ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal23d14
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_635269.1| Dictyostelium discoideum hypothetical protein (... 40 2.2
2gb|AC129778.5| Homo sapiens BAC clone RP11-1221G12 from UL, comp... 40 2.2
3gb|AC122450.4| Mus musculus BAC clone RP24-249K4 from chromosome... 40 2.2
4emb|AL845321.4| Human DNA sequence from clone RP11-236F9 on chro... 40 2.2
5emb|AL591379.18| Human DNA sequence from clone RP11-381O7 on chr... 40 2.2
6emb|AL591471.8| Human DNA sequence from clone RP11-341A11 on chr... 40 2.2
7emb|AL445665.20| Human DNA sequence from clone RP11-574E24 on ch... 40 2.2
8emb|AL136317.5| Human DNA sequence from clone RP11-15E1 on chrom... 40 2.2
9emb|AL137070.9| Human DNA sequence from clone RP11-251O17 on chr... 40 2.2
10dbj|AK127320.1| Homo sapiens cDNA FLJ45391 fis, clone BRHIP3026231 40 2.2
11ref|XM_575065.1| PREDICTED: Rattus norvegicus similar to RIKEN c... 40 2.2
12emb|AL845331.2| Human DNA sequence from clone RP11-407P15 on chr... 40 2.2
13gb|AC139320.4| Mus musculus BAC clone RP24-410G8 from 9, complet... 40 2.2
14gb|AC165971.3| Mus musculus BAC clone RP23-94L17 from chromosome... 38 8.7
15emb|CT010577.7| Mouse DNA sequence from clone RP23-318D14 on chr... 38 8.7
16ref|XM_380956.1| Gibberella zeae PH-1 chromosome 1 hypothetical ... 38 8.7
17gb|AC125234.4| Mus musculus BAC clone RP23-14K16 from 13, comple... 38 8.7
18gb|AC159816.2| Mus musculus BAC clone RP23-321A19 from chromosom... 38 8.7
19emb|AL590397.7| Human DNA sequence from clone RP11-376O21 on chr... 38 8.7
20emb|AL445218.12| Human DNA sequence from clone RP11-14O19 on chr... 38 8.7
21emb|AL445926.5| Human DNA sequence from clone RP11-439I6 on chro... 38 8.7
22gb|AC114786.4| Homo sapiens BAC clone RP11-618I10 from 4, comple... 38 8.7
23gb|AC156568.3| Mus musculus BAC clone RP23-291D3 from chromosome... 38 8.7
24gb|AC106901.4| Homo sapiens BAC clone RP11-1178E6 from 2, comple... 38 8.7
25gb|AC013472.8| Homo sapiens BAC clone RP11-503P10 from 2, comple... 38 8.7
26gb|AC091260.10| Mus musculus chromosome 9, clone RP23-208K9, com... 38 8.7
27gb|AC137692.4| Mus musculus BAC clone RP24-323P9 from 13, comple... 38 8.7
28emb|AL844574.8| Mouse DNA sequence from clone RP23-155G13 on chr... 38 8.7
29emb|AL672247.8| Mouse DNA sequence from clone RP23-95I19 on chro... 38 8.7
30gb|AC157476.2| Mus musculus BAC clone RP24-174O15 from chromosom... 38 8.7

>ref|XM_635269.1| Dictyostelium discoideum hypothetical protein (DDB0205141), partial
            mRNA
          Length = 4923

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 146  aaatatgaagaggatatgca 165
            ||||||||||||||||||||
Sbjct: 3334 aaatatgaagaggatatgca 3353



to top

>gb|AC129778.5| Homo sapiens BAC clone RP11-1221G12 from UL, complete sequence
          Length = 236177

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 58   agggagcaaggaaaagcagg 77
            ||||||||||||||||||||
Sbjct: 7698 agggagcaaggaaaagcagg 7717



to top

>gb|AC122450.4| Mus musculus BAC clone RP24-249K4 from chromosome 1, complete sequence
          Length = 154695

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 140   tgcacaaaatatgaagagga 159
             ||||||||||||||||||||
Sbjct: 79502 tgcacaaaatatgaagagga 79483



to top

>emb|AL845321.4| Human DNA sequence from clone RP11-236F9 on chromosome 9 Contains an
             aquaporin 7(AQP7) pseudogene, a novel gene, three novel
             pseudogenes, a pseudogene similar to part of BMS1-like,
             ribosome assembly protein (yeast)(BMS1L) and a CpG island,
             complete sequence
          Length = 158462

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    agggagcaaggaaaagcagg 77
             ||||||||||||||||||||
Sbjct: 47136 agggagcaaggaaaagcagg 47155



to top

>emb|AL591379.18| Human DNA sequence from clone RP11-381O7 on chromosome 9 Contains an
              aquaporin 7 (AQP7) pseudogene, a novel gene, three novel
              pseudogenes, a pseudogene similar to part of BMS1-like,
              ribosome assembly protein (yeast) (BMS1L), a pseudogene
              similar to part of tripartite motif-containing family
              protein and a CpG island, complete sequence
          Length = 194491

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     agggagcaaggaaaagcagg 77
              ||||||||||||||||||||
Sbjct: 152133 agggagcaaggaaaagcagg 152114



to top

>emb|AL591471.8| Human DNA sequence from clone RP11-341A11 on chromosome 9 Contains a
            calponin 2 pseudogene (CNN2) and a novel pseudogene,
            complete sequence
          Length = 131871

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 58   agggagcaaggaaaagcagg 77
            ||||||||||||||||||||
Sbjct: 4478 agggagcaaggaaaagcagg 4459



to top

>emb|AL445665.20| Human DNA sequence from clone RP11-574E24 on chromosome 9 Contains an
              aquaporin 7 (AQP7) pseudogene and a CpG island, complete
              sequence
          Length = 179371

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     agggagcaaggaaaagcagg 77
              ||||||||||||||||||||
Sbjct: 129228 agggagcaaggaaaagcagg 129209



to top

>emb|AL136317.5| Human DNA sequence from clone RP11-15E1 on chromosome 9 Contains a
              calponin 2 (CNN2) pseudogene, a novel pseudogene, a novel
              gene similar to aquaporin 7 (AQP7) and a CpG island,
              complete sequence
          Length = 166426

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     agggagcaaggaaaagcagg 77
              ||||||||||||||||||||
Sbjct: 127393 agggagcaaggaaaagcagg 127412



to top

>emb|AL137070.9| Human DNA sequence from clone RP11-251O17 on chromosome 9 Contains 2
              calponin 2 (CNN2) pseudogenes, a gene for a novel protein
              similar to aquaporin 7 (AQP7), part of gene for a novel
              protein similar to methylenetetrahydrofolate
              dehydrogenase(NADP+ dependent), methenyltetrahydrofolate
              cyclohydrolase, formyltetrahydrofolate synthetase (MTHFD1)
              and a CpG island, complete sequence
          Length = 170237

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     agggagcaaggaaaagcagg 77
              ||||||||||||||||||||
Sbjct: 133494 agggagcaaggaaaagcagg 133513



to top

>dbj|AK127320.1| Homo sapiens cDNA FLJ45391 fis, clone BRHIP3026231
          Length = 3413

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 58   agggagcaaggaaaagcagg 77
            ||||||||||||||||||||
Sbjct: 2713 agggagcaaggaaaagcagg 2694



to top

>ref|XM_575065.1| PREDICTED: Rattus norvegicus similar to RIKEN cDNA 5230400J09
           (LOC499731), mRNA
          Length = 1069

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 57  gagggagcaaggaaaagcaggtgaccca 84
           |||| |||||||||||||| ||||||||
Sbjct: 768 gaggaagcaaggaaaagcatgtgaccca 795



to top

>emb|AL845331.2| Human DNA sequence from clone RP11-407P15 on chromosome 9, complete
             sequence
          Length = 185111

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    agggagcaaggaaaagcagg 77
             ||||||||||||||||||||
Sbjct: 56703 agggagcaaggaaaagcagg 56684



to top

>gb|AC139320.4| Mus musculus BAC clone RP24-410G8 from 9, complete sequence
          Length = 176888

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 51     aaacatgagggagcaaggaa 70
              ||||||||||||||||||||
Sbjct: 134509 aaacatgagggagcaaggaa 134490



to top

>gb|AC165971.3| Mus musculus BAC clone RP23-94L17 from chromosome 14, complete sequence
          Length = 211607

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 45     tgccacaaacatgagggag 63
              |||||||||||||||||||
Sbjct: 188631 tgccacaaacatgagggag 188649



to top

>emb|CT010577.7| Mouse DNA sequence from clone RP23-318D14 on chromosome 14, complete
              sequence
          Length = 195351

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 45     tgccacaaacatgagggag 63
              |||||||||||||||||||
Sbjct: 189205 tgccacaaacatgagggag 189223



to top

>ref|XM_380956.1| Gibberella zeae PH-1 chromosome 1 hypothetical protein (FG00780.1)
           partial mRNA
          Length = 1950

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 54  catgagggagcaaggaaaa 72
           |||||||||||||||||||
Sbjct: 294 catgagggagcaaggaaaa 312



to top

>gb|AC125234.4| Mus musculus BAC clone RP23-14K16 from 13, complete sequence
          Length = 209715

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 16     atctacaactcctgcccta 34
              |||||||||||||||||||
Sbjct: 147273 atctacaactcctgcccta 147291



to top

>gb|AC159816.2| Mus musculus BAC clone RP23-321A19 from chromosome 9, complete sequence
          Length = 191274

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 51     aaacatgagggagcaagga 69
              |||||||||||||||||||
Sbjct: 180595 aaacatgagggagcaagga 180613



to top

>emb|AL590397.7| Human DNA sequence from clone RP11-376O21 on chromosome 9 Contains
            the 3' end of the PTPRD gene for protein tyrosine
            phosphatase, receptor type, D (HPTP, PTPD, HPTPD),
            complete sequence
          Length = 168323

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 32   ctatgcaaatgcctgccacaaac 54
            ||||||||||| |||||||||||
Sbjct: 8230 ctatgcaaatggctgccacaaac 8252



to top

>emb|AL445218.12| Human DNA sequence from clone RP11-14O19 on chromosome 1 Contains two
             novel genes, complete sequence
          Length = 44203

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 35    tgcaaatgcctgccacaaa 53
             |||||||||||||||||||
Sbjct: 24391 tgcaaatgcctgccacaaa 24409



to top

>emb|AL445926.5| Human DNA sequence from clone RP11-439I6 on chromosome 9 Contains the
             3' end of the PTPRD gene for protein tyrosine phosphatase,
             receptor type, D (HPTP, PTPD, HPTPD), complete sequence
          Length = 167253

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 32    ctatgcaaatgcctgccacaaac 54
             ||||||||||| |||||||||||
Sbjct: 65256 ctatgcaaatggctgccacaaac 65278



to top

>gb|AC114786.4| Homo sapiens BAC clone RP11-618I10 from 4, complete sequence
          Length = 148977

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 24    ctcctgccctatgcaaatg 42
             |||||||||||||||||||
Sbjct: 78674 ctcctgccctatgcaaatg 78656



to top

>gb|AC156568.3| Mus musculus BAC clone RP23-291D3 from chromosome 12, complete sequence
          Length = 224350

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 142   cacaaaatatgaagaggat 160
             |||||||||||||||||||
Sbjct: 59660 cacaaaatatgaagaggat 59642



to top

>gb|AC106901.4| Homo sapiens BAC clone RP11-1178E6 from 2, complete sequence
          Length = 91323

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 57    gagggagcaaggaaaagca 75
             |||||||||||||||||||
Sbjct: 54047 gagggagcaaggaaaagca 54029



to top

>gb|AC013472.8| Homo sapiens BAC clone RP11-503P10 from 2, complete sequence
          Length = 149481

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 24    ctcctgccctatgcaaatgcctg 46
             ||||||||||| |||||||||||
Sbjct: 96790 ctcctgccctaagcaaatgcctg 96812



to top

>gb|AC091260.10| Mus musculus chromosome 9, clone RP23-208K9, complete sequence
          Length = 188754

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 55     atgagggagcaaggaaaagcagg 77
              |||||||||||||||| ||||||
Sbjct: 100155 atgagggagcaaggaacagcagg 100177



to top

>gb|AC137692.4| Mus musculus BAC clone RP24-323P9 from 13, complete sequence
          Length = 180677

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 16     atctacaactcctgcccta 34
              |||||||||||||||||||
Sbjct: 139426 atctacaactcctgcccta 139408



to top

>emb|AL844574.8| Mouse DNA sequence from clone RP23-155G13 on chromosome 2, complete
            sequence
          Length = 72165

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 58   agggagcaaggaaaagcag 76
            |||||||||||||||||||
Sbjct: 4302 agggagcaaggaaaagcag 4320



to top

>emb|AL672247.8| Mouse DNA sequence from clone RP23-95I19 on chromosome X, complete
              sequence
          Length = 224241

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 136    tatgtgcacaaaatatgaa 154
              |||||||||||||||||||
Sbjct: 147358 tatgtgcacaaaatatgaa 147340



to top

>gb|AC157476.2| Mus musculus BAC clone RP24-174O15 from chromosome 9, complete sequence
          Length = 161849

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 51     aaacatgagggagcaagga 69
              |||||||||||||||||||
Sbjct: 120894 aaacatgagggagcaagga 120876


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,273,817
Number of Sequences: 3902068
Number of extensions: 1273817
Number of successful extensions: 88872
Number of sequences better than 10.0: 30
Number of HSP's better than 10.0 without gapping: 30
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 88813
Number of HSP's gapped (non-prelim): 59
length of query: 177
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 155
effective length of database: 17,147,199,772
effective search space: 2657815964660
effective search space used: 2657815964660
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top