |||||||||||||||||||||||| || |||||| | || ||||||||||| Sbjct: 1547 cactttgtggggatgccggcggccttgccagcattgagcccagcagcagcgctcttgatg 1488 Query: 334 cacttgcacgccgcttgcttgtca 357 ||||||||| |||||||||||||| Sbjct: 1487 cacttgcacaccgcttgcttgtca 1464
>gb|DQ465679.1| Triticum aestivum clone Lt19C10 non-specific lipid transfer protein 1 precursor, mRNA, complete cds Length = 348 Score = 168 bits (85), Expect = 8e-39 Identities = 127/142 (89%) Strand = Plus / Minus Query: 216 tcagcgaatcttagagcagtcgacggaagcgctgatggcgtangggacgctgacgccgca 275 ||||||||||||||||||||| ||||| | ||| |||||||| |||| |||||||||||| Sbjct: 348 tcagcgaatcttagagcagtccacggatgagctaatggcgtaggggatgctgacgccgca 289 Query: 276 catggaggggatgccggcggccttgccagcgttaagcccacccncancgctcttgatgca 335 | ||||||||||||| |||||||| |||||||| |||||||| || | ||||| ||||| Sbjct: 288 cttggaggggatgcctgcggcctttccagcgttgagcccaccagcagcactcttaatgca 229 Query: 336 cttgcacgccgcttgcttgtca 357 |||||||||||||||||||||| Sbjct: 228 cttgcacgccgcttgcttgtca 207
>gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) gene, complete cds Length = 3448 Score = 115 bits (58), Expect = 1e-22 Identities = 121/143 (84%) Strand = Plus / Minus Query: 214 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtangggacgctgacgccg 273 |||||| | |||||||||||||| ||||| |||||||||| ||| |||| |||||||||| Sbjct: 3206 gatcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccg 3147 Query: 274 cacatggaggggatgccggcggccttgccagcgttaagcccacccncancgctcttgatg 333 ||| |||||||||| | || ||||| || | ||| |||||||| || | ||||||||| Sbjct: 3146 cacttggaggggatacttgcagcctttccggggttgagcccaccggcagcactcttgatg 3087 Query: 334 cacttgcacgccgcttgcttgtc 356 ||| |||| |||||||||||||| Sbjct: 3086 cacctgcatgccgcttgcttgtc 3064 Score = 56.0 bits (28), Expect = 8e-05 Identities = 37/40 (92%) Strand = Plus / Minus Query: 115 ctcacatggagatcagatcagagcgtttattcatatatat 154 ||||||||||||||| |||||||| ||||||||| ||||| Sbjct: 3341 ctcacatggagatcatatcagagcatttattcatgtatat 3302
>gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein precursor (LTP1) mRNA, complete cds Length = 737 Score = 115 bits (58), Expect = 1e-22 Identities = 121/143 (84%) Strand = Plus / Minus Query: 214 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtangggacgctgacgccg 273 |||||| | |||||||||||||| ||||| |||||||||| ||| |||| |||||||||| Sbjct: 410 gatcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccg 351 Query: 274 cacatggaggggatgccggcggccttgccagcgttaagcccacccncancgctcttgatg 333 ||| |||||||||| | || ||||| || | ||| |||||||| || | ||||||||| Sbjct: 350 cacttggaggggatacttgcagcctttccggggttgagcccaccggcagcactcttgatg 291 Query: 334 cacttgcacgccgcttgcttgtc 356 ||| |||| |||||||||||||| Sbjct: 290 cacctgcatgccgcttgcttgtc 268 Score = 56.0 bits (28), Expect = 8e-05 Identities = 37/40 (92%) Strand = Plus / Minus Query: 115 ctcacatggagatcagatcagagcgtttattcatatatat 154 ||||||||||||||| |||||||| ||||||||| ||||| Sbjct: 545 ctcacatggagatcatatcagagcatttattcatgtatat 506
>gb|AY796184.1| Triticum aestivum lipid transfer protein (LTP1) mRNA, complete cds Length = 348 Score = 113 bits (57), Expect = 4e-22 Identities = 114/134 (85%) Strand = Plus / Minus Query: 223 atcttagagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggag 282 |||||||||||||| ||||| |||||||||| ||| |||| ||||||||||||| ||||| Sbjct: 341 atcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccgcacttggag 282 Query: 283 gggatgccggcggccttgccagcgttaagcccacccncancgctcttgatgcacttgcac 342 ||||| | || ||||| || | ||| |||||||| || | |||||||||||| |||| Sbjct: 281 gggatacttgcagcctttccggggttgagcccaccggcagcactcttgatgcacctgcat 222 Query: 343 gccgcttgcttgtc 356 |||||||||||||| Sbjct: 221 gccgcttgcttgtc 208
>gb|AC135561.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0086N07 map S790A, complete sequence Length = 178523 Score = 113 bits (57), Expect = 4e-22 Identities = 80/88 (90%) Strand = Plus / Plus Query: 227 tagagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggagggga 286 |||||||||||| |||||||||||||| ||| |||||||||||||||||| ||||||||| Sbjct: 94021 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 94080 Query: 287 tgccggcggccttgccagcgttaagccc 314 ||| |||||| ||||| ||||| ||||| Sbjct: 94081 tgctggcggcgttgccggcgttgagccc 94108
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 113 bits (57), Expect = 4e-22 Identities = 80/88 (90%) Strand = Plus / Minus Query: 227 tagagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggagggga 286 |||||||||||| |||||||||||||| ||| |||||||||||||||||| ||||||||| Sbjct: 13090059 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 13090000 Query: 287 tgccggcggccttgccagcgttaagccc 314 ||| |||||| ||||| ||||| ||||| Sbjct: 13089999 tgctggcggcgttgccggcgttgagccc 13089972 Score = 101 bits (51), Expect = 2e-18 Identities = 77/86 (89%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 |||||||||| |||||||||||||| ||| |||||||||||||||||| | ||||||||| Sbjct: 702441 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 702382 Query: 289 ccggcggccttgccagcgttaagccc 314 | |||||| ||||| ||||| ||||| Sbjct: 702381 ctggcggcgttgccggcgttgagccc 702356 Score = 81.8 bits (41), Expect = 1e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 |||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 692764 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 692705 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 692704 ctggcggcattgccggcgtt 692685 Score = 69.9 bits (35), Expect = 5e-09 Identities = 58/66 (87%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||||| |||||||||||| |||| | ||||| ||||| ||||||||||| Sbjct: 679469 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 679410 Query: 289 ccggcg 294 |||||| Sbjct: 679409 ccggcg 679404 Score = 40.1 bits (20), Expect = 4.7 Identities = 32/36 (88%) Strand = Plus / Minus Query: 261 gacgctgacgccgcacatggaggggatgccggcggc 296 |||| ||||||||||| || ||||||||||||||| Sbjct: 714845 gacgttgacgccgcacttgccggggatgccggcggc 714810
>dbj|AK071260.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086A05, full insert sequence Length = 843 Score = 113 bits (57), Expect = 4e-22 Identities = 80/88 (90%) Strand = Plus / Minus Query: 227 tagagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggagggga 286 |||||||||||| |||||||||||||| ||| |||||||||||||||||| ||||||||| Sbjct: 459 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 400 Query: 287 tgccggcggccttgccagcgttaagccc 314 ||| |||||| ||||| ||||| ||||| Sbjct: 399 tgctggcggcgttgccggcgttgagccc 372
>dbj|AK061288.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-H12, full insert sequence Length = 846 Score = 113 bits (57), Expect = 4e-22 Identities = 80/88 (90%) Strand = Plus / Minus Query: 227 tagagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggagggga 286 |||||||||||| |||||||||||||| ||| |||||||||||||||||| ||||||||| Sbjct: 458 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 399 Query: 287 tgccggcggccttgccagcgttaagccc 314 ||| |||||| ||||| ||||| ||||| Sbjct: 398 tgctggcggcgttgccggcgttgagccc 371
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 113 bits (57), Expect = 4e-22 Identities = 80/88 (90%) Strand = Plus / Minus Query: 227 tagagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggagggga 286 |||||||||||| |||||||||||||| ||| |||||||||||||||||| ||||||||| Sbjct: 13170238 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 13170179 Query: 287 tgccggcggccttgccagcgttaagccc 314 ||| |||||| ||||| ||||| ||||| Sbjct: 13170178 tgctggcggcgttgccggcgttgagccc 13170151 Score = 101 bits (51), Expect = 2e-18 Identities = 77/86 (89%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 |||||||||| |||||||||||||| ||| |||||||||||||||||| | ||||||||| Sbjct: 702441 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 702382 Query: 289 ccggcggccttgccagcgttaagccc 314 | |||||| ||||| ||||| ||||| Sbjct: 702381 ctggcggcgttgccggcgttgagccc 702356 Score = 81.8 bits (41), Expect = 1e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 |||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 692764 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 692705 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 692704 ctggcggcattgccggcgtt 692685 Score = 69.9 bits (35), Expect = 5e-09 Identities = 58/66 (87%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||||| |||||||||||| |||| | ||||| ||||| ||||||||||| Sbjct: 679469 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 679410 Query: 289 ccggcg 294 |||||| Sbjct: 679409 ccggcg 679404 Score = 40.1 bits (20), Expect = 4.7 Identities = 32/36 (88%) Strand = Plus / Minus Query: 261 gacgctgacgccgcacatggaggggatgccggcggc 296 |||| ||||||||||| || ||||||||||||||| Sbjct: 714845 gacgttgacgccgcacttgccggggatgccggcggc 714810
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 109 bits (55), Expect = 6e-21 Identities = 78/86 (90%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 |||||||||| |||||||||||||| ||| |||||||||||||||||| ||||||||||| Sbjct: 736743 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 736684 Query: 289 ccggcggccttgccagcgttaagccc 314 | |||||| ||||| ||||| ||||| Sbjct: 736683 ctggcggcgttgccggcgttgagccc 736658 Score = 81.8 bits (41), Expect = 1e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 |||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 732616 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 732557 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 732556 ctggcggcattgccggcgtt 732537 Score = 69.9 bits (35), Expect = 5e-09 Identities = 58/66 (87%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||||| |||||| ||||| |||| | ||||||||||| ||||||||||| Sbjct: 722727 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 722668 Query: 289 ccggcg 294 |||||| Sbjct: 722667 ccggcg 722662 Score = 40.1 bits (20), Expect = 4.7 Identities = 32/36 (88%) Strand = Plus / Minus Query: 261 gacgctgacgccgcacatggaggggatgccggcggc 296 |||| ||||||||||| || ||||||||||||||| Sbjct: 745555 gacgttgacgccgcacttgccggggatgccggcggc 745520
>emb|X83435.1|OSLTPA15 O.sativa mRNA for lipid transfer protein, a15 Length = 511 Score = 109 bits (55), Expect = 6e-21 Identities = 78/86 (90%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 |||||||||| |||||||||||||| ||| |||||||||||||||||| ||||||||||| Sbjct: 413 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 354 Query: 289 ccggcggccttgccagcgttaagccc 314 | |||||| ||||| ||||| ||||| Sbjct: 353 ctggcggcgttgccggcgttgagccc 328
>dbj|AK059808.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-A04, full insert sequence Length = 995 Score = 109 bits (55), Expect = 6e-21 Identities = 78/86 (90%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 |||||||||| |||||||||||||| ||| |||||||||||||||||| ||||||||||| Sbjct: 670 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 611 Query: 289 ccggcggccttgccagcgttaagccc 314 | |||||| ||||| ||||| ||||| Sbjct: 610 ctggcggcgttgccggcgttgagccc 585
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 109 bits (55), Expect = 6e-21 Identities = 78/86 (90%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 |||||||||| |||||||||||||| ||| |||||||||||||||||| ||||||||||| Sbjct: 736743 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 736684 Query: 289 ccggcggccttgccagcgttaagccc 314 | |||||| ||||| ||||| ||||| Sbjct: 736683 ctggcggcgttgccggcgttgagccc 736658 Score = 81.8 bits (41), Expect = 1e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 |||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 732616 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 732557 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 732556 ctggcggcattgccggcgtt 732537 Score = 69.9 bits (35), Expect = 5e-09 Identities = 58/66 (87%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||||| |||||| ||||| |||| | ||||||||||| ||||||||||| Sbjct: 722727 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 722668 Query: 289 ccggcg 294 |||||| Sbjct: 722667 ccggcg 722662 Score = 40.1 bits (20), Expect = 4.7 Identities = 32/36 (88%) Strand = Plus / Minus Query: 261 gacgctgacgccgcacatggaggggatgccggcggc 296 |||| ||||||||||| || ||||||||||||||| Sbjct: 745555 gacgttgacgccgcacttgccggggatgccggcggc 745520
>emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136_E08 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 118211 Score = 109 bits (55), Expect = 6e-21 Identities = 78/86 (90%) Strand = Plus / Plus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 |||||||||| |||||||||||||| ||| |||||||||||||||||| ||||||||||| Sbjct: 42391 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 42450 Query: 289 ccggcggccttgccagcgttaagccc 314 | |||||| ||||| ||||| ||||| Sbjct: 42451 ctggcggcgttgccggcgttgagccc 42476 Score = 81.8 bits (41), Expect = 1e-12 Identities = 70/80 (87%) Strand = Plus / Plus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 |||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 46518 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 46577 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 46578 ctggcggcattgccggcgtt 46597 Score = 69.9 bits (35), Expect = 5e-09 Identities = 58/66 (87%) Strand = Plus / Plus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||||| |||||| ||||| |||| | ||||||||||| ||||||||||| Sbjct: 56407 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 56466 Query: 289 ccggcg 294 |||||| Sbjct: 56467 ccggcg 56472 Score = 40.1 bits (20), Expect = 4.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 261 gacgctgacgccgcacatggaggggatgccggcggc 296 |||| ||||||||||| || ||||||||||||||| Sbjct: 33579 gacgttgacgccgcacttgccggggatgccggcggc 33614
>gb|DQ465677.1| Triticum aestivum clone Lt10B6 non-specific lipid transfer protein 1 precursor, mRNA, complete cds Length = 348 Score = 105 bits (53), Expect = 1e-19 Identities = 113/134 (84%) Strand = Plus / Minus Query: 223 atcttagagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggag 282 ||||||||||| || ||||| |||||||||| ||| |||| ||||||||||||| ||||| Sbjct: 341 atcttagagcaatccacggatgcgctgatggagtaggggatgctgacgccgcacttggag 282 Query: 283 gggatgccggcggccttgccagcgttaagcccacccncancgctcttgatgcacttgcac 342 ||||| | || ||||| || | ||| |||||||| || | |||||||||||| |||| Sbjct: 281 gggatacttgcagcctttccggggttgagcccaccggcagcactcttgatgcacctgcat 222 Query: 343 gccgcttgcttgtc 356 |||||||||||||| Sbjct: 221 gccgcttgcttgtc 208
>gb|AY335485.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LT1 mRNA, complete cds Length = 530 Score = 101 bits (51), Expect = 2e-18 Identities = 77/86 (89%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 |||||||||| |||||||||||||| ||| |||||||||||||||||| | ||||||||| Sbjct: 426 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 367 Query: 289 ccggcggccttgccagcgttaagccc 314 | |||||| ||||| ||||| ||||| Sbjct: 366 ctggcggcgttgccggcgttgagccc 341
>emb|Y08691.1|OSLPI O.sativa mRNA for lipid transfer protein Length = 799 Score = 101 bits (51), Expect = 2e-18 Identities = 77/86 (89%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||| |||| |||||||||||||| ||| |||||||||||||||||| ||||||||||| Sbjct: 438 gagcaatcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 379 Query: 289 ccggcggccttgccagcgttaagccc 314 | |||||| ||||| ||||| ||||| Sbjct: 378 ctggcggcgttgccggcgttgagccc 353
>dbj|AK070414.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023053H09, full insert sequence Length = 2882 Score = 101 bits (51), Expect = 2e-18 Identities = 77/86 (89%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 |||||||||| |||||||||||||| ||| |||||||||||||||||| | ||||||||| Sbjct: 2445 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 2386 Query: 289 ccggcggccttgccagcgttaagccc 314 | |||||| ||||| ||||| ||||| Sbjct: 2385 ctggcggcgttgccggcgttgagccc 2360
>dbj|AK058805.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-003-B09, full insert sequence Length = 551 Score = 101 bits (51), Expect = 2e-18 Identities = 77/86 (89%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 |||||||||| |||||||||||||| ||| |||||||||||||||||| | ||||||||| Sbjct: 322 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 263 Query: 289 ccggcggccttgccagcgttaagccc 314 | |||||| ||||| ||||| ||||| Sbjct: 262 ctggcggcgttgccggcgttgagccc 237
>emb|BX000512.1|CNS08CE2 Oryza sativa chromosome 11, . BAC OSJNBa0025K19 of library OSJNBa from chromosome 11 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 181322 Score = 101 bits (51), Expect = 2e-18 Identities = 77/86 (89%) Strand = Plus / Plus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 |||||||||| |||||||||||||| ||| |||||||||||||||||| | ||||||||| Sbjct: 40531 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 40590 Query: 289 ccggcggccttgccagcgttaagccc 314 | |||||| ||||| ||||| ||||| Sbjct: 40591 ctggcggcgttgccggcgttgagccc 40616 Score = 81.8 bits (41), Expect = 1e-12 Identities = 70/80 (87%) Strand = Plus / Plus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 |||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 50208 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 50267 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 50268 ctggcggcattgccggcgtt 50287 Score = 69.9 bits (35), Expect = 5e-09 Identities = 58/66 (87%) Strand = Plus / Plus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||||| |||||||||||| |||| | ||||| ||||| ||||||||||| Sbjct: 63503 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 63562 Query: 289 ccggcg 294 |||||| Sbjct: 63563 ccggcg 63568 Score = 40.1 bits (20), Expect = 4.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 261 gacgctgacgccgcacatggaggggatgccggcggc 296 |||| ||||||||||| || ||||||||||||||| Sbjct: 28127 gacgttgacgccgcacttgccggggatgccggcggc 28162
>gb|U77295.1|OSU77295 Oryza sativa lipid transfer protein (LTP) mRNA, complete cds Length = 799 Score = 101 bits (51), Expect = 2e-18 Identities = 77/86 (89%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||| |||| |||||||||||||| ||| |||||||||||||||||| ||||||||||| Sbjct: 438 gagcaatcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 379 Query: 289 ccggcggccttgccagcgttaagccc 314 | |||||| ||||| ||||| ||||| Sbjct: 378 ctggcggcgttgccggcgttgagccc 353
>gb|AF017360.1|AF017360 Oryza sativa lipid transfer protein LPT III mRNA, complete cds Length = 805 Score = 99.6 bits (50), Expect = 6e-18 Identities = 78/86 (90%), Gaps = 1/86 (1%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 |||||||||| |||||||||||||| ||| |||||||||||||||||| ||||||||||| Sbjct: 412 gagcagtcgatggaagcgctgatggtgta-gggacgctgacgccgcacttggaggggatg 354 Query: 289 ccggcggccttgccagcgttaagccc 314 | |||||| ||||| ||||| ||||| Sbjct: 353 ctggcggcgttgccggcgttgagccc 328
>gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein precursor (LTP2) mRNA, complete cds Length = 730 Score = 95.6 bits (48), Expect = 9e-17 Identities = 77/87 (88%) Strand = Plus / Minus Query: 214 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtangggacgctgacgccg 273 |||||| | |||||||||||||| ||||| |||||||| | ||| ||||||||||||||| Sbjct: 429 gatcagtggatcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccg 370 Query: 274 cacatggaggggatgccggcggccttg 300 ||| ||||||| ||||| ||||||||| Sbjct: 369 cacttggagggaatgcctgcggccttg 343 Score = 56.0 bits (28), Expect = 8e-05 Identities = 37/40 (92%) Strand = Plus / Minus Query: 115 ctcacatggagatcagatcagagcgtttattcatatatat 154 ||||||||||||||| |||||||| ||||||||| ||||| Sbjct: 550 ctcacatggagatcatatcagagcatttattcatgtatat 511
>emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non specific lipid transfer protein precursor Length = 496 Score = 95.6 bits (48), Expect = 9e-17 Identities = 77/87 (88%) Strand = Plus / Minus Query: 214 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtangggacgctgacgccg 273 |||||| | |||||||||||||| ||||| |||||||| | ||| ||||||||||||||| Sbjct: 370 gatcagtggatcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccg 311 Query: 274 cacatggaggggatgccggcggccttg 300 ||| ||||||| ||||| ||||||||| Sbjct: 310 cacttggagggaatgcctgcggccttg 284 Score = 56.0 bits (28), Expect = 8e-05 Identities = 37/40 (92%) Strand = Plus / Minus Query: 115 ctcacatggagatcagatcagagcgtttattcatatatat 154 ||||||||||||||| |||||||| ||||||||| ||||| Sbjct: 491 ctcacatggagatcatatcagagcatttattcatgtatat 452
>gb|AY754742.1| Triticum aestivum lipid transfer protein (LTP2) mRNA, complete cds Length = 348 Score = 93.7 bits (47), Expect = 4e-16 Identities = 70/78 (89%) Strand = Plus / Minus Query: 223 atcttagagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggag 282 |||||||||||||| ||||| |||||||| | ||| |||||||||||||||||| ||||| Sbjct: 341 atcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccgcacttggag 282 Query: 283 gggatgccggcggccttg 300 || ||||| ||||||||| Sbjct: 281 ggaatgcctgcggccttg 264
>gb|AF017361.1|AF017361 Oryza sativa lipid transfer protein LPT IV mRNA, complete cds Length = 507 Score = 93.7 bits (47), Expect = 4e-16 Identities = 76/86 (88%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||| || |||||||||||||| ||| |||||||||||||||||| | ||||||||| Sbjct: 373 gagcagtggatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 314 Query: 289 ccggcggccttgccagcgttaagccc 314 | |||||| ||||| ||||| ||||| Sbjct: 313 ctggcggcgttgccggcgttgagccc 288
>emb|X56547.1|HSBLT4 H. vulgare BLT4 mRNA Length = 724 Score = 87.7 bits (44), Expect = 2e-14 Identities = 82/95 (86%) Strand = Plus / Minus Query: 214 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtangggacgctgacgccg 273 |||||| | ||||||||||||||||| |||||||| | ||| ||||||||||||||| Sbjct: 420 gatcagtggatcttagagcagtcgacactggcgctgatcgtgtaggggacgctgacgccg 361 Query: 274 cacatggaggggatgccggcggccttgccagcgtt 308 ||| ||||||||||||| |||||| |||| ||||| Sbjct: 360 cacctggaggggatgcctgcggccctgccggcgtt 326
>gb|AY327042.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LPT1 mRNA, complete cds Length = 647 Score = 81.8 bits (41), Expect = 1e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 |||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 469 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 410 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 409 ctggcggcattgccggcgtt 390
>emb|Z23271.1|OSLPTPRA O.sativa lipid transfer protein gene, complete CDS Length = 1485 Score = 81.8 bits (41), Expect = 1e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 |||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 701 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 642 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 641 ctggcggcattgccggcgtt 622
>emb|X71669.1|SVTLP1R S.vulgare ltp1 mRNA Length = 717 Score = 81.8 bits (41), Expect = 1e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||||||||||||||||| ||||||||||| Sbjct: 294 gagcagtcggtggaggtgctgatggtgtaggggacgctgacgccgcacttggaggggatg 235 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 234 ctggcggcgttgccggcgtt 215
>emb|X71667.1|SVLTP1 S.vulgare ltp1 gene Length = 1499 Score = 81.8 bits (41), Expect = 1e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||||||||||||||||| ||||||||||| Sbjct: 997 gagcagtcggtggaggtgctgatggtgtaggggacgctgacgccgcacttggaggggatg 938 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 937 ctggcggcgttgccggcgtt 918
>emb|X83434.1|OSLTPB1 O.sativa mRNA for lipid transfer protein, b1 Length = 692 Score = 81.8 bits (41), Expect = 1e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 |||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 331 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 272 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 271 ctggcggcattgccggcgtt 252
>dbj|AK059819.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-C07, full insert sequence Length = 1003 Score = 81.8 bits (41), Expect = 1e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 |||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 654 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 595 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 594 ctggcggcattgccggcgtt 575
>dbj|AK058896.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-G08, full insert sequence Length = 840 Score = 81.8 bits (41), Expect = 1e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 |||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 437 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 378 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 377 ctggcggcattgccggcgtt 358
>gb|AF017359.1|AF017359 Oryza sativa lipid transfer protein LPT II mRNA, complete cds Length = 845 Score = 81.8 bits (41), Expect = 1e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 |||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 419 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 360 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 359 ctggcggcattgccggcgtt 340
>emb|Z37114.1|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid transfer protein precursor Length = 627 Score = 79.8 bits (40), Expect = 6e-12 Identities = 81/95 (85%) Strand = Plus / Minus Query: 214 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtangggacgctgacgccg 273 |||||| | ||||| ||||||||||| |||||||| | ||| ||||||||||||||| Sbjct: 352 gatcagtggatcttggagcagtcgacactggcgctgatcgtgtaggggacgctgacgccg 293 Query: 274 cacatggaggggatgccggcggccttgccagcgtt 308 ||| ||||||||||||| |||||| |||| ||||| Sbjct: 292 cacctggaggggatgcctgcggccctgccggcgtt 258
>emb|X71668.1|SVLTP2 S.vulgare ltp2 gene Length = 1800 Score = 77.8 bits (39), Expect = 2e-11 Identities = 65/74 (87%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 965 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 906 Query: 289 ccggcggccttgcc 302 | |||||||||||| Sbjct: 905 ctggcggccttgcc 892
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 77.8 bits (39), Expect = 2e-11 Identities = 59/66 (89%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||||| |||||||||||| |||| | ||||||||||| ||||||||||| Sbjct: 14437064 gagcagtcggtggaagggctgatggcgtaggggatgttgacgccgcacttggaggggatg 14437005 Query: 289 ccggcg 294 |||||| Sbjct: 14437004 ccggcg 14436999 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 116 tcacatggagatcagatcaga 136 ||||||||||||||||||||| Sbjct: 22847882 tcacatggagatcagatcaga 22847902
>dbj|AP004134.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1116_C12 Length = 116758 Score = 77.8 bits (39), Expect = 2e-11 Identities = 59/66 (89%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||||| |||||||||||| |||| | ||||||||||| ||||||||||| Sbjct: 45562 gagcagtcggtggaagggctgatggcgtaggggatgttgacgccgcacttggaggggatg 45503 Query: 289 ccggcg 294 |||||| Sbjct: 45502 ccggcg 45497
>gb|AF017358.1|AF017358 Oryza sativa lipid transfer protein mRNA, complete cds Length = 695 Score = 73.8 bits (37), Expect = 3e-10 Identities = 60/68 (88%) Strand = Plus / Minus Query: 241 gaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttg 300 |||| |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| ||| Sbjct: 325 gaagggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattg 266 Query: 301 ccagcgtt 308 || ||||| Sbjct: 265 ccggcgtt 258
>gb|U66105.1|ZMU66105 Zea mays phospholipid transfer protein mRNA, complete cds Length = 770 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 423 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 364 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 363 ctggcggcgttgccggcgtt 344
>gb|DQ147213.1| Zea diploperennis isolate d7B phospholipid transfer protein 1 (plt1) gene, partial cds Length = 698 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 333 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 274 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 273 ctggcggcgttgccggcgtt 254
>gb|DQ147210.1| Zea diploperennis isolate d4 phospholipid transfer protein 1 (plt1) gene, partial cds Length = 514 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 325 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 266 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 265 ctggcggcgttgccggcgtt 246
>gb|DQ147209.1| Zea diploperennis isolate d4a phospholipid transfer protein 1 (plt1) gene, partial cds Length = 514 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 325 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 266 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 265 ctggcggcgttgccggcgtt 246
>gb|DQ147205.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 804 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 434 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 375 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 374 ctggcggcgttgccggcgtt 355
>gb|DQ147193.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 831 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 451 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 392 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 391 ctggcggcgttgccggcgtt 372
>gb|DQ147192.1| Zea diploperennis isolate d8L phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147191.1| Zea diploperennis isolate d7 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147190.1| Zea diploperennis isolate d5b phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147189.1| Zea diploperennis isolate d5 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147188.1| Zea diploperennis isolate d6 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147187.1| Zea diploperennis isolate d4 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147186.1| Zea diploperennis isolate d3b phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147185.1| Zea diploperennis isolate d3a phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147184.1| Zea diploperennis isolate d2 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147183.1| Zea diploperennis isolate d1b phospholipid transfer protein 2 (plt2) gene, partial cds Length = 613 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 259 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 258 ctggcggcgttgccggcgtt 239
>gb|DQ147182.1| Zea diploperennis isolate d1a phospholipid transfer protein 2 (pl2) gene, partial cds Length = 613 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 259 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 258 ctggcggcgttgccggcgtt 239
>gb|DQ147181.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 826 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147180.1| Zea mays subsp. parviglumis isolate p14 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 822 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147179.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 829 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 414 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 355 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 354 ctggcggcgttgccggcgtt 335
>gb|DQ147178.1| Zea mays subsp. parviglumis isolate p12G phospholipid transfer protein 2 (plt2) gene, complete cds Length = 816 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147177.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147176.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 826 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147175.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 818 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147174.1| Zea mays subsp. parviglumis isolate p6U phospholipid transfer protein 2 (plt2) gene, complete cds Length = 822 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147173.1| Zea mays subsp. parviglumis isolate p6L phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147171.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 832 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147170.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 820 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147169.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>dbj|AK107447.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-128-C01, full insert sequence Length = 718 Score = 71.9 bits (36), Expect = 1e-09 Identities = 56/63 (88%) Strand = Plus / Plus Query: 246 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 305 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| ||||| || Sbjct: 97 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggc 156 Query: 306 gtt 308 ||| Sbjct: 157 gtt 159
>dbj|AK104981.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-125-E10, full insert sequence Length = 793 Score = 69.9 bits (35), Expect = 5e-09 Identities = 58/66 (87%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||||| |||||| ||||| |||| | ||||||||||| ||||||||||| Sbjct: 430 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 371 Query: 289 ccggcg 294 |||||| Sbjct: 370 ccggcg 365
>dbj|AK102455.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033094A19, full insert sequence Length = 3876 Score = 69.9 bits (35), Expect = 5e-09 Identities = 58/66 (87%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||||| |||||| ||||| |||| | ||||||||||| ||||||||||| Sbjct: 3516 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 3457 Query: 289 ccggcg 294 |||||| Sbjct: 3456 ccggcg 3451
>dbj|AK073466.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044B21, full insert sequence Length = 792 Score = 69.9 bits (35), Expect = 5e-09 Identities = 58/66 (87%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||||| |||||| ||||| |||| | ||||||||||| ||||||||||| Sbjct: 432 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 373 Query: 289 ccggcg 294 |||||| Sbjct: 372 ccggcg 367
>dbj|AK063683.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-119-E10, full insert sequence Length = 745 Score = 69.9 bits (35), Expect = 5e-09 Identities = 58/66 (87%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||||| |||||||||||| |||| | ||||| ||||| ||||||||||| Sbjct: 434 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 375 Query: 289 ccggcg 294 |||||| Sbjct: 374 ccggcg 369
>gb|BT018347.1| Zea mays clone EL01T0403E02.c mRNA sequence Length = 827 Score = 65.9 bits (33), Expect = 8e-08 Identities = 59/68 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 434 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 375 Query: 289 ccggcggc 296 | |||||| Sbjct: 374 ctggcggc 367
>emb|X68655.1|HVCW18 H.vulgare Cw-18 mRNA Length = 732 Score = 65.9 bits (33), Expect = 8e-08 Identities = 71/84 (84%) Strand = Plus / Minus Query: 214 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtangggacgctgacgccg 273 |||||| | ||||| ||||||||||| |||||||| | ||| ||||||||||| ||| Sbjct: 423 gatcagtggatcttggagcagtcgacactggcgctgatcgtgtaggggacgctgaccccg 364 Query: 274 cacatggaggggatgccggcggcc 297 ||| ||||||||||||| |||||| Sbjct: 363 cacctggaggggatgcctgcggcc 340
>gb|U31766.1|OSU31766 Oryza sativa lipid transfer protein precursor (LTP2) mRNA, complete cds Length = 840 Score = 65.9 bits (33), Expect = 8e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 |||||||||| ||| | |||||||| ||| |||| ||||||||||| ||||||||||| Sbjct: 414 gagcagtcgatggaggggctgatggtgtaggggatcgtgacgccgcacttggaggggatg 355 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 354 ctggcggcattgccggcgtt 335
>gb|DQ147207.1| Zea diploperennis isolate d2 phospholipid transfer protein 1 (plt1) gene, partial cds Length = 699 Score = 65.9 bits (33), Expect = 8e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||| ||| Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggagggtatg 259 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 258 ctggcggcgttgccggcgtt 239
>gb|DQ147204.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 780 Score = 65.9 bits (33), Expect = 8e-08 Identities = 59/68 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 416 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 357 Query: 289 ccggcggc 296 | |||||| Sbjct: 356 ctggcggc 349
>gb|DQ147203.1| Zea mays subsp. parviglumis isolate p12 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 714 Score = 65.9 bits (33), Expect = 8e-08 Identities = 59/68 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 341 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 282 Query: 289 ccggcggc 296 | |||||| Sbjct: 281 ctggcggc 274
>gb|DQ147202.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 648 Score = 65.9 bits (33), Expect = 8e-08 Identities = 59/68 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 440 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 381 Query: 289 ccggcggc 296 | |||||| Sbjct: 380 ctggcggc 373
>gb|DQ147201.1| Zea mays subsp. parviglumis isolate p11a phospholipid transfer protein 1 (plt1) gene, complete cds Length = 829 Score = 65.9 bits (33), Expect = 8e-08 Identities = 59/68 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 453 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 394 Query: 289 ccggcggc 296 | |||||| Sbjct: 393 ctggcggc 386
>gb|DQ147199.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 831 Score = 65.9 bits (33), Expect = 8e-08 Identities = 59/68 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 455 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 396 Query: 289 ccggcggc 296 | |||||| Sbjct: 395 ctggcggc 388
>gb|DQ147198.1| Zea mays subsp. parviglumis isolate p6 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 821 Score = 65.9 bits (33), Expect = 8e-08 Identities = 59/68 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391 Query: 289 ccggcggc 296 | |||||| Sbjct: 390 ctggcggc 383
>gb|DQ147197.1| Zea mays subsp. parviglumis isolate p5 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 832 Score = 65.9 bits (33), Expect = 8e-08 Identities = 59/68 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 453 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 394 Query: 289 ccggcggc 296 | |||||| Sbjct: 393 ctggcggc 386
>gb|DQ147196.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 835 Score = 65.9 bits (33), Expect = 8e-08 Identities = 59/68 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391 Query: 289 ccggcggc 296 | |||||| Sbjct: 390 ctggcggc 383
>gb|DQ147194.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 814 Score = 65.9 bits (33), Expect = 8e-08 Identities = 59/68 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391 Query: 289 ccggcggc 296 | |||||| Sbjct: 390 ctggcggc 383
>gb|DQ147172.1| Zea mays subsp. parviglumis isolate p5_U phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 65.9 bits (33), Expect = 8e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||| |||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggacgggatg 356 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147168.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 65.9 bits (33), Expect = 8e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||| |||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggacgggatg 356 Query: 289 ccggcggccttgccagcgtt 308 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|M57249.1|MZEPLTPA Maize phospholipid transfer protein mRNA, 3' end Length = 677 Score = 65.9 bits (33), Expect = 8e-08 Identities = 59/68 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 264 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 205 Query: 289 ccggcggc 296 | |||||| Sbjct: 204 ctggcggc 197
>gb|J04176.1|MZEPLTP Maize phospholipid transfer protein mRNA, complete cds. of clone 9C2 Length = 813 Score = 65.9 bits (33), Expect = 8e-08 Identities = 59/68 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||||||| Sbjct: 451 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 392 Query: 289 ccggcggc 296 | |||||| Sbjct: 391 ctggcggc 384
>gb|AF051369.1|AF051369 Oryza sativa lipid transfer protein mRNA, complete cds Length = 766 Score = 61.9 bits (31), Expect = 1e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||||| |||||| ||||| |||| | |||| |||||| ||||||||||| Sbjct: 384 gagcagtcggtggaagggctgatagcgtaggggatgttgaccccgcacttggaggggatg 325 Query: 289 ccggcg 294 |||||| Sbjct: 324 ccggcg 319
>gb|AY789644.1| Triticum aestivum lipid transfer protein 4 (LTP4) mRNA, complete cds Length = 345 Score = 60.0 bits (30), Expect = 5e-06 Identities = 84/103 (81%) Strand = Plus / Minus Query: 255 gtangggacgctgacgccgcacatggaggggatgccggcggccttgccagcgttaagccc 314 ||| ||||||||||||| |||| |||||||||| | |||||| |||| | || | ||| Sbjct: 309 gtaggggacgctgacgcggcacttggaggggatctctgcggccgtgccttctttgacccc 250 Query: 315 acccncancgctcttgatgcacttgcacgccgcttgcttgtca 357 ||| || | |||||||||||| ||||||||||| ||||||| Sbjct: 249 accggcagcactcttgatgcacaggcacgccgctttcttgtca 207
>gb|DQ147200.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer protein 1 (plt1) gene, partial cds Length = 709 Score = 58.0 bits (29), Expect = 2e-05 Identities = 58/68 (85%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| || |||| ||||||||||||| ||||||||||| Sbjct: 319 gagcagtcggtggaggtgctgatggtataggggatgctgacgccgcacttggaggggatg 260 Query: 289 ccggcggc 296 | |||||| Sbjct: 259 ctggcggc 252
>gb|DQ147195.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer protein 1 (plt1) gene, partial cds Length = 686 Score = 58.0 bits (29), Expect = 2e-05 Identities = 58/68 (85%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||| | |||||||| ||| |||| ||||||||| ||| ||||||||||| Sbjct: 320 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccacacttggaggggatg 261 Query: 289 ccggcggc 296 | |||||| Sbjct: 260 ctggcggc 253
>dbj|D10955.1|RIC323PTP Oryza sativa mRNA for phospholipid trasfer protein Length = 372 Score = 56.0 bits (28), Expect = 8e-05 Identities = 54/63 (85%) Strand = Plus / Minus Query: 229 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatg 288 ||||||||| ||||| ||||||| |||| |||| | ||||| ||||| ||||||||||| Sbjct: 141 gagcagtcggtggaagggctgatgccgtaggggatgttgacgtcgcacttggaggggatg 82 Query: 289 ccg 291 ||| Sbjct: 81 ccg 79
>emb|X68656.1|HVCW19 H.vulgare Cw-19 mRNA Length = 660 Score = 52.0 bits (26), Expect = 0.001 Identities = 32/34 (94%) Strand = Plus / Minus Query: 324 gctcttgatgcacttgcacgccgcttgcttgtca 357 |||||||| |||| |||||||||||||||||||| Sbjct: 285 gctcttgaggcacctgcacgccgcttgcttgtca 252
>gb|AY662492.1| Hordeum vulgare subsp. vulgare non-specific lipid transfer protein 6 (Ltp6) gene, promoter and complete cds Length = 3257 Score = 52.0 bits (26), Expect = 0.001 Identities = 43/49 (87%) Strand = Plus / Minus Query: 246 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcg 294 |||||||||||| |||| | ||||||||||| || ||||||||||||| Sbjct: 2770 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 2722
>gb|AC161418.4| Mus musculus BAC clone RP23-325K2 from chromosome 3, complete sequence Length = 202765 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 42 aaagtaaaaaacaaccatagt 62 ||||||||||||||||||||| Sbjct: 67013 aaagtaaaaaacaaccatagt 67033
>dbj|AP005640.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0006O15 Length = 139723 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 116 tcacatggagatcagatcaga 136 ||||||||||||||||||||| Sbjct: 81220 tcacatggagatcagatcaga 81240
>dbj|AK100917.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023133E20, full insert sequence Length = 5035 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 116 tcacatggagatcagatcaga 136 ||||||||||||||||||||| Sbjct: 4798 tcacatggagatcagatcaga 4818
>gb|AC132475.4| Mus musculus BAC clone RP23-114P16 from 3, complete sequence Length = 215899 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 42 aaagtaaaaaacaaccatagt 62 ||||||||||||||||||||| Sbjct: 210967 aaagtaaaaaacaaccatagt 210987
>gb|AC121237.19| Medicago truncatula clone mth2-22g11, complete sequence Length = 127731 Score = 40.1 bits (20), Expect = 4.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 29 tcaaaagggagagaaagtaaaaaa 52 |||||||||||||| ||||||||| Sbjct: 124911 tcaaaagggagagagagtaaaaaa 124934
>emb|AL358372.11| Human DNA sequence from clone RP11-350E19 on chromosome 1 Contains a rodent farnesoid X receptor beta (Fxrb) pseudogene and the 5' end of the SYCP1 gene for synaptonemal complex protein 1, complete sequence Length = 155819 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 31 aaaagggagagaaagtaaaa 50 |||||||||||||||||||| Sbjct: 106216 aaaagggagagaaagtaaaa 106235
>emb|AL121777.39|HSJ1057D4 Human DNA sequence from clone RP5-1057D4 on chromosome 20 Contains the SRMP1 gene for spermidine synthase pseudogene 1, the 5' end of the gene for a novel protein similar to glucosamine-6-sulfatases (SULF2) (sulfatase 2, H-SULF2, KIAA1247) and a CpG island, complete sequence Length = 131888 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 102 gactcctttctccctcacat 121 |||||||||||||||||||| Sbjct: 88928 gactcctttctccctcacat 88909
>gb|AC069528.10| Homo sapiens 3 BAC RP11-329N15 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 163163 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 aagggagagaaagtaaaaaa 52 |||||||||||||||||||| Sbjct: 126180 aagggagagaaagtaaaaaa 126161
>emb|AJ277892.2|HSA277892 Homo sapiens partial TTN gene for titin Length = 294540 Score = 40.1 bits (20), Expect = 4.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 25 ctcctcaaaagggagagaaagtaa 48 |||||||||||||| ||||||||| Sbjct: 219918 ctcctcaaaagggacagaaagtaa 219941
>gb|BC070113.1| Homo sapiens cDNA clone IMAGE:5268363 Length = 4610 Score = 40.1 bits (20), Expect = 4.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 25 ctcctcaaaagggagagaaagtaa 48 |||||||||||||| ||||||||| Sbjct: 3813 ctcctcaaaagggacagaaagtaa 3790
>gb|BC041357.1| Homo sapiens cDNA clone IMAGE:5272988 Length = 4615 Score = 40.1 bits (20), Expect = 4.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 25 ctcctcaaaagggagagaaagtaa 48 |||||||||||||| ||||||||| Sbjct: 3818 ctcctcaaaagggacagaaagtaa 3795
>gb|AC010680.10| Homo sapiens BAC clone RP11-171I2 from 2, complete sequence Length = 177476 Score = 40.1 bits (20), Expect = 4.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 25 ctcctcaaaagggagagaaagtaa 48 |||||||||||||| ||||||||| Sbjct: 34521 ctcctcaaaagggacagaaagtaa 34498
>gb|AE004829.1| Pseudomonas aeruginosa PAO1, section 390 of 529 of the complete genome Length = 10201 Score = 40.1 bits (20), Expect = 4.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 279 ggaggggatgccggcggccttgcc 302 |||| ||||||||||||||||||| Sbjct: 4301 ggagaggatgccggcggccttgcc 4278
>emb|X60292.1|HVLTP1G Hordeum vulgare gene for LTP 1 Length = 2874 Score = 40.1 bits (20), Expect = 4.7 Identities = 43/51 (84%) Strand = Plus / Minus Query: 246 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggc 296 |||||||| ||| |||||| |||| |||| |||||||||||| |||||| Sbjct: 2071 gctgatggtgtatgggacgttgacattgcacttggaggggatgctggcggc 2021
>emb|X59253.1|HVLTP1 H.vulgare rearranged Ltp1 gene for lipid transfer protein Length = 1487 Score = 40.1 bits (20), Expect = 4.7 Identities = 43/51 (84%) Strand = Plus / Minus Query: 246 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggc 296 |||||||| ||| |||||| |||| |||| |||||||||||| |||||| Sbjct: 1111 gctgatggtgtatgggacgttgacattgcacttggaggggatgctggcggc 1061
>dbj|AK073363.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033030A16, full insert sequence Length = 760 Score = 40.1 bits (20), Expect = 4.7 Identities = 32/36 (88%) Strand = Plus / Minus Query: 261 gacgctgacgccgcacatggaggggatgccggcggc 296 |||| ||||||||||| || ||||||||||||||| Sbjct: 400 gacgttgacgccgcacttgccggggatgccggcggc 365
>dbj|AK070192.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023041I08, full insert sequence Length = 2914 Score = 40.1 bits (20), Expect = 4.7 Identities = 32/36 (88%) Strand = Plus / Minus Query: 261 gacgctgacgccgcacatggaggggatgccggcggc 296 |||| ||||||||||| || ||||||||||||||| Sbjct: 2487 gacgttgacgccgcacttgccggggatgccggcggc 2452
>dbj|AK062690.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-A02, full insert sequence Length = 646 Score = 40.1 bits (20), Expect = 4.7 Identities = 32/36 (88%) Strand = Plus / Minus Query: 261 gacgctgacgccgcacatggaggggatgccggcggc 296 |||| ||||||||||| || ||||||||||||||| Sbjct: 394 gacgttgacgccgcacttgccggggatgccggcggc 359
>dbj|AK061182.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-209-D09, full insert sequence Length = 928 Score = 40.1 bits (20), Expect = 4.7 Identities = 32/36 (88%) Strand = Plus / Minus Query: 261 gacgctgacgccgcacatggaggggatgccggcggc 296 |||| ||||||||||| || ||||||||||||||| Sbjct: 399 gacgttgacgccgcacttgccggggatgccggcggc 364
>dbj|AK059737.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-202-D08, full insert sequence Length = 853 Score = 40.1 bits (20), Expect = 4.7 Identities = 32/36 (88%) Strand = Plus / Minus Query: 261 gacgctgacgccgcacatggaggggatgccggcggc 296 |||| ||||||||||| || ||||||||||||||| Sbjct: 394 gacgttgacgccgcacttgccggggatgccggcggc 359
>dbj|AK059714.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-032-F09, full insert sequence Length = 773 Score = 40.1 bits (20), Expect = 4.7 Identities = 32/36 (88%) Strand = Plus / Minus Query: 261 gacgctgacgccgcacatggaggggatgccggcggc 296 |||| ||||||||||| || ||||||||||||||| Sbjct: 399 gacgttgacgccgcacttgccggggatgccggcggc 364
>emb|X05168.1|TAMYR1 Hordeum vulgare mRNA for putative amylase or protease inhibitor Length = 650 Score = 40.1 bits (20), Expect = 4.7 Identities = 43/51 (84%) Strand = Plus / Minus Query: 246 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggc 296 |||||||| ||| |||||| |||| |||| |||||||||||| |||||| Sbjct: 390 gctgatggtgtatgggacgttgacattgcacttggaggggatgctggcggc 340
>gb|AY057932.1| Bromus inermis nonspecific lipid transfer protein (BG14) mRNA, complete cds Length = 841 Score = 40.1 bits (20), Expect = 4.7 Identities = 40/47 (85%) Strand = Plus / Minus Query: 248 tgatggcgtangggacgctgacgccgcacatggaggggatgccggcg 294 |||||||||| |||| ||||||||||| || ||||||||||||| Sbjct: 401 tgatggcgtaggggatattgacgccgcacttgctggggatgccggcg 355
>emb|AL138783.6| Human DNA sequence from clone RP5-1165D20 on chromosome 1p13.1-13.3, complete sequence Length = 118065 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 31 aaaagggagagaaagtaaaa 50 |||||||||||||||||||| Sbjct: 88582 aaaagggagagaaagtaaaa 88601
>gb|M15207.1|BLYPAPI Barley (H.vulgare) probable amylase/protease inhibitor (PAPI) gene, complete cds Length = 650 Score = 40.1 bits (20), Expect = 4.7 Identities = 43/51 (84%) Strand = Plus / Minus Query: 246 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggc 296 |||||||| ||| |||||| |||| |||| |||||||||||| |||||| Sbjct: 390 gctgatggtgtatgggacgttgacattgcacttggaggggatgctggcggc 340 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,615,022 Number of Sequences: 3902068 Number of extensions: 2615022 Number of successful extensions: 58976 Number of sequences better than 10.0: 135 Number of HSP's better than 10.0 without gapping: 138 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 58645 Number of HSP's gapped (non-prelim): 326 length of query: 357 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 335 effective length of database: 17,147,199,772 effective search space: 5744311923620 effective search space used: 5744311923620 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
