Clone Name	rbaal7f21
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|AY123422.1| Triticum aestivum putative Rieske Fe-S precursor ...	1118	0.0
2	dbj|AK071634.1| Oryza sativa (japonica cultivar-group) cDNA clon...	535	e-149
3	gb|AF093631.1|AF093631 Oryza sativa Rieske Fe-S precursor protei...	535	e-149
4	emb|AJ222783.1|HVJ222783 Hordeum vulgare mRNA for cytochrome b6/...	529	e-147
5	gb|BT016255.1| Zea mays clone Contig88 mRNA sequence	511	e-142
6	gb|AY104934.1| Zea mays PCO071754 mRNA sequence	511	e-142
7	gb|AY581830.1| Cynodon dactylon putative Rieske Fe-S precursor p...	293	4e-76
8	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	194	3e-46
9	dbj|AP005125.3| Oryza sativa (japonica cultivar-group) genomic D...	194	3e-46
10	gb|DQ427777.1| Sorghum propinquum locus HHU30 genomic sequence	113	8e-22
11	gb|DQ427776.1| Sorghum bicolor voucher PI585454 locus HHU30 geno...	113	8e-22
12	gb|DQ427775.1| Sorghum bicolor voucher PI267539 locus HHU30 geno...	113	8e-22
13	gb|DQ427774.1| Sorghum bicolor voucher PI267408 locus HHU30 geno...	113	8e-22
14	gb|DQ427773.1| Sorghum bicolor voucher PI221607 locus HHU30 geno...	113	8e-22
15	gb|DQ427772.1| Sorghum bicolor voucher PI152702 locus HHU30 geno...	113	8e-22
16	gb|DQ427771.1| Sorghum bicolor voucher NSL92371 locus HHU30 geno...	113	8e-22
17	gb|DQ427770.1| Sorghum bicolor voucher NSL87902 locus HHU30 geno...	113	8e-22
18	gb|DQ427769.1| Sorghum bicolor voucher NSL87666 locus HHU30 geno...	113	8e-22
19	gb|DQ427768.1| Sorghum bicolor voucher NSL77217 locus HHU30 geno...	113	8e-22
20	gb|DQ427767.1| Sorghum bicolor voucher NSL77034 locus HHU30 geno...	113	8e-22
21	gb|DQ427766.1| Sorghum bicolor voucher NSL56174 locus HHU30 geno...	113	8e-22
22	gb|DQ427765.1| Sorghum bicolor voucher NSL56003 locus HHU30 geno...	113	8e-22
23	gb|DQ427764.1| Sorghum bicolor voucher NSL55243 locus HHU30 geno...	113	8e-22
24	gb|DQ427763.1| Sorghum bicolor voucher NSL51365 locus HHU30 geno...	113	8e-22
25	gb|DQ427762.1| Sorghum bicolor voucher NSL51030 locus HHU30 geno...	113	8e-22
26	gb|DQ427761.1| Sorghum bicolor voucher NSL50875 locus HHU30 geno...	113	8e-22
27	gb|DQ427760.1| Sorghum bicolor voucher BTx623 locus HHU30 genomi...	113	8e-22
28	gb|DQ122916.1| Chlamydomonas incerta chloroplast cytochrome B6/F...	90	1e-14
29	dbj|D32003.1| Chlamydomonas reinhardtii mRNA for chloroplast Rie...	90	1e-14
30	gb|DQ384526.1| Panax ginseng clone PG6L-3 photosynthetic electro...	88	4e-14
31	gb|AY826845.1| Pavlova lutheri clone PLCB61 chloroplast cytochro...	82	3e-12
32	gb|AY300039.1| Solanum tuberosum putative Rieske Fe-S protein pr...	80	1e-11
33	emb|AL731601.3|OSJN00245 Oryza sativa genomic DNA, chromosome 4,...	80	1e-11
34	gb|AC122543.1| Genomic sequence for Brassica oleracea, clone B21...	80	1e-11
35	dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D...	80	1e-11
36	gb|AF037456.1|AF037456 Fritillaria agrestis cytochrome B6-F comp...	78	4e-11
37	ref|NM_116566.3| Arabidopsis thaliana PETC (PHOTOSYNTHETIC ELECT...	76	2e-10
38	ref|NM_178964.1| Arabidopsis thaliana PETC (PHOTOSYNTHETIC ELECT...	76	2e-10
39	gb|AC005275.1| Arabidopsis thaliana BAC F4C21 from chromosome IV...	76	2e-10
40	emb|AL161496.2|ATCHRIV8 Arabidopsis thaliana DNA chromosome 4, c...	76	2e-10
41	emb|AJ292972.1|ATH292972 Arabidopsis thaliana petC gene for Ries...	76	2e-10
42	emb|AJ243702.1|ATH243702 Arabidopsis thaliana mRNA for rieske ir...	76	2e-10
43	gb|AY093726.1| Arabidopsis thaliana AT4g03280/F4C21_21 mRNA, com...	76	2e-10
44	gb|AF410296.1|AF410296 Arabidopsis thaliana AT4g03280/F4C21_21 m...	76	2e-10
45	gb|AF370566.1|AF370566 Arabidopsis thaliana putative component o...	76	2e-10
46	emb|BX827560.1|CNS0A2RQ Arabidopsis thaliana Full-length cDNA Co...	76	2e-10
47	ref|NM_193963.1| Oryza sativa (japonica cultivar-group), predic...	74	7e-10
48	emb|AJ784852.1| Cyanophora paradoxa mRNA for Rieske iron-sulphur...	74	7e-10
49	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	74	7e-10
50	dbj|AP002870.1| Oryza sativa (japonica cultivar-group) genomic D...	74	7e-10
51	dbj|AB025003.1| Cicer arietinum mRNA for plastoquinol-plastocyan...	74	7e-10
52	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	72	3e-09
53	dbj|AP004875.3| Oryza sativa (japonica cultivar-group) genomic D...	72	3e-09
54	dbj|AP006844.2| Oryza sativa (japonica cultivar-group) genomic D...	72	3e-09
55	dbj|AU066527.1| Chlamydomonas sp. HS-5 mRNA for hypothetical pro...	64	6e-07
56	gb|AC134927.2| Oryza sativa (japonica cultivar-group) chromosome...	62	3e-06
57	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	62	3e-06
58	emb|BX826362.1|CNS0A4FZ Arabidopsis thaliana Full-length cDNA Co...	60	1e-05
59	emb|X63605.1|PSPETC P.sativum petC mRNA for chloroplast Rieske F...	58	4e-05
60	gb|AY826843.1| Heterocapsa triquetra clone HTCB61 chloroplast cy...	54	6e-04
61	emb|AJ784853.1| Cyanophora paradoxa mRNA for Rieske iron-sulphur...	52	0.002
62	emb|BX826457.1|CNS0A4G1 Arabidopsis thaliana Full-length cDNA Co...	52	0.002
63	emb|BX826302.1|CNS0A381 Arabidopsis thaliana Full-length cDNA Co...	52	0.002
64	emb|X06244.1|SORFES Spinach mRNA for Rieske FeS-precursor protein	52	0.002
65	gb|AF110783.1|AF110783 Volvox carteri f. nagariensis clone G9 ri...	50	0.010
66	gb|AY267656.1| Bigelowiella natans Fe-S subunit of cytochrome c6...	48	0.038
67	emb|X76299.1|CRPETC C.reinhardtii petC gene	48	0.038
68	emb|X66009.1|NTRFES1 N.tabacum mRNA for chloroplast Rieske FeS p...	46	0.15
69	emb|X64353.1|NTRFSCBFC N.tabacum mRNA for Rieske Fe/S protein of...	46	0.15
70	emb|BX572099.1| Prochlorococcus marinus MIT9313 complete genome;...	46	0.15
71	emb|BX569694.1| Synechococcus sp. WH8102 complete genome; segmen...	46	0.15
72	dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete g...	44	0.59
73	gb|AY826844.1| Isochrysis galbana clone ISCB61 chloroplast cytoc...	44	0.59
74	gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome	44	0.59
75	gb|AC093100.2| Drosophila melanogaster clone BACR05J04, complete...	42	2.3
76	gb|AC090377.15| Homo sapiens chromosome 18, clone RP11-866E20, c...	42	2.3
77	gb|AC107990.5| Homo sapiens chromosome 18, clone RP11-103A19, co...	42	2.3
78	ref|NM_135169.2| Drosophila melanogaster Pez CG9493-RA (Pez), mRNA	42	2.3
79	dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D...	42	2.3
80	gb|AF217284.1|AF217284 Drosophila melanogaster protein tyrosine ...	42	2.3
81	gb|AE003613.4| Drosophila melanogaster chromosome 2L, section 22...	42	2.3
82	gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome...	42	2.3
83	emb|AL928781.4|CNS08CCB Oryza sativa chromosome 12, . BAC OSJNBa...	42	2.3
84	gb|AC005285.1|AC005285 Drosophila melanogaster DNA sequence (P1s...	42	2.3
85	ref|NM_018094.2| Homo sapiens G1 to S phase transition 2 (GSPT2)...	40	9.2
86	gb|AC120788.7| Mus musculus chromosome 14, clone RP23-279B13, co...	40	9.2
87	gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome	40	9.2
88	gb|AC148476.4| Homo sapiens 12 BAC RP13-714J12 (Roswell Park Can...	40	9.2
89	ref|XM_754954.1| Ustilago maydis 521 hypothetical protein (UM039...	40	9.2
90	gb|AC124358.4| Mus musculus BAC clone RP24-491B24 from chromosom...	40	9.2
91	gb|AC125332.3| Mus musculus BAC clone RP23-113I20 from 3, comple...	40	9.2
92	gb|AC121928.2| Mus musculus BAC clone RP24-204F1 from 3, complet...	40	9.2
93	emb|AL929101.4| Human DNA sequence from clone RP11-22B10 on chro...	40	9.2
94	emb|AL662824.9| Human DNA sequence from clone XXbac-22I16 on chr...	40	9.2
95	emb|AL645931.7| Human DNA sequence from clone XXbac-138A21 on ch...	40	9.2
96	ref|XM_783177.1| PREDICTED: Strongylocentrotus purpuratus simila...	40	9.2
97	gb|AC090496.28| Mus musculus strain C57BL/6J clone rp23-469n6 ma...	40	9.2
98	gb|CP000088.1| Thermobifida fusca YX, complete genome	40	9.2
99	gb|BC036077.1| Homo sapiens G1 to S phase transition 2, mRNA (cD...	40	9.2
100	emb|AJ251548.1|HSA251548 Homo sapiens mRNA for polypeptide chain...	40	9.2
101	emb|CR759795.4| Human DNA sequence from clone DAMC-206D4 on chro...	40	9.2
102	emb|AL133055.1|HSM801326 Homo sapiens mRNA; cDNA DKFZp434J1015 (...	40	9.2
103	emb|CR861342.1| Pongo pygmaeus mRNA; cDNA DKFZp459J1511 (from cl...	40	9.2
104	gb|AC087892.16| Homo sapiens 12q BAC RP11-3L23 (Roswell Park Can...	40	9.2
105	gb|AE005819.1| Caulobacter crescentus CB15 section 145 of 359 of...	40	9.2
106	gb|AC098615.2| Homo sapiens chromosome 3 clone RP11-268I20, comp...	40	9.2
107	dbj|AK023155.1| Homo sapiens cDNA FLJ13093 fis, clone NT2RP30021...	40	9.2
108	dbj|AK001303.1| Homo sapiens cDNA FLJ10441 fis, clone NT2RP10007...	40	9.2
109	gb|CP000133.1| Rhizobium etli CFN 42, complete genome	40	9.2
110	ref|XM_498167.2| PREDICTED: Homo sapiens hypothetical protein DK...	40	9.2
111	gb|AC073343.6| Homo sapiens BAC clone RP11-611L7 from 7, complet...	40	9.2
112	gb|AC157941.4| Mus musculus BAC clone RP24-253I2 from chromosome...	40	9.2
113	gb|AF336983.1|AF336983 Vaucheria litorea cytochrome b6f complex ...	40	9.2
114	emb|AL606597.4|OSJN00042 Oryza sativa genomic DNA, chromosome 4,...	40	9.2
115	gb|AC012451.8| Homo sapiens BAC clone RP11-414K19 from 2, comple...	40	9.2
116	gb|AC055858.18| Homo sapiens chromosome 17, clone RP11-682M7, co...	40	9.2
117	gb|AF203698.1|AF203698 Rattus norvegicus T calcium channel alpha...	40	9.2

---

>gb|AY123422.1| Triticum aestivum putative Rieske Fe-S precursor protein mRNA,
           complete cds
          Length = 866

 Score = 1118 bits (564), Expect = 0.0
 Identities = 640/663 (96%), Gaps = 3/663 (0%)
 Strand = Plus / Minus

                                                                       
Query: 16  tagactgtatacatataactggatacaagaaacaggtgcatttatagcaggagtactctt 75
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 857 tagactgtatacatataactggatacaagaaacaggtgcatttatagcaggagtagtctt 798

                                                                       
Query: 76  at--agcagcgttcttaggactggcaggaggcttaacatatcacacgagtgagctttgct 133
           ||  ||||||||||||||||||||||||||||||||||||||||| |||||||| |||||
Sbjct: 797 atgtagcagcgttcttaggactggcaggaggcttaacatatcacaggagtgagcattgct 738

                                                                       
Query: 134 gccggagcttgtgtcgcttatttccaccacgggttctcgccggtcctgaagtcggtctcc 193
           ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 737 gccggagcttgcgtcgcttatttccaccacgggttgtcgccggtcctgaagtcggtctcc 678

                                                                       
Query: 194 acccatggcacgaagacgaccttgctgtcgtcgacgtcggcgtgaacgagggccagcgac 253
           ||||| ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||
Sbjct: 677 acccacggcacgaagacgaccttgccgtcgtcgacgtcggcgtgaaccagggccagcgac 618

                                                                       
Query: 254 agaggtgcaggtccacggacaaccttgccctggttgttgtactgggatccatggcaaggg 313
           ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 617 agaggtgcaggcccacggacaaccttgccctggttgttgtactgggatccatggcagggg 558

                                                                       
Query: 314 cagaggaacttgttctcggcggcgttccaaggcacgacgcagccaagatgcgtgcagacg 373
           ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |||
Sbjct: 557 cagaggaacttgttctcggcggcgttccacggcacgacgcatccaagatgcgtgcacacg 498

                                                                       
Query: 374 gcgttgatcccgtaggtggcgagggtcttgtcggactccaccacaaggtaggtaggatca 433
           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 497 gcgttgatcccgtaggtggcaagggtcttgtcggactccaccacaaggtaggtaggatca 438

                                                                       
Query: 434 cccttgagcccctgggcgagcgtgcggtcgttggggcccgtgcgtcttgagccaatcctc 493
           ||||||||||||||||| |||||||||||||||||| ||||||||||||||||| |||||
Sbjct: 437 cccttgagcccctgggccagcgtgcggtcgttgggg-ccgtgcgtcttgagccagtcctc 379

                                                                       
Query: 494 gacgaggatgtcgttgccgagcttgtccttggcggcgacccctccggcgttgctcccgga 553
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 378 gacgaggatgtcgttgccgagcttgtccttggcggcgacccctccggcgttgctcccgga 319

                                                                       
Query: 554 gccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagat 613
           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 318 gccggcggggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagat 259

                                                                       
Query: 614 ggcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgc 673
           |||||||||||| || |||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 258 ggcgcccagcaggagcaggttcatcagctccctcttgctcatgtccggcacgcggtccgc 199

              
Query: 674 gga 676
           |||
Sbjct: 198 gga 196

---

>dbj|AK071634.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023100K03, full
           insert sequence
          Length = 1082

 Score =  535 bits (270), Expect = e-149
 Identities = 454/514 (88%), Gaps = 1/514 (0%)
 Strand = Plus / Minus

                                                                       
Query: 157 ccaccacgggttctcgccggtcctgaagtcggtctccacccatggcacgaagacgacctt 216
           |||||||||||| ||||||||||||||||||||||||||||| ||||||||||  |||||
Sbjct: 725 ccaccacgggttgtcgccggtcctgaagtcggtctccacccacggcacgaagagaacctt 666

                                                                       
Query: 217 gctgtcgtcgacgtcggcgtgaacgagggccagcgacagaggtgcaggtccacggacaac 276
           || |||||||||||||||||| || |  ||||||||||| || |||||||||||||| ||
Sbjct: 665 gccgtcgtcgacgtcggcgtgcaccaatgccagcgacaggggagcaggtccacggacgac 606

                                                                       
Query: 277 cttgccctggttgttgtactgggatccatggcaagggcagaggaacttgttctcggcggc 336
           | ||||||||||||||||||| || || ||||| ||||||| ||||||||||||||||||
Sbjct: 605 cctgccctggttgttgtactgcgagccgtggcaggggcagatgaacttgttctcggcggc 546

                                                                       
Query: 337 gttccaaggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgag 396
           |||||| ||||||||||| ||||| |||||||| ||||||||||||||||| ||||| ||
Sbjct: 545 gttccacggcacgacgcacccaaggtgcgtgcacacggcgttgatcccgtacgtggccag 486

                                                                       
Query: 397 ggtcttgtcggactccaccacaaggtaggtaggatcacccttgagcccctgggcgagcgt 456
            |||||||||| |||||| || ||||| || || ||||||||||||||||||| ||| ||
Sbjct: 485 cgtcttgtcggcctccacgacgaggtacgtcgggtcacccttgagcccctgggtgagggt 426

                                                                       
Query: 457 gcggtcgttggggcccgtgcgtcttgagccaatcctcgacgaggatgtcgttgccgagct 516
           ||||||||||||| ||||| ||||||||||| |||||| |||| | ||||||||||||||
Sbjct: 425 gcggtcgttgggg-ccgtgtgtcttgagccactcctcggcgagcacgtcgttgccgagct 367

                                                                       
Query: 517 tgtccttggcggcgacccctccggcgttgctcccggagccggccgggacgaggaaggagc 576
           ||||||||||| |   ||| ||| ||  | ||||||| ||||| |||| || ||||| ||
Sbjct: 366 tgtccttggcgacctgcccgccgccggcgttcccggacccggcggggatgaagaaggcgc 307

                                                                       
Query: 577 cgtaggggacgagcatgccgaaggtggggagcgagatggcgcccagcagcaggaggttca 636
           ||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||||||||
Sbjct: 306 cgtaggggacgagcatgccgacggtggggagcgagatggcgccgagcaggaggaggttca 247

                                             
Query: 637 tcagctccctcttgctcatgtccgggacgcggtc 670
           ||||||  | ||||| ||||||||||||||||||
Sbjct: 246 tcagctggcgcttgcccatgtccgggacgcggtc 213

---

>gb|AF093631.1|AF093631 Oryza sativa Rieske Fe-S precursor protein (RISP) mRNA, complete
           cds
          Length = 919

 Score =  535 bits (270), Expect = e-149
 Identities = 454/514 (88%), Gaps = 1/514 (0%)
 Strand = Plus / Minus

                                                                       
Query: 157 ccaccacgggttctcgccggtcctgaagtcggtctccacccatggcacgaagacgacctt 216
           |||||||||||| ||||||||||||||||||||||||||||| ||||||||||  |||||
Sbjct: 713 ccaccacgggttgtcgccggtcctgaagtcggtctccacccacggcacgaagagaacctt 654

                                                                       
Query: 217 gctgtcgtcgacgtcggcgtgaacgagggccagcgacagaggtgcaggtccacggacaac 276
           || |||||||||||||||||| || |  ||||||||||| || |||||||||||||| ||
Sbjct: 653 gccgtcgtcgacgtcggcgtgcaccaatgccagcgacaggggagcaggtccacggacgac 594

                                                                       
Query: 277 cttgccctggttgttgtactgggatccatggcaagggcagaggaacttgttctcggcggc 336
           | ||||||||||||||||||| || || ||||| ||||||| ||||||||||||||||||
Sbjct: 593 cctgccctggttgttgtactgcgagccgtggcaggggcagatgaacttgttctcggcggc 534

                                                                       
Query: 337 gttccaaggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgag 396
           |||||| ||||||||||| ||||| |||||||| ||||||||||||||||| ||||| ||
Sbjct: 533 gttccacggcacgacgcacccaaggtgcgtgcacacggcgttgatcccgtacgtggccag 474

                                                                       
Query: 397 ggtcttgtcggactccaccacaaggtaggtaggatcacccttgagcccctgggcgagcgt 456
            |||||||||| |||||| || ||||| || || ||||||||||||||||||| ||| ||
Sbjct: 473 cgtcttgtcggcctccacgacgaggtacgtcgggtcacccttgagcccctgggtgagggt 414

                                                                       
Query: 457 gcggtcgttggggcccgtgcgtcttgagccaatcctcgacgaggatgtcgttgccgagct 516
           ||||||||||||| ||||| ||||||||||| |||||| |||| | ||||||||||||||
Sbjct: 413 gcggtcgttgggg-ccgtgtgtcttgagccactcctcggcgagcacgtcgttgccgagct 355

                                                                       
Query: 517 tgtccttggcggcgacccctccggcgttgctcccggagccggccgggacgaggaaggagc 576
           ||||||||||| |   ||| ||| ||  | ||||||| ||||| |||| || ||||| ||
Sbjct: 354 tgtccttggcgacctgcccgccgccggcgttcccggacccggcggggatgaagaaggcgc 295

                                                                       
Query: 577 cgtaggggacgagcatgccgaaggtggggagcgagatggcgcccagcagcaggaggttca 636
           ||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||||||||
Sbjct: 294 cgtaggggacgagcatgccgacggtggggagcgagatggcgccgagcaggaggaggttca 235

                                             
Query: 637 tcagctccctcttgctcatgtccgggacgcggtc 670
           ||||||  | ||||| ||||||||||||||||||
Sbjct: 234 tcagctggcgcttgcccatgtccgggacgcggtc 201

---

>emb|AJ222783.1|HVJ222783 Hordeum vulgare mRNA for cytochrome b6/f-complex iron-sulfur
           like-protein, clone RG115
          Length = 275

 Score =  529 bits (267), Expect = e-147
 Identities = 270/271 (99%)
 Strand = Plus / Minus

                                                                       
Query: 170 tcgccggtcctgaagtcggtctccacccatggcacgaagacgaccttgctgtcgtcgacg 229
           ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 275 tcgccggtcctgaagtcggtctccacccatggcacgaagacgaccttgccgtcgtcgacg 216

                                                                       
Query: 230 tcggcgtgaacgagggccagcgacagaggtgcaggtccacggacaaccttgccctggttg 289
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 215 tcggcgtgaacgagggccagcgacagaggtgcaggtccacggacaaccttgccctggttg 156

                                                                       
Query: 290 ttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacg 349
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 155 ttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacg 96

                                                                       
Query: 350 acgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcggac 409
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 95  acgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcggac 36

                                          
Query: 410 tccaccacaaggtaggtaggatcacccttga 440
           |||||||||||||||||||||||||||||||
Sbjct: 35  tccaccacaaggtaggtaggatcacccttga 5

---

>gb|BT016255.1| Zea mays clone Contig88 mRNA sequence
          Length = 998

 Score =  511 bits (258), Expect = e-142
 Identities = 457/522 (87%), Gaps = 1/522 (0%)
 Strand = Plus / Minus

                                                                       
Query: 155 ttccaccacgggttctcgccggtcctgaagtcggtctccacccatggcacgaagacgacc 214
           ||||||||||||| |||||||||||||||||||||||||||||| || ||||||| ||||
Sbjct: 746 ttccaccacgggtcctcgccggtcctgaagtcggtctccacccacgggacgaagaggacc 687

                                                                       
Query: 215 ttgctgtcgtcgacgtcggcgtgaacgagggccagcgacagaggtgcaggtccacggaca 274
           |||| ||||||||||||||||||||| ||||||||||||||||| || ||||||||||| 
Sbjct: 686 ttgccgtcgtcgacgtcggcgtgaaccagggccagcgacagaggcgccggtccacggacc 627

                                                                       
Query: 275 accttgccctggttgttgtactgggatccatggcaagggcagaggaacttgttctcggcg 334
           ||||||||||||||||||||||||||||| ||||| ||||||| ||||||||||||||||
Sbjct: 626 accttgccctggttgttgtactgggatccgtggcatgggcagatgaacttgttctcggcg 567

                                                                       
Query: 335 gcgttccaaggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcg 394
            ||||||| |||||||||||||| || || ||||| ||||||||||||||||||||||| 
Sbjct: 566 ccgttccacggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggcc 507

                                                                       
Query: 395 agggtcttgtcggactccaccacaaggtaggtaggatcacccttgagcccctgggcgagc 454
           || ||||||||   ||||||||| ||||| || || ||||||||||||||||| ||||||
Sbjct: 506 agcgtcttgtcctgctccaccaccaggtacgtggggtcacccttgagcccctgcgcgagc 447

                                                                       
Query: 455 gtgcggtcgttggggcccgtgcgtcttgagccaatcctcgacgaggatgtcgttgccgag 514
           ||||| ||||| ||| |||||||| ||||||||  |||| ||   |||||||||||| ||
Sbjct: 446 gtgcgatcgtt-gggaccgtgcgtgttgagccacgcctccaccgtgatgtcgttgcccag 388

                                                                       
Query: 515 cttgtccttggcggcgacccctccggcgttgctcccggagccggccgggacgaggaagga 574
           |||||||||||||  |  ||| ||| ||  | ||||||||||||| ||||||| ||||| 
Sbjct: 387 cttgtccttggcgtaggtcccgccgccggcgttcccggagccggcagggacgaagaaggc 328

                                                                       
Query: 575 gccgtaggggacgagcatgccgaaggtggggagcgagatggcgcccagcagcaggaggtt 634
           |||||||||||||| |||||||| |||||| | |||||||||||| || || ||||||||
Sbjct: 327 gccgtaggggacgaccatgccgacggtgggcaacgagatggcgccgaggaggaggaggtt 268

                                                     
Query: 635 catcagctccctcttgctcatgtccgggacgcggtccgcgga 676
           |||||||| || |||   |||||| ||||||||||| |||||
Sbjct: 267 catcagcttccgcttctccatgtcggggacgcggtcggcgga 226

---

>gb|AY104934.1| Zea mays PCO071754 mRNA sequence
          Length = 1058

 Score =  511 bits (258), Expect = e-142
 Identities = 457/522 (87%), Gaps = 1/522 (0%)
 Strand = Plus / Minus

                                                                       
Query: 155 ttccaccacgggttctcgccggtcctgaagtcggtctccacccatggcacgaagacgacc 214
           |||||||| |||| |||||||||||||||||||||||||||||| || ||||||| ||||
Sbjct: 805 ttccaccatgggtcctcgccggtcctgaagtcggtctccacccacgggacgaagaggacc 746

                                                                       
Query: 215 ttgctgtcgtcgacgtcggcgtgaacgagggccagcgacagaggtgcaggtccacggaca 274
           |||| ||||||||||||||||||||| ||||||||||||||||| || ||||||||||| 
Sbjct: 745 ttgccgtcgtcgacgtcggcgtgaaccagggccagcgacagaggcgccggtccacggacc 686

                                                                       
Query: 275 accttgccctggttgttgtactgggatccatggcaagggcagaggaacttgttctcggcg 334
           ||||||||||||||||||||||||||||| ||||| ||||||| |||||||||||| |||
Sbjct: 685 accttgccctggttgttgtactgggatccgtggcaggggcagatgaacttgttctcagcg 626

                                                                       
Query: 335 gcgttccaaggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcg 394
            ||||||| |||||||||||||| || || ||||| ||||||||||||||||||||||| 
Sbjct: 625 ccgttccacggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggcc 566

                                                                       
Query: 395 agggtcttgtcggactccaccacaaggtaggtaggatcacccttgagcccctgggcgagc 454
           || ||||||||   ||||||||| ||||| || || ||||||||||||||||| ||||||
Sbjct: 565 agcgtcttgtcctgctccaccaccaggtacgtggggtcacccttgagcccctgcgcgagc 506

                                                                       
Query: 455 gtgcggtcgttggggcccgtgcgtcttgagccaatcctcgacgaggatgtcgttgccgag 514
           ||||||||||| ||| |||||||| |||||||| ||||| ||   |||||||||||| ||
Sbjct: 505 gtgcggtcgtt-gggaccgtgcgtgttgagccactcctccaccgtgatgtcgttgcccag 447

                                                                       
Query: 515 cttgtccttggcggcgacccctccggcgttgctcccggagccggccgggacgaggaagga 574
           |||||||||||||  |  ||| ||| ||  | ||||||||||||| ||||||| ||||| 
Sbjct: 446 cttgtccttggcgtaggtcccgccgccggcgttcccggagccggcagggacgaagaaggc 387

                                                                       
Query: 575 gccgtaggggacgagcatgccgaaggtggggagcgagatggcgcccagcagcaggaggtt 634
           |||||||||||||| |||||||| |||||| | |||||||||||| || || ||||||||
Sbjct: 386 gccgtaggggacgaccatgccgacggtgggcaacgagatggcgccgaggaggaggaggtt 327

                                                     
Query: 635 catcagctccctcttgctcatgtccgggacgcggtccgcgga 676
           |||||||| || |||   |||||| ||||||||||| |||||
Sbjct: 326 catcagcttccgcttctccatgtcggggacgcggtcggcgga 285

---

>gb|AY581830.1| Cynodon dactylon putative Rieske Fe-S precursor protein mRNA,
           partial cds
          Length = 511

 Score =  293 bits (148), Expect = 4e-76
 Identities = 284/328 (86%), Gaps = 1/328 (0%)
 Strand = Plus / Minus

                                                                       
Query: 155 ttccaccacgggttctcgccggtcctgaagtcggtctccacccatggcacgaagacgacc 214
           |||||||| |||| |||||||||||||||||||||||||||||| || ||||| | | ||
Sbjct: 327 ttccaccaggggtcctcgccggtcctgaagtcggtctccacccacgggacgaaaagggcc 268

                                                                       
Query: 215 ttgctgtcgtcgacgtcggcgtgaacgagggccagcgacagaggtgcaggtccacggaca 274
           |||| ||||||||||||||||||||| | |||||||||||| || || ||||||||||| 
Sbjct: 267 ttgccgtcgtcgacgtcggcgtgaaccaaggccagcgacagtggcgccggtccacggacg 208

                                                                       
Query: 275 accttgccctggttgttgtactgggatccatggcaagggcagaggaacttgttctcggcg 334
           ||||||||||||||||||||||||||||| ||||| ||| | | |||||||||||||| |
Sbjct: 207 accttgccctggttgttgtactgggatccgtggcatgggtacatgaacttgttctcgggg 148

                                                                       
Query: 335 gcgttccaaggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcg 394
           |  ||||| ||||||||||| || || || |||||||| |||||||| ||||||||||| 
Sbjct: 147 ggattccacggcacgacgcatcccaggtgggtgcagaccgcgttgatgccgtaggtggcc 88

                                                                       
Query: 395 agggtcttgtcggactccaccacaaggtaggtaggatcacccttgagcccctgggcgagc 454
           || ||||||||    ||||| || ||||| || || ||||||||||||||||| | ||||
Sbjct: 87  agcgtcttgtccttgtccacgaccaggtacgtggggtcacccttgagcccctgcgtgagc 28

                                       
Query: 455 gtgcggtcgttggggcccgtgcgtcttg 482
           |||||||| |||||| ||||||||||||
Sbjct: 27  gtgcggtctttgggg-ccgtgcgtcttg 1

---

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  194 bits (98), Expect = 3e-46
 Identities = 158/178 (88%)
 Strand = Plus / Minus

                                                                            
Query: 260      gcaggtccacggacaaccttgccctggttgttgtactgggatccatggcaagggcagagg 319
                |||||||||||||| ||| ||||||||||||||||||| || || ||||| ||||||| |
Sbjct: 22132649 gcaggtccacggacgaccctgccctggttgttgtactgcgagccgtggcaggggcagatg 22132590

                                                                            
Query: 320      aacttgttctcggcggcgttccaaggcacgacgcagccaagatgcgtgcagacggcgttg 379
                ||||||||||||||||||||||| ||||||||||| ||||| |||||||| |||||||||
Sbjct: 22132589 aacttgttctcggcggcgttccacggcacgacgcacccaaggtgcgtgcacacggcgttg 22132530

                                                                          
Query: 380      atcccgtaggtggcgagggtcttgtcggactccaccacaaggtaggtaggatcaccct 437
                |||||||| ||||| || |||||||||| |||||| || ||||| || || |||||||
Sbjct: 22132529 atcccgtacgtggccagcgtcttgtcggcctccacgacgaggtacgtcgggtcaccct 22132472



 Score =  143 bits (72), Expect = 9e-31
 Identities = 105/116 (90%)
 Strand = Plus / Minus

                                                                            
Query: 555      ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 614
                ||||| |||| || ||||| ||||||||||||||||||||||| ||||||||||||||||
Sbjct: 22132170 ccggcggggatgaagaaggcgccgtaggggacgagcatgccgacggtggggagcgagatg 22132111

                                                                        
Query: 615      gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtc 670
                ||||| ||||| ||||||||||||||||  | ||||| ||||||||||||||||||
Sbjct: 22132110 gcgccgagcaggaggaggttcatcagctggcgcttgcccatgtccgggacgcggtc 22132055



 Score =  121 bits (61), Expect = 3e-24
 Identities = 76/81 (93%)
 Strand = Plus / Minus

                                                                            
Query: 157      ccaccacgggttctcgccggtcctgaagtcggtctccacccatggcacgaagacgacctt 216
                |||||||||||| ||||||||||||||||||||||||||||| ||||||||||  |||||
Sbjct: 22132954 ccaccacgggttgtcgccggtcctgaagtcggtctccacccacggcacgaagagaacctt 22132895

                                     
Query: 217      gctgtcgtcgacgtcggcgtg 237
                || ||||||||||||||||||
Sbjct: 22132894 gccgtcgtcgacgtcggcgtg 22132874



 Score =  113 bits (57), Expect = 8e-22
 Identities = 85/93 (91%), Gaps = 1/93 (1%)
 Strand = Plus / Minus

                                                                            
Query: 435      ccttgagcccctgggcgagcgtgcggtcgttggggcccgtgcgtcttgagccaatcctcg 494
                ||||||||||||||| ||| ||||||||||||||||| ||| ||||||||||| ||||||
Sbjct: 22132386 ccttgagcccctgggtgagggtgcggtcgttggggcc-gtgtgtcttgagccactcctcg 22132328

                                                 
Query: 495      acgaggatgtcgttgccgagcttgtccttggcg 527
                 |||| | |||||||||||||||||||||||||
Sbjct: 22132327 gcgagcacgtcgttgccgagcttgtccttggcg 22132295

---

>dbj|AP005125.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OSJNBa0058I18
          Length = 151453

 Score =  194 bits (98), Expect = 3e-46
 Identities = 158/178 (88%)
 Strand = Plus / Minus

                                                                         
Query: 260   gcaggtccacggacaaccttgccctggttgttgtactgggatccatggcaagggcagagg 319
             |||||||||||||| ||| ||||||||||||||||||| || || ||||| ||||||| |
Sbjct: 86305 gcaggtccacggacgaccctgccctggttgttgtactgcgagccgtggcaggggcagatg 86246

                                                                         
Query: 320   aacttgttctcggcggcgttccaaggcacgacgcagccaagatgcgtgcagacggcgttg 379
             ||||||||||||||||||||||| ||||||||||| ||||| |||||||| |||||||||
Sbjct: 86245 aacttgttctcggcggcgttccacggcacgacgcacccaaggtgcgtgcacacggcgttg 86186

                                                                       
Query: 380   atcccgtaggtggcgagggtcttgtcggactccaccacaaggtaggtaggatcaccct 437
             |||||||| ||||| || |||||||||| |||||| || ||||| || || |||||||
Sbjct: 86185 atcccgtacgtggccagcgtcttgtcggcctccacgacgaggtacgtcgggtcaccct 86128



 Score =  143 bits (72), Expect = 9e-31
 Identities = 105/116 (90%)
 Strand = Plus / Minus

                                                                         
Query: 555   ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 614
             ||||| |||| || ||||| ||||||||||||||||||||||| ||||||||||||||||
Sbjct: 85826 ccggcggggatgaagaaggcgccgtaggggacgagcatgccgacggtggggagcgagatg 85767

                                                                     
Query: 615   gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtc 670
             ||||| ||||| ||||||||||||||||  | ||||| ||||||||||||||||||
Sbjct: 85766 gcgccgagcaggaggaggttcatcagctggcgcttgcccatgtccgggacgcggtc 85711



 Score =  121 bits (61), Expect = 3e-24
 Identities = 76/81 (93%)
 Strand = Plus / Minus

                                                                         
Query: 157   ccaccacgggttctcgccggtcctgaagtcggtctccacccatggcacgaagacgacctt 216
             |||||||||||| ||||||||||||||||||||||||||||| ||||||||||  |||||
Sbjct: 86610 ccaccacgggttgtcgccggtcctgaagtcggtctccacccacggcacgaagagaacctt 86551

                                  
Query: 217   gctgtcgtcgacgtcggcgtg 237
             || ||||||||||||||||||
Sbjct: 86550 gccgtcgtcgacgtcggcgtg 86530



 Score =  113 bits (57), Expect = 8e-22
 Identities = 85/93 (91%), Gaps = 1/93 (1%)
 Strand = Plus / Minus

                                                                         
Query: 435   ccttgagcccctgggcgagcgtgcggtcgttggggcccgtgcgtcttgagccaatcctcg 494
             ||||||||||||||| ||| ||||||||||||||||| ||| ||||||||||| ||||||
Sbjct: 86042 ccttgagcccctgggtgagggtgcggtcgttggggcc-gtgtgtcttgagccactcctcg 85984

                                              
Query: 495   acgaggatgtcgttgccgagcttgtccttggcg 527
              |||| | |||||||||||||||||||||||||
Sbjct: 85983 gcgagcacgtcgttgccgagcttgtccttggcg 85951

---

>gb|DQ427777.1| Sorghum propinquum locus HHU30 genomic sequence
          Length = 742

 Score =  113 bits (57), Expect = 8e-22
 Identities = 105/121 (86%)
 Strand = Plus / Minus

                                                                       
Query: 555 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 614
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 320 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 261

                                                                       
Query: 615 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 674
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 260 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 201

            
Query: 675 g 675
           |
Sbjct: 200 g 200



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 82/93 (88%), Gaps = 1/93 (1%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggcccgtgcgtcttgagccaatcctcg 494
           ||||||||||||| || |||||||||||||| ||| ||||||||||||||||| || || 
Sbjct: 524 ccttgagcccctgcgccagcgtgcggtcgtt-gggaccgtgcgtcttgagccactcatcc 466

                                            
Query: 495 acgaggatgtcgttgccgagcttgtccttggcg 527
           ||   |||||||||||| |||||||||||||||
Sbjct: 465 accgtgatgtcgttgcccagcttgtccttggcg 433



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 739 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 680

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 679 tcctgctccaccaccaggtacgtcgggtcaccct 646

---

>gb|DQ427776.1| Sorghum bicolor voucher PI585454 locus HHU30 genomic sequence
          Length = 728

 Score =  113 bits (57), Expect = 8e-22
 Identities = 105/121 (86%)
 Strand = Plus / Minus

                                                                       
Query: 555 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 614
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                                                       
Query: 615 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 674
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 252 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 193

            
Query: 675 g 675
           |
Sbjct: 192 g 192



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 82/93 (88%), Gaps = 1/93 (1%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggcccgtgcgtcttgagccaatcctcg 494
           ||||||||||||| || |||||||||||||| ||| ||||||||||||||||| || || 
Sbjct: 516 ccttgagcccctgcgccagcgtgcggtcgtt-gggaccgtgcgtcttgagccactcatcc 458

                                            
Query: 495 acgaggatgtcgttgccgagcttgtccttggcg 527
           ||   |||||||||||| |||||||||||||||
Sbjct: 457 accgtgatgtcgttgcccagcttgtccttggcg 425



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 725 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 666

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 665 tcctgctccaccaccaggtacgtcgggtcaccct 632

---

>gb|DQ427775.1| Sorghum bicolor voucher PI267539 locus HHU30 genomic sequence
          Length = 731

 Score =  113 bits (57), Expect = 8e-22
 Identities = 105/121 (86%)
 Strand = Plus / Minus

                                                                       
Query: 555 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 614
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                                                       
Query: 615 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 674
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 252 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 193

            
Query: 675 g 675
           |
Sbjct: 192 g 192



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 82/93 (88%), Gaps = 1/93 (1%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggcccgtgcgtcttgagccaatcctcg 494
           ||||||||||||| || |||||||||||||| ||| ||||||||||||||||| || || 
Sbjct: 519 ccttgagcccctgcgccagcgtgcggtcgtt-gggaccgtgcgtcttgagccactcatcc 461

                                            
Query: 495 acgaggatgtcgttgccgagcttgtccttggcg 527
           ||   |||||||||||| |||||||||||||||
Sbjct: 460 accgtgatgtcgttgcccagcttgtccttggcg 428



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 728 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 669

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 668 tcctgctccaccaccaggtacgtcgggtcaccct 635

---

>gb|DQ427774.1| Sorghum bicolor voucher PI267408 locus HHU30 genomic sequence
          Length = 731

 Score =  113 bits (57), Expect = 8e-22
 Identities = 105/121 (86%)
 Strand = Plus / Minus

                                                                       
Query: 555 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 614
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                                                       
Query: 615 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 674
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 252 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 193

            
Query: 675 g 675
           |
Sbjct: 192 g 192



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 82/93 (88%), Gaps = 1/93 (1%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggcccgtgcgtcttgagccaatcctcg 494
           ||||||||||||| || |||||||||||||| ||| ||||||||||||||||| || || 
Sbjct: 519 ccttgagcccctgcgccagcgtgcggtcgtt-gggaccgtgcgtcttgagccactcatcc 461

                                            
Query: 495 acgaggatgtcgttgccgagcttgtccttggcg 527
           ||   |||||||||||| |||||||||||||||
Sbjct: 460 accgtgatgtcgttgcccagcttgtccttggcg 428



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 728 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 669

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 668 tcctgctccaccaccaggtacgtcgggtcaccct 635

---

>gb|DQ427773.1| Sorghum bicolor voucher PI221607 locus HHU30 genomic sequence
          Length = 725

 Score =  113 bits (57), Expect = 8e-22
 Identities = 105/121 (86%)
 Strand = Plus / Minus

                                                                       
Query: 555 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 614
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                                                       
Query: 615 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 674
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 252 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 193

            
Query: 675 g 675
           |
Sbjct: 192 g 192



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 82/93 (88%), Gaps = 1/93 (1%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggcccgtgcgtcttgagccaatcctcg 494
           ||||||||||||| || |||||||||||||| ||| ||||||||||||||||| || || 
Sbjct: 519 ccttgagcccctgcgccagcgtgcggtcgtt-gggaccgtgcgtcttgagccactcatcc 461

                                            
Query: 495 acgaggatgtcgttgccgagcttgtccttggcg 527
           ||   |||||||||||| |||||||||||||||
Sbjct: 460 accgtgatgtcgttgcccagcttgtccttggcg 428



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 722 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 663

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 662 tcctgctccaccaccaggtacgtcgggtcaccct 629

---

>gb|DQ427772.1| Sorghum bicolor voucher PI152702 locus HHU30 genomic sequence
          Length = 731

 Score =  113 bits (57), Expect = 8e-22
 Identities = 105/121 (86%)
 Strand = Plus / Minus

                                                                       
Query: 555 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 614
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                                                       
Query: 615 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 674
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 252 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 193

            
Query: 675 g 675
           |
Sbjct: 192 g 192



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 82/93 (88%), Gaps = 1/93 (1%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggcccgtgcgtcttgagccaatcctcg 494
           ||||||||||||| || |||||||||||||| ||| ||||||||||||||||| || || 
Sbjct: 519 ccttgagcccctgcgccagcgtgcggtcgtt-gggaccgtgcgtcttgagccactcatcc 461

                                            
Query: 495 acgaggatgtcgttgccgagcttgtccttggcg 527
           ||   |||||||||||| |||||||||||||||
Sbjct: 460 accgtgatgtcgttgcccagcttgtccttggcg 428



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 728 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 669

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 668 tcctgctccaccaccaggtacgtcgggtcaccct 635

---

>gb|DQ427771.1| Sorghum bicolor voucher NSL92371 locus HHU30 genomic sequence
          Length = 731

 Score =  113 bits (57), Expect = 8e-22
 Identities = 105/121 (86%)
 Strand = Plus / Minus

                                                                       
Query: 555 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 614
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                                                       
Query: 615 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 674
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 252 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 193

            
Query: 675 g 675
           |
Sbjct: 192 g 192



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 82/93 (88%), Gaps = 1/93 (1%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggcccgtgcgtcttgagccaatcctcg 494
           ||||||||||||| || |||||||||||||| ||| ||||||||||||||||| || || 
Sbjct: 519 ccttgagcccctgcgccagcgtgcggtcgtt-gggaccgtgcgtcttgagccactcatcc 461

                                            
Query: 495 acgaggatgtcgttgccgagcttgtccttggcg 527
           ||   |||||||||||| |||||||||||||||
Sbjct: 460 accgtgatgtcgttgcccagcttgtccttggcg 428



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 728 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 669

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 668 tcctgctccaccaccaggtacgtcgggtcaccct 635

---

>gb|DQ427770.1| Sorghum bicolor voucher NSL87902 locus HHU30 genomic sequence
          Length = 728

 Score =  113 bits (57), Expect = 8e-22
 Identities = 105/121 (86%)
 Strand = Plus / Minus

                                                                       
Query: 555 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 614
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                                                       
Query: 615 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 674
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 252 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 193

            
Query: 675 g 675
           |
Sbjct: 192 g 192



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 82/93 (88%), Gaps = 1/93 (1%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggcccgtgcgtcttgagccaatcctcg 494
           ||||||||||||| || |||||||||||||| ||| ||||||||||||||||| || || 
Sbjct: 516 ccttgagcccctgcgccagcgtgcggtcgtt-gggaccgtgcgtcttgagccactcatcc 458

                                            
Query: 495 acgaggatgtcgttgccgagcttgtccttggcg 527
           ||   |||||||||||| |||||||||||||||
Sbjct: 457 accgtgatgtcgttgcccagcttgtccttggcg 425



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 725 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 666

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 665 tcctgctccaccaccaggtacgtcgggtcaccct 632

---

>gb|DQ427769.1| Sorghum bicolor voucher NSL87666 locus HHU30 genomic sequence
          Length = 733

 Score =  113 bits (57), Expect = 8e-22
 Identities = 105/121 (86%)
 Strand = Plus / Minus

                                                                       
Query: 555 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 614
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                                                       
Query: 615 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 674
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 252 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 193

            
Query: 675 g 675
           |
Sbjct: 192 g 192



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 82/93 (88%), Gaps = 1/93 (1%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggcccgtgcgtcttgagccaatcctcg 494
           ||||||||||||| || |||||||||||||| ||| ||||||||||||||||| || || 
Sbjct: 521 ccttgagcccctgcgccagcgtgcggtcgtt-gggaccgtgcgtcttgagccactcatcc 463

                                            
Query: 495 acgaggatgtcgttgccgagcttgtccttggcg 527
           ||   |||||||||||| |||||||||||||||
Sbjct: 462 accgtgatgtcgttgcccagcttgtccttggcg 430



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 730 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 671

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 670 tcctgctccaccaccaggtacgtcgggtcaccct 637

---

>gb|DQ427768.1| Sorghum bicolor voucher NSL77217 locus HHU30 genomic sequence
          Length = 731

 Score =  113 bits (57), Expect = 8e-22
 Identities = 105/121 (86%)
 Strand = Plus / Minus

                                                                       
Query: 555 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 614
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                                                       
Query: 615 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 674
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 252 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 193

            
Query: 675 g 675
           |
Sbjct: 192 g 192



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 82/93 (88%), Gaps = 1/93 (1%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggcccgtgcgtcttgagccaatcctcg 494
           ||||||||||||| || |||||||||||||| ||| ||||||||||||||||| || || 
Sbjct: 519 ccttgagcccctgcgccagcgtgcggtcgtt-gggaccgtgcgtcttgagccactcatcc 461

                                            
Query: 495 acgaggatgtcgttgccgagcttgtccttggcg 527
           ||   |||||||||||| |||||||||||||||
Sbjct: 460 accgtgatgtcgttgcccagcttgtccttggcg 428



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 728 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 669

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 668 tcctgctccaccaccaggtacgtcgggtcaccct 635

---

>gb|DQ427767.1| Sorghum bicolor voucher NSL77034 locus HHU30 genomic sequence
          Length = 723

 Score =  113 bits (57), Expect = 8e-22
 Identities = 105/121 (86%)
 Strand = Plus / Minus

                                                                       
Query: 555 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 614
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 310 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 251

                                                                       
Query: 615 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 674
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 250 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 191

            
Query: 675 g 675
           |
Sbjct: 190 g 190



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 82/93 (88%), Gaps = 1/93 (1%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggcccgtgcgtcttgagccaatcctcg 494
           ||||||||||||| || |||||||||||||| ||| ||||||||||||||||| || || 
Sbjct: 517 ccttgagcccctgcgccagcgtgcggtcgtt-gggaccgtgcgtcttgagccactcatcc 459

                                            
Query: 495 acgaggatgtcgttgccgagcttgtccttggcg 527
           ||   |||||||||||| |||||||||||||||
Sbjct: 458 accgtgatgtcgttgcccagcttgtccttggcg 426



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 720 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 661

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 660 tcctgctccaccaccaggtacgtcgggtcaccct 627

---

>gb|DQ427766.1| Sorghum bicolor voucher NSL56174 locus HHU30 genomic sequence
          Length = 723

 Score =  113 bits (57), Expect = 8e-22
 Identities = 105/121 (86%)
 Strand = Plus / Minus

                                                                       
Query: 555 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 614
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 310 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 251

                                                                       
Query: 615 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 674
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 250 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 191

            
Query: 675 g 675
           |
Sbjct: 190 g 190



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 82/93 (88%), Gaps = 1/93 (1%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggcccgtgcgtcttgagccaatcctcg 494
           ||||||||||||| || |||||||||||||| ||| ||||||||||||||||| || || 
Sbjct: 517 ccttgagcccctgcgccagcgtgcggtcgtt-gggaccgtgcgtcttgagccactcatcc 459

                                            
Query: 495 acgaggatgtcgttgccgagcttgtccttggcg 527
           ||   |||||||||||| |||||||||||||||
Sbjct: 458 accgtgatgtcgttgcccagcttgtccttggcg 426



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 720 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 661

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 660 tcctgctccaccaccaggtacgtcgggtcaccct 627

---

>gb|DQ427765.1| Sorghum bicolor voucher NSL56003 locus HHU30 genomic sequence
          Length = 723

 Score =  113 bits (57), Expect = 8e-22
 Identities = 105/121 (86%)
 Strand = Plus / Minus

                                                                       
Query: 555 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 614
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 310 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 251

                                                                       
Query: 615 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 674
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 250 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 191

            
Query: 675 g 675
           |
Sbjct: 190 g 190



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 82/93 (88%), Gaps = 1/93 (1%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggcccgtgcgtcttgagccaatcctcg 494
           ||||||||||||| || |||||||||||||| ||| ||||||||||||||||| || || 
Sbjct: 517 ccttgagcccctgcgccagcgtgcggtcgtt-gggaccgtgcgtcttgagccactcatcc 459

                                            
Query: 495 acgaggatgtcgttgccgagcttgtccttggcg 527
           ||   |||||||||||| |||||||||||||||
Sbjct: 458 accgtgatgtcgttgcccagcttgtccttggcg 426



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 720 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 661

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 660 tcctgctccaccaccaggtacgtcgggtcaccct 627

---

>gb|DQ427764.1| Sorghum bicolor voucher NSL55243 locus HHU30 genomic sequence
          Length = 723

 Score =  113 bits (57), Expect = 8e-22
 Identities = 105/121 (86%)
 Strand = Plus / Minus

                                                                       
Query: 555 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 614
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 310 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 251

                                                                       
Query: 615 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 674
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 250 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 191

            
Query: 675 g 675
           |
Sbjct: 190 g 190



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 82/93 (88%), Gaps = 1/93 (1%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggcccgtgcgtcttgagccaatcctcg 494
           ||||||||||||| || |||||||||||||| ||| ||||||||||||||||| || || 
Sbjct: 517 ccttgagcccctgcgccagcgtgcggtcgtt-gggaccgtgcgtcttgagccactcatcc 459

                                            
Query: 495 acgaggatgtcgttgccgagcttgtccttggcg 527
           ||   |||||||||||| |||||||||||||||
Sbjct: 458 accgtgatgtcgttgcccagcttgtccttggcg 426



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 720 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 661

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 660 tcctgctccaccaccaggtacgtcgggtcaccct 627

---

>gb|DQ427763.1| Sorghum bicolor voucher NSL51365 locus HHU30 genomic sequence
          Length = 723

 Score =  113 bits (57), Expect = 8e-22
 Identities = 105/121 (86%)
 Strand = Plus / Minus

                                                                       
Query: 555 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 614
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 310 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 251

                                                                       
Query: 615 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 674
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 250 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 191

            
Query: 675 g 675
           |
Sbjct: 190 g 190



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 82/93 (88%), Gaps = 1/93 (1%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggcccgtgcgtcttgagccaatcctcg 494
           ||||||||||||| || |||||||||||||| ||| ||||||||||||||||| || || 
Sbjct: 517 ccttgagcccctgcgccagcgtgcggtcgtt-gggaccgtgcgtcttgagccactcatcc 459

                                            
Query: 495 acgaggatgtcgttgccgagcttgtccttggcg 527
           ||   |||||||||||| |||||||||||||||
Sbjct: 458 accgtgatgtcgttgcccagcttgtccttggcg 426



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 720 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 661

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 660 tcctgctccaccaccaggtacgtcgggtcaccct 627

---

>gb|DQ427762.1| Sorghum bicolor voucher NSL51030 locus HHU30 genomic sequence
          Length = 728

 Score =  113 bits (57), Expect = 8e-22
 Identities = 105/121 (86%)
 Strand = Plus / Minus

                                                                       
Query: 555 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 614
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                                                       
Query: 615 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 674
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 252 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 193

            
Query: 675 g 675
           |
Sbjct: 192 g 192



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 82/93 (88%), Gaps = 1/93 (1%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggcccgtgcgtcttgagccaatcctcg 494
           ||||||||||||| || |||||||||||||| ||| ||||||||||||||||| || || 
Sbjct: 516 ccttgagcccctgcgccagcgtgcggtcgtt-gggaccgtgcgtcttgagccactcatcc 458

                                            
Query: 495 acgaggatgtcgttgccgagcttgtccttggcg 527
           ||   |||||||||||| |||||||||||||||
Sbjct: 457 accgtgatgtcgttgcccagcttgtccttggcg 425



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 725 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 666

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 665 tcctgctccaccaccaggtacgtcgggtcaccct 632

---

>gb|DQ427761.1| Sorghum bicolor voucher NSL50875 locus HHU30 genomic sequence
          Length = 725

 Score =  113 bits (57), Expect = 8e-22
 Identities = 105/121 (86%)
 Strand = Plus / Minus

                                                                       
Query: 555 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 614
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                                                       
Query: 615 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 674
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 252 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 193

            
Query: 675 g 675
           |
Sbjct: 192 g 192



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 82/93 (88%), Gaps = 1/93 (1%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggcccgtgcgtcttgagccaatcctcg 494
           ||||||||||||| || |||||||||||||| ||| ||||||||||||||||| || || 
Sbjct: 519 ccttgagcccctgcgccagcgtgcggtcgtt-gggaccgtgcgtcttgagccactcatcc 461

                                            
Query: 495 acgaggatgtcgttgccgagcttgtccttggcg 527
           ||   |||||||||||| |||||||||||||||
Sbjct: 460 accgtgatgtcgttgcccagcttgtccttggcg 428



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 722 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 663

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 662 tcctgctccaccaccaggtacgtcgggtcaccct 629

---

>gb|DQ427760.1| Sorghum bicolor voucher BTx623 locus HHU30 genomic sequence
          Length = 731

 Score =  113 bits (57), Expect = 8e-22
 Identities = 105/121 (86%)
 Strand = Plus / Minus

                                                                       
Query: 555 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 614
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                                                       
Query: 615 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 674
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 252 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 193

            
Query: 675 g 675
           |
Sbjct: 192 g 192



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 82/93 (88%), Gaps = 1/93 (1%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggcccgtgcgtcttgagccaatcctcg 494
           ||||||||||||| || |||||||||||||| ||| ||||||||||||||||| || || 
Sbjct: 519 ccttgagcccctgcgccagcgtgcggtcgtt-gggaccgtgcgtcttgagccactcatcc 461

                                            
Query: 495 acgaggatgtcgttgccgagcttgtccttggcg 527
           ||   |||||||||||| |||||||||||||||
Sbjct: 460 accgtgatgtcgttgcccagcttgtccttggcg 428



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 728 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 669

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 668 tcctgctccaccaccaggtacgtcgggtcaccct 635

---

>gb|DQ122916.1| Chlamydomonas incerta chloroplast cytochrome B6/F complex rieske
           iron-sulfur protein (PetC) mRNA, partial cds; nuclear
           gene for chloroplast product
          Length = 1178

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 114/137 (83%)
 Strand = Plus / Minus

                                                                       
Query: 242 agggccagcgacagaggtgcaggtccacggacaaccttgccctggttgttgtactgggat 301
           |||||||||||||| || || || |||||||| ||||||||||    ||||||||| || 
Sbjct: 443 agggccagcgacaggggagcggggccacggaccaccttgccctcagcgttgtactgagag 384

                                                                       
Query: 302 ccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacgacgcagccaaga 361
           || |||||||||||   ||||||||||||||| ||   |||||||||||||||||| || 
Sbjct: 383 ccgtggcaagggcacttgaacttgttctcggccgccacccaaggcacgacgcagcccagg 324

                            
Query: 362 tgcgtgcagacggcgtt 378
           || ||||| ||||||||
Sbjct: 323 tgagtgcacacggcgtt 307

---

>dbj|D32003.1| Chlamydomonas reinhardtii mRNA for chloroplast Rieske Fe-S
           precursor protein, complete cds
          Length = 1436

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 114/137 (83%)
 Strand = Plus / Minus

                                                                       
Query: 242 agggccagcgacagaggtgcaggtccacggacaaccttgccctggttgttgtactgggat 301
           |||||||||||||| || || || |||||||| ||||||||||    ||||||||| || 
Sbjct: 576 agggccagcgacaggggagcggggccacggaccaccttgccctcagcgttgtactgagag 517

                                                                       
Query: 302 ccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacgacgcagccaaga 361
           || |||||||||||   ||||||||||||||| ||   |||||||||||||||||| || 
Sbjct: 516 ccgtggcaagggcacttgaacttgttctcggccgccacccaaggcacgacgcagcccagg 457

                            
Query: 362 tgcgtgcagacggcgtt 378
           || ||||| ||||||||
Sbjct: 456 tgagtgcacacggcgtt 440

---

>gb|DQ384526.1| Panax ginseng clone PG6L-3 photosynthetic electron transfer-like
           protein mRNA, complete cds
          Length = 770

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 116/140 (82%)
 Strand = Plus / Minus

                                                                       
Query: 251 gacagaggtgcaggtccacggacaaccttgccctggttgttgtactgggatccatggcaa 310
           |||||||| ||||| || |  ||||||||||| |||||||||||||| ||||||||||| 
Sbjct: 528 gacagaggagcagggcctctaacaaccttgccttggttgttgtactgagatccatggcat 469

                                                                       
Query: 311 gggcagaggaacttgttctcggcggcgttccaaggcacgacgcagccaagatgcgtgcag 370
           ||||| | |||||||||||| ||    ||||| ||||| || || |||||||||||||| 
Sbjct: 468 gggcacatgaacttgttctctgctttattccatggcacaacacaaccaagatgcgtgcac 409

                               
Query: 371 acggcgttgatcccgtaggt 390
           || || ||||| || |||||
Sbjct: 408 actgcattgataccataggt 389

---

>gb|AY826845.1| Pavlova lutheri clone PLCB61 chloroplast cytochrome b6 mRNA,
           partial cds; nuclear gene for chloroplast product
          Length = 640

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 77/89 (86%)
 Strand = Plus / Minus

                                                                       
Query: 292 gtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacgac 351
           |||||| || || ||||| ||||||| |||||| | ||  ||||||||||| ||||||||
Sbjct: 310 gtactgcgagccgtggcaggggcagatgaacttctgctgcgcggcgttccacggcacgac 251

                                        
Query: 352 gcagccaagatgcgtgcagacggcgttga 380
           ||||||||| ||||||||||| |||||||
Sbjct: 250 gcagccaaggtgcgtgcagaccgcgttga 222

---

>gb|AY300039.1| Solanum tuberosum putative Rieske Fe-S protein precursor (FeS)
           mRNA, complete cds; nuclear gene for chloroplast product
          Length = 693

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 124/152 (81%)
 Strand = Plus / Minus

                                                                       
Query: 287 ttgttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggc 346
           |||||||| || ||||||||||||||||| | |||||||||||| || |  ||||| |||
Sbjct: 557 ttgttgtattgagatccatggcaagggcaaatgaacttgttctcagcagtattccacggc 498

                                                                       
Query: 347 acgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406
           ||||| || ||||| || ||||| || |||||||| || ||||| ||||| ||    |||
Sbjct: 497 acgacacaaccaaggtgagtgcacacagcgttgataccataggtcgcgagtgttccatcg 438

                                           
Query: 407 gactccaccacaaggtaggtaggatcaccctt 438
             |||||| |||||||| |||||||| |||||
Sbjct: 437 ttctccacaacaaggtaagtaggatctccctt 406

---

>emb|AL731601.3|OSJN00245 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0044M19,
             complete sequence
          Length = 188317

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 87/103 (84%), Gaps = 6/103 (5%)
 Strand = Plus / Plus

                                                                         
Query: 157   ccaccacgggttctcgccggtcctgaagtcggtctc------cacccatggcacgaagac 210
             |||||||||||| ||||| |||||||||||||||||      |||||| |||||||||| 
Sbjct: 53046 ccaccacgggttgtcgccagtcctgaagtcggtctccactcacacccacggcacgaagag 53105

                                                        
Query: 211   gaccttgctgtcgtcgacgtcggcgtgaacgagggccagcgac 253
              ||||||  ||||||||||||||||||||| |  |||||||||
Sbjct: 53106 aaccttgtcgtcgtcgacgtcggcgtgaaccaatgccagcgac 53148

---

>gb|AC122543.1| Genomic sequence for Brassica oleracea, clone B21H13, complete sequence
          Length = 101563

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 121/148 (81%)
 Strand = Plus / Minus

                                                                          
Query: 290    ttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacg 349
              ||||| ||||||||||||||||| || |||||||||||||| ||   |||||| ||||| 
Sbjct: 101211 ttgtattgggatccatggcaaggacataggaacttgttctcagctttgttccatggcaca 101152

                                                                          
Query: 350    acgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcggac 409
              || || |||||||| ||||| || ||||| || ||||| || || || |||||||||  |
Sbjct: 101151 acacatccaagatgtgtgcatactgcgtttataccgtatgtcgctagtgtcttgtcgttc 101092

                                          
Query: 410    tccaccacaaggtaggtaggatcaccct 437
              ||||| || ||||| || ||||| ||||
Sbjct: 101091 tccacaactaggtaagttggatctccct 101064

---

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 87/103 (84%), Gaps = 6/103 (5%)
 Strand = Plus / Plus

                                                                            
Query: 157      ccaccacgggttctcgccggtcctgaagtcggtctc------cacccatggcacgaagac 210
                |||||||||||| ||||| |||||||||||||||||      |||||| |||||||||| 
Sbjct: 18961122 ccaccacgggttgtcgccagtcctgaagtcggtctccactcacacccacggcacgaagag 18961181

                                                           
Query: 211      gaccttgctgtcgtcgacgtcggcgtgaacgagggccagcgac 253
                 ||||||  ||||||||||||||||||||| |  |||||||||
Sbjct: 18961182 aaccttgtcgtcgtcgacgtcggcgtgaaccaatgccagcgac 18961224



 Score = 40.1 bits (20), Expect = 9.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                      
Query: 3       tttctcttctttntagactgtat 25
               |||||||||||| ||||||||||
Sbjct: 8169878 tttctcttctttttagactgtat 8169856

---

>gb|AF037456.1|AF037456 Fritillaria agrestis cytochrome B6-F complex iron-sulfur subunit
           precursor (petC) mRNA, complete cds
          Length = 881

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 245 gccagcgacagaggtgcaggtccacggacaaccttgccctggttgttgtactgggatcca 304
           ||||||||||  ||||||||||| | ||||||||| || || |||||||| || ||||| 
Sbjct: 605 gccagcgacaacggtgcaggtcccctgacaaccttcccttgattgttgtattgcgatccg 546

                                  
Query: 305 tggcaagggcagaggaacttgtt 327
           ||||| |||||||||||||||||
Sbjct: 545 tggcaggggcagaggaacttgtt 523

---

>ref|NM_116566.3| Arabidopsis thaliana PETC (PHOTOSYNTHETIC ELECTRON TRANSFER C)
           AT4G03280 (PETC) transcript variant AT4G03280.1 mRNA,
           complete cds
          Length = 963

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 98/118 (83%)
 Strand = Plus / Minus

                                                                       
Query: 289 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348
           |||||| ||||||||||||||||| || || ||||||||||| ||   |||||| |||||
Sbjct: 678 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 619

                                                                     
Query: 349 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406
            || || |||||||| ||||| || |||||||| ||||| || || || |||||||||
Sbjct: 618 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 561

---

>ref|NM_178964.1| Arabidopsis thaliana PETC (PHOTOSYNTHETIC ELECTRON TRANSFER C)
           AT4G03280 (PETC) transcript variant AT4G03280.2 mRNA,
           complete cds
          Length = 1062

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 98/118 (83%)
 Strand = Plus / Minus

                                                                       
Query: 289 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348
           |||||| ||||||||||||||||| || || ||||||||||| ||   |||||| |||||
Sbjct: 777 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 718

                                                                     
Query: 349 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406
            || || |||||||| ||||| || |||||||| ||||| || || || |||||||||
Sbjct: 717 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 660

---

>gb|AC005275.1| Arabidopsis thaliana BAC F4C21 from chromosome IV, top arm, near 17 cM,
             complete sequence
          Length = 136335

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 98/118 (83%)
 Strand = Plus / Minus

                                                                         
Query: 289   gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348
             |||||| ||||||||||||||||| || || ||||||||||| ||   |||||| |||||
Sbjct: 74269 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 74210

                                                                       
Query: 349   gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406
              || || |||||||| ||||| || |||||||| ||||| || || || |||||||||
Sbjct: 74209 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 74152

---

>emb|AL161496.2|ATCHRIV8 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 8
          Length = 195429

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 98/118 (83%)
 Strand = Plus / Minus

                                                                         
Query: 289   gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348
             |||||| ||||||||||||||||| || || ||||||||||| ||   |||||| |||||
Sbjct: 92641 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 92582

                                                                       
Query: 349   gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406
              || || |||||||| ||||| || |||||||| ||||| || || || |||||||||
Sbjct: 92581 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 92524

---

>emb|AJ292972.1|ATH292972 Arabidopsis thaliana petC gene for Rieske FeS protein, exons 1-5
          Length = 2145

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 98/118 (83%)
 Strand = Plus / Minus

                                                                        
Query: 289  gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348
            |||||| ||||||||||||||||| || || ||||||||||| ||   |||||| |||||
Sbjct: 1917 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 1858

                                                                      
Query: 349  gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406
             || || |||||||| ||||| || |||||||| ||||| || || || |||||||||
Sbjct: 1857 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 1800

---

>emb|AJ243702.1|ATH243702 Arabidopsis thaliana mRNA for rieske iron-sulfur protein precursor
           (petC gene)
          Length = 957

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 98/118 (83%)
 Strand = Plus / Minus

                                                                       
Query: 289 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348
           |||||| ||||||||||||||||| || || ||||||||||| ||   |||||| |||||
Sbjct: 654 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 595

                                                                     
Query: 349 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406
            || || |||||||| ||||| || |||||||| ||||| || || || |||||||||
Sbjct: 594 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 537

---

>gb|AY093726.1| Arabidopsis thaliana AT4g03280/F4C21_21 mRNA, complete cds
          Length = 633

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 98/118 (83%)
 Strand = Plus / Minus

                                                                       
Query: 289 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348
           |||||| ||||||||||||||||| || || ||||||||||| ||   |||||| |||||
Sbjct: 492 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 433

                                                                     
Query: 349 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406
            || || |||||||| ||||| || |||||||| ||||| || || || |||||||||
Sbjct: 432 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 375

---

>gb|AF410296.1|AF410296 Arabidopsis thaliana AT4g03280/F4C21_21 mRNA, complete cds
          Length = 1061

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 98/118 (83%)
 Strand = Plus / Minus

                                                                       
Query: 289 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348
           |||||| ||||||||||||||||| || || ||||||||||| ||   |||||| |||||
Sbjct: 780 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 721

                                                                     
Query: 349 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406
            || || |||||||| ||||| || |||||||| ||||| || || || |||||||||
Sbjct: 720 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 663

---

>gb|AF370566.1|AF370566 Arabidopsis thaliana putative component of cytochrome B6-F complex
           (F4C21.21) mRNA, complete cds
          Length = 732

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 98/118 (83%)
 Strand = Plus / Minus

                                                                       
Query: 289 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348
           |||||| ||||||||||||||||| || || ||||||||||| ||   |||||| |||||
Sbjct: 549 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 490

                                                                     
Query: 349 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406
            || || |||||||| ||||| || |||||||| ||||| || || || |||||||||
Sbjct: 489 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 432

---

>emb|BX827560.1|CNS0A2RQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS74ZE01 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1358

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 98/118 (83%)
 Strand = Plus / Minus

                                                                        
Query: 289  gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348
            |||||| ||||||||||||||||| || || ||||||||||| ||   |||||| |||||
Sbjct: 1133 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 1074

                                                                      
Query: 349  gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406
             || || |||||||| ||||| || |||||||| ||||| || || || |||||||||
Sbjct: 1073 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 1016

---

>ref|NM_193963.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 705

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                       
Query: 189 tctccacccatggcacgaagacgaccttgctgtcgtcgacgtcggcgtgaacgagggcca 248
           |||||||||| ||||||||||  ||||||| ||||||||||||||||||||| |  ||||
Sbjct: 160 tctccacccacggcacgaagagaaccttgccgtcgtcgacgtcggcgtgaaccaatgcca 101

                
Query: 249 gcgac 253
           |||||
Sbjct: 100 gcgac 96

---

>emb|AJ784852.1| Cyanophora paradoxa mRNA for Rieske iron-sulphur protein (petC-1
           gene)
          Length = 864

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                       
Query: 292 gtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacgac 351
           ||||||||| || ||||| ||||| | |||||||||||| |  |||||||| || |||||
Sbjct: 615 gtactgggagccgtggcacgggcacatgaacttgttctccgacgcgttccacgggacgac 556

                                        
Query: 352 gcagccaagatgcgtgcagacggcgttga 380
           ||| ||||| || ||||||||||||||||
Sbjct: 555 gcacccaaggtgagtgcagacggcgttga 527

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                            
Query: 189      tctccacccatggcacgaagacgaccttgctgtcgtcgacgtcggcgtgaacgagggcca 248
                |||||||||| ||||||||||  ||||||| ||||||||||||||||||||| |  ||||
Sbjct: 14242662 tctccacccacggcacgaagagaaccttgccgtcgtcgacgtcggcgtgaaccaatgcca 14242603

                     
Query: 249      gcgac 253
                |||||
Sbjct: 14242602 gcgac 14242598

---

>dbj|AP002870.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0458A05
          Length = 120593

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                         
Query: 189   tctccacccatggcacgaagacgaccttgctgtcgtcgacgtcggcgtgaacgagggcca 248
             |||||||||| ||||||||||  ||||||| ||||||||||||||||||||| |  ||||
Sbjct: 38352 tctccacccacggcacgaagagaaccttgccgtcgtcgacgtcggcgtgaaccaatgcca 38293

                  
Query: 249   gcgac 253
             |||||
Sbjct: 38292 gcgac 38288

---

>dbj|AB025003.1| Cicer arietinum mRNA for plastoquinol-plastocyanin reductase,
           partial cds
          Length = 479

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 121/149 (81%)
 Strand = Plus / Minus

                                                                       
Query: 290 ttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacg 349
           |||||||| ||||||||||| |||||||  |||||||||||||||| |||  | ||||||
Sbjct: 361 ttgtactgagatccatggcaggggcagataaacttgttctcggcggtgttaaacggcacg 302

                                                                       
Query: 350 acgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcggac 409
           || || || || || ||||| || || || ||||| || || || || ||  ||||   |
Sbjct: 301 acacacccgaggtgagtgcatactgcattaatcccatatgttgcaagtgttctgtctttc 242

                                        
Query: 410 tccaccacaaggtaggtaggatcaccctt 438
           ||||||||||||||||||||||| |||||
Sbjct: 241 tccaccacaaggtaggtaggatccccctt 213

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 86/103 (83%), Gaps = 6/103 (5%)
 Strand = Plus / Minus

                                                                           
Query: 157     ccaccacgggttctcgccggtcctgaagtcggtctccac------ccatggcacgaagac 210
               |||||||||||| ||||| ||||||||||| ||||||||      ||| |||||||||| 
Sbjct: 8732264 ccaccacgggttgtcgccagtcctgaagtcagtctccactcacacccacggcacgaagag 8732205

                                                          
Query: 211     gaccttgctgtcgtcgacgtcggcgtgaacgagggccagcgac 253
                ||||||  ||||||||||||||||||||| |  |||||||||
Sbjct: 8732204 aaccttgtcgtcgtcgacgtcggcgtgaaccaatgccagcgac 8732162

---

>dbj|AP004875.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0463G12
          Length = 145403

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 86/103 (83%), Gaps = 6/103 (5%)
 Strand = Plus / Minus

                                                                          
Query: 157    ccaccacgggttctcgccggtcctgaagtcggtctccac------ccatggcacgaagac 210
              |||||||||||| ||||| ||||||||||| ||||||||      ||| |||||||||| 
Sbjct: 139311 ccaccacgggttgtcgccagtcctgaagtcagtctccactcacacccacggcacgaagag 139252

                                                         
Query: 211    gaccttgctgtcgtcgacgtcggcgtgaacgagggccagcgac 253
               ||||||  ||||||||||||||||||||| |  |||||||||
Sbjct: 139251 aaccttgtcgtcgtcgacgtcggcgtgaaccaatgccagcgac 139209

---

>dbj|AP006844.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBa0052K15
          Length = 156250

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 86/103 (83%), Gaps = 6/103 (5%)
 Strand = Plus / Minus

                                                                         
Query: 157   ccaccacgggttctcgccggtcctgaagtcggtctccac------ccatggcacgaagac 210
             |||||||||||| ||||| ||||||||||| ||||||||      ||| |||||||||| 
Sbjct: 31343 ccaccacgggttgtcgccagtcctgaagtcagtctccactcacacccacggcacgaagag 31284

                                                        
Query: 211   gaccttgctgtcgtcgacgtcggcgtgaacgagggccagcgac 253
              ||||||  ||||||||||||||||||||| |  |||||||||
Sbjct: 31283 aaccttgtcgtcgtcgacgtcggcgtgaaccaatgccagcgac 31241

---

>dbj|AU066527.1| Chlamydomonas sp. HS-5 mRNA for hypothetical protein, NaCl
           inducible, complete cds, clone:NaEX96-104
          Length = 578

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 275 accttgccctggttgttgtactgggatccatggcaagggcagaggaacttgttctc 330
           ||||||||||||||||||||||| ||||| ||||| |||||   ||||||||||||
Sbjct: 474 accttgccctggttgttgtactgcgatccgtggcaggggcacttgaacttgttctc 419

---

>gb|AC134927.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1036C05,
             complete sequence
          Length = 143400

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 55/63 (87%)
 Strand = Plus / Plus

                                                                         
Query: 191   tccacccatggcacgaagacgaccttgctgtcgtcgacgtcggcgtgaacgagggccagc 250
             |||| ||| ||||||||||  ||||||| ||||||||||||||||||||| |  ||||||
Sbjct: 64199 tccatccacggcacgaagataaccttgccgtcgtcgacgtcggcgtgaaccaatgccagc 64258

                
Query: 251   gac 253
             |||
Sbjct: 64259 gac 64261

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 55/63 (87%)
 Strand = Plus / Plus

                                                                            
Query: 191      tccacccatggcacgaagacgaccttgctgtcgtcgacgtcggcgtgaacgagggccagc 250
                |||| ||| ||||||||||  ||||||| ||||||||||||||||||||| |  ||||||
Sbjct: 16113029 tccatccacggcacgaagataaccttgccgtcgtcgacgtcggcgtgaaccaatgccagc 16113088

                   
Query: 251      gac 253
                |||
Sbjct: 16113089 gac 16113091

---

>emb|BX826362.1|CNS0A4FZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB19ZF07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 714

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 96/118 (81%)
 Strand = Plus / Minus

                                                                       
Query: 289 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348
           |||||| ||||||||||||||||| ||  | ||||||| ||| ||   |||||| |||||
Sbjct: 678 gttgtattgggatccatggcaaggacatggaaacttgtactcagctttgttccatggcac 619

                                                                     
Query: 349 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406
            || || |||||||| ||||| || |||||||| ||||| || || || |||||||||
Sbjct: 618 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 561

---

>emb|X63605.1|PSPETC P.sativum petC mRNA for chloroplast Rieske FeS protein
          Length = 880

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 290 ttgtactgggatccatggcaagggcagaggaacttgttctc 330
           |||||||| ||||||||||| ||||||| ||||||||||||
Sbjct: 591 ttgtactgagatccatggcaggggcagatgaacttgttctc 551



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 413 accacaaggtaggtaggatcaccctt 438
           ||||||||||||||||||||||||||
Sbjct: 468 accacaaggtaggtaggatcaccctt 443

---

>gb|AY826843.1| Heterocapsa triquetra clone HTCB61 chloroplast cytochrome b6 mRNA,
           partial cds; nuclear gene for chloroplast product
          Length = 531

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 87/107 (81%)
 Strand = Plus / Minus

                                                                       
Query: 275 accttgccctggttgttgtactgggatccatggcaagggcagaggaacttgttctcggcg 334
           |||||||||| || ||||||||| ||||| ||||| ||||||| |||   |||| ||   
Sbjct: 276 accttgccctcgtcgttgtactgcgatccgtggcacgggcagatgaagcggttcgcgttc 217

                                                          
Query: 335 gcgttccaaggcacgacgcagccaagatgcgtgcagacggcgttgat 381
             |||||| |||||||||||||| || || |||||||| ||||||||
Sbjct: 216 ctgttccagggcacgacgcagcccaggtgggtgcagaccgcgttgat 170

---

>emb|AJ784853.1| Cyanophora paradoxa mRNA for Rieske iron-sulphur protein (petC-2
           gene)
          Length = 874

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 337 gttccaaggcacgacgcagccaagatgcgtgcagacggcgtt 378
           |||||| || |||||||||||||| || ||||||||||||||
Sbjct: 554 gttccagggaacgacgcagccaaggtgagtgcagacggcgtt 513



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 419 aggtaggtaggatcacccttgagcccctgggcgagcgtgcggtcg 463
           |||||||| | ||| |||||||| ||||||||||||| |||||||
Sbjct: 472 aggtaggtggcatcgcccttgaggccctgggcgagcgagcggtcg 428

---

>emb|BX826457.1|CNS0A4G1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB28ZC01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 532

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 289 gttgtactgggatccatggcaagggcagaggaacttgttctc 330
           |||||| ||||||||||||||||| || || |||||||||||
Sbjct: 252 gttgtattgggatccatggcaaggacatagaaacttgttctc 211

---

>emb|BX826302.1|CNS0A381 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB13ZB05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 790

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 95/118 (80%)
 Strand = Plus / Minus

                                                                       
Query: 289 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348
           |||||| ||||||||||||||||| || |  ||||||||||| ||   |||||| |||||
Sbjct: 553 gttgtattgggatccatggcaaggacataaaaacttgttctcagctttgttccatggcac 494

                                                                     
Query: 349 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406
            || || |||||| | || || || |||||||| ||||| || || || |||||||||
Sbjct: 493 aacacatccaagaagagttcacactgcgttgataccgtatgtcgctagagtcttgtcg 436

---

>emb|X06244.1|SORFES Spinach mRNA for Rieske FeS-precursor protein
          Length = 1024

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 98/122 (80%)
 Strand = Plus / Minus

                                                                       
Query: 251 gacagaggtgcaggtccacggacaaccttgccctggttgttgtactgggatccatggcaa 310
           |||| ||||||||| || || |||||  |||| ||||| ||||| |||||||||||||| 
Sbjct: 683 gacaaaggtgcagggcctcgaacaactctgccttggttattgtattgggatccatggcat 624

                                                                       
Query: 311 gggcagaggaacttgttctcggcggcgttccaaggcacgacgcagccaagatgcgtgcag 370
           || || | ||| |||||||| || || ||  | ||||| || || |||||||| ||||||
Sbjct: 623 ggacaaatgaatttgttctcagcagcattaaatggcaccacacatccaagatgtgtgcag 564

             
Query: 371 ac 372
           ||
Sbjct: 563 ac 562

---

>gb|AF110783.1|AF110783 Volvox carteri f. nagariensis clone G9 rieske iron-sulfur protein
           precursor (petC) mRNA, nuclear gene encoding chloroplast
           protein, complete cds
          Length = 1159

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 109/137 (79%)
 Strand = Plus / Minus

                                                                       
Query: 242 agggccagcgacagaggtgcaggtccacggacaaccttgccctggttgttgtactgggat 301
           |||||||  ||||| || ||||| |||||||| ||||||||||     |||||||| || 
Sbjct: 553 agggccaaagacagcggagcagggccacggaccaccttgccctcagcattgtactgagag 494

                                                                       
Query: 302 ccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacgacgcagccaaga 361
           || |||||||||||   ||||||||||||||| ||   |||||| ||||| ||||| |  
Sbjct: 493 ccgtggcaagggcacttgaacttgttctcggccgccacccaaggaacgacacagcccaag 434

                            
Query: 362 tgcgtgcagacggcgtt 378
           || ||||| ||||||||
Sbjct: 433 tgggtgcacacggcgtt 417

---

>gb|AY267656.1| Bigelowiella natans Fe-S subunit of cytochrome c6f complex mRNA,
           complete cds; nuclear gene for plastid product
          Length = 1025

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 292 gtactgggatccatggcaagggca 315
           ||||||||||||||||||||||||
Sbjct: 653 gtactgggatccatggcaagggca 630

---

>emb|X76299.1|CRPETC C.reinhardtii petC gene
          Length = 1608

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                        
Query: 266  ccacggacaaccttgccctggttgttgtactgggatccatggcaagggcagaggaacttg 325
            |||||||| ||||||||||    ||||||||| || || |||||||||||   |||||||
Sbjct: 1171 ccacggaccaccttgccctcagcgttgtactgagagccgtggcaagggcacttgaacttg 1112

                    
Query: 326  ttctcggc 333
            ||||||||
Sbjct: 1111 ttctcggc 1104



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 340 ccaaggcacgacgcagccaagatgcgtgcagacggcgtt 378
           |||||||||||||||||| || || ||||| ||||||||
Sbjct: 959 ccaaggcacgacgcagcccaggtgagtgcacacggcgtt 921

---

>emb|X66009.1|NTRFES1 N.tabacum mRNA for chloroplast Rieske FeS precursor protein 1
          Length = 814

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 284 tggttgttgtactgggatccatggcaagggcagaggaacttgttctc 330
           ||||||||||| || ||||||||||| ||||| |  |||||||||||
Sbjct: 592 tggttgttgtattgagatccatggcaggggcaaataaacttgttctc 546

---

>emb|X64353.1|NTRFSCBFC N.tabacum mRNA for Rieske Fe/S protein of cytochrome b6/f complex
          Length = 833

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 284 tggttgttgtactgggatccatggcaagggcagaggaacttgttctc 330
           ||||||||||| || ||||||||||| ||||| |  |||||||||||
Sbjct: 556 tggttgttgtattgagatccatggcaggggcaaataaacttgttctc 510

---

>emb|BX572099.1| Prochlorococcus marinus MIT9313 complete genome; segment 5/7
          Length = 349746

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                                
Query: 337   gttccaaggcacgacgcagccaagatgcgtgcagacggcgttgatcccgta 387
             |||||||||||| |||||||| || || |||||||  |||||||| |||||
Sbjct: 12422 gttccaaggcaccacgcagccgaggtgggtgcagatcgcgttgattccgta 12372

---

>emb|BX569694.1| Synechococcus sp. WH8102 complete genome; segment 6/7
          Length = 349122

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                         
Query: 305   tggcaagggcagaggaacttgttctcggcggcgttccaaggcacgacgcagccaagatgc 364
             ||||||||||| | |||||||||  || ||  |||||| ||||| |||||||| || || 
Sbjct: 17548 tggcaagggcacatgaacttgttggcgccgctgttccagggcaccacgcagcccaggtgg 17489

                                    
Query: 365   gtgcagacggcgttgatcccgta 387
             ||||||| |||||| || |||||
Sbjct: 17488 gtgcagatggcgttaatgccgta 17466

---

>dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete genome
          Length = 2696255

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                    
Query: 335    gcgttccaaggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtag 388
              |||||||||||||| |||||||| |  || ||||| || |||||||| ||||||
Sbjct: 367671 gcgttccaaggcaccacgcagcccaagtgggtgcaaactgcgttgatgccgtag 367618

---

>gb|AY826844.1| Isochrysis galbana clone ISCB61 chloroplast cytochrome b6 mRNA,
           partial cds; nuclear gene for chloroplast product
          Length = 1010

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 91/114 (79%)
 Strand = Plus / Minus

                                                                       
Query: 292 gtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacgac 351
           |||||| || || ||||| ||||||| | |||||  || ||||  |||||| || |||||
Sbjct: 521 gtactgcgagccgtggcacgggcagatgtacttgagctgggcgcggttccatgggacgac 462

                                                                 
Query: 352 gcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtc 405
           |||||| || || ||||| || ||||||||  ||||| |  |||||||||||||
Sbjct: 461 gcagccgaggtgggtgcaaacagcgttgatggcgtagttctcgagggtcttgtc 408

---

>gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome
          Length = 2695903

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                     
Query: 335     gcgttccaaggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtag 388
               |||||||||||||| |||||||| |  || ||||| || |||||||| ||||||
Sbjct: 1253134 gcgttccaaggcaccacgcagcccaagtgggtgcaaactgcgttgatgccgtag 1253187

---

>gb|AC093100.2| Drosophila melanogaster clone BACR05J04, complete sequence
          Length = 214621

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 507    ttgccgagcttgtccttggcggcga 531
              ||||||||| |||||||||||||||
Sbjct: 148179 ttgccgagcgtgtccttggcggcga 148155

---

>gb|AC090377.15| Homo sapiens chromosome 18, clone RP11-866E20, complete sequence
          Length = 192704

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 617    gcccagcagcaggaggttcat 637
              |||||||||||||||||||||
Sbjct: 142142 gcccagcagcaggaggttcat 142162

---

>gb|AC107990.5| Homo sapiens chromosome 18, clone RP11-103A19, complete sequence
          Length = 166109

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 617   gcccagcagcaggaggttcat 637
             |||||||||||||||||||||
Sbjct: 25300 gcccagcagcaggaggttcat 25320

---

>ref|NM_135169.2| Drosophila melanogaster Pez CG9493-RA (Pez), mRNA
          Length = 4527

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 507  ttgccgagcttgtccttggcggcga 531
            ||||||||| |||||||||||||||
Sbjct: 1064 ttgccgagcgtgtccttggcggcga 1040

---

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 211      gaccttgctgtcgtcgacgtc 231
                |||||||||||||||||||||
Sbjct: 25526148 gaccttgctgtcgtcgacgtc 25526168

---

>gb|AF217284.1|AF217284 Drosophila melanogaster protein tyrosine phosphatase Pez (Pez)
           mRNA, complete cds
          Length = 4433

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 507 ttgccgagcttgtccttggcggcga 531
           ||||||||| |||||||||||||||
Sbjct: 955 ttgccgagcgtgtccttggcggcga 931

---

>gb|AE003613.4| Drosophila melanogaster chromosome 2L, section 22 of 83 of the complete
              sequence
          Length = 280095

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 507    ttgccgagcttgtccttggcggcga 531
              ||||||||| |||||||||||||||
Sbjct: 119693 ttgccgagcgtgtccttggcggcga 119717

---

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 211      gaccttgctgtcgtcgacgtc 231
                |||||||||||||||||||||
Sbjct: 25454324 gaccttgctgtcgtcgacgtc 25454344

---

>emb|AL928781.4|CNS08CCB Oryza sativa chromosome 12, . BAC OSJNBa0070E09 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 144084

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   gaccttgctgtcgtcgacgtc 231
             |||||||||||||||||||||
Sbjct: 95530 gaccttgctgtcgtcgacgtc 95550

---

>gb|AC005285.1|AC005285 Drosophila melanogaster DNA sequence (P1s DS00121 (D128), DS05470 (D270),
              and DS00108 (D120)), complete sequence
          Length = 209071

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 507    ttgccgagcttgtccttggcggcga 531
              ||||||||| |||||||||||||||
Sbjct: 133047 ttgccgagcgtgtccttggcggcga 133071

---

>ref|NM_018094.2| Homo sapiens G1 to S phase transition 2 (GSPT2), mRNA
          Length = 2503

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 541 cgttgctcccggagccggccggga 564
           ||||||| ||||||||||||||||
Sbjct: 464 cgttgctgccggagccggccggga 441

---

>gb|AC120788.7| Mus musculus chromosome 14, clone RP23-279B13, complete sequence
          Length = 215810

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 88    ttaggactggcaggaggctt 107
             ||||||||||||||||||||
Sbjct: 14455 ttaggactggcaggaggctt 14436

---

>gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome
          Length = 2467205

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 511     cgagcttgtccttggcggcg 530
               ||||||||||||||||||||
Sbjct: 1291092 cgagcttgtccttggcggcg 1291073

---

>gb|AC148476.4| Homo sapiens 12 BAC RP13-714J12 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 41737

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 610  agatggcgcccagcagcagg 629
            ||||||||||||||||||||
Sbjct: 3744 agatggcgcccagcagcagg 3763

---

>ref|XM_754954.1| Ustilago maydis 521 hypothetical protein (UM03900.1) partial mRNA
          Length = 3015

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  ggcaagggcagaggaacttg 325
            ||||||||||||||||||||
Sbjct: 1647 ggcaagggcagaggaacttg 1628

---

>gb|AC124358.4| Mus musculus BAC clone RP24-491B24 from chromosome 3, complete sequence
          Length = 161119

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 633   ttcatcagctccctcttgctcatg 656
             ||||| ||||||||||||||||||
Sbjct: 31588 ttcataagctccctcttgctcatg 31611

---

>gb|AC125332.3| Mus musculus BAC clone RP23-113I20 from 3, complete sequence
          Length = 220068

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 303    catggcaagggcagaggaac 322
              ||||||||||||||||||||
Sbjct: 148711 catggcaagggcagaggaac 148730

---

>gb|AC121928.2| Mus musculus BAC clone RP24-204F1 from 3, complete sequence
          Length = 178387

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 303    catggcaagggcagaggaac 322
              ||||||||||||||||||||
Sbjct: 151789 catggcaagggcagaggaac 151770

---

>emb|AL929101.4| Human DNA sequence from clone RP11-22B10 on chromosome X Contains the
             GSPT2 gene for G1 to S phase transition 2, a pseudogene
             similar to part of p30 (nuclear protein p30), a zinc
             finger protein pseudogene, the 5' end of a variant of the
             MAGED1 gene for melanoma antigen, family D, 1 and two CpG
             islands, complete sequence
          Length = 157110

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 541   cgttgctcccggagccggccggga 564
             ||||||| ||||||||||||||||
Sbjct: 40236 cgttgctgccggagccggccggga 40213

---

>emb|AL662824.9| Human DNA sequence from clone XXbac-22I16 on chromosome 6 contains the
             HLA-DPA1 gene for major histocompatibility complex, class
             II, DP alpha 1, the HLA-DPB1 gene for major
             histocompatibility complex, class II, DP beta 1, a
             ribosomal protein L32 (RPL32) pseudogene, the HLA-DPA2
             pseudogene for major histocompatibility complex, class II,
             DP alpha 2, a pseudogene similar to part of collagens, a
             novel protein similar to major histocompatibility complex,
             class II, DP beta 2 (pseudogene), a major
             histocompatibility complex, class II, DP beta 1
             pseudogene, two putative novel transcripts, the COL11A2
             gene for collagen, type XI, alpha 2, the RXRB gene for
             retinoid X receptor, beta, the HKE4 gene for HLA-class II
             region expressed gene KE4, the 5' end of the HSD17B8 gene
             for hydroxysteroid (17-beta) dehydrogenase 8 and four CpG
             islands, complete sequence
          Length = 187964

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 305   tggcaagggcagaggaactt 324
             ||||||||||||||||||||
Sbjct: 38046 tggcaagggcagaggaactt 38027

---

>emb|AL645931.7| Human DNA sequence from clone XXbac-138A21 on chromosome 6 Contains the
             HLA-DOA, HLA-DPA1 and HLA-DPB1 genes for major
             histocompatibility complex class II proteins DO alpha, DP
             alpha 1 and DP beta 1, the HLA-DPA2 major
             histocompatibility complex class II DP alpha 2 pseudogene,
             ribosomal protein L32 pseudogene RPL32P1, a pseudogene
             similar to part of collagens, the 5' end of an HLA class
             II histocompatibility antigen D or S beta pseudogene, the
             5' end of a novel protein similar to major
             histocompatibility complex class II DP beta 1 precursor
             and a CpG island, complete sequence
          Length = 124899

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 305   tggcaagggcagaggaactt 324
             ||||||||||||||||||||
Sbjct: 63756 tggcaagggcagaggaactt 63737

---

>ref|XM_783177.1| PREDICTED: Strongylocentrotus purpuratus similar to tripartite
           motif protein TRIM2 (LOC583257), mRNA
          Length = 1002

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 486 caatcctcgacgaggatgtc 505
           ||||||||||||||||||||
Sbjct: 776 caatcctcgacgaggatgtc 757

---

>gb|AC090496.28| Mus musculus strain C57BL/6J clone rp23-469n6 map 14, complete sequence
          Length = 180338

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 88     ttaggactggcaggaggctt 107
              ||||||||||||||||||||
Sbjct: 173120 ttaggactggcaggaggctt 173101

---

>gb|CP000088.1| Thermobifida fusca YX, complete genome
          Length = 3642249

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 619     ccagcagcaggaggttcatc 638
               ||||||||||||||||||||
Sbjct: 1354502 ccagcagcaggaggttcatc 1354483

---

>gb|BC036077.1| Homo sapiens G1 to S phase transition 2, mRNA (cDNA clone MGC:33729
           IMAGE:5313878), complete cds
          Length = 2513

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 541 cgttgctcccggagccggccggga 564
           ||||||| ||||||||||||||||
Sbjct: 464 cgttgctgccggagccggccggga 441

---

>emb|AJ251548.1|HSA251548 Homo sapiens mRNA for polypeptide chain release factor 3b (GSPT2
           gene)
          Length = 1887

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 541 cgttgctcccggagccggccggga 564
           ||||||| ||||||||||||||||
Sbjct: 268 cgttgctgccggagccggccggga 245

---

>emb|CR759795.4| Human DNA sequence from clone DAMC-206D4 on chromosome 6, complete
             sequence
          Length = 119898

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 305   tggcaagggcagaggaactt 324
             ||||||||||||||||||||
Sbjct: 58192 tggcaagggcagaggaactt 58173

---

>emb|AL133055.1|HSM801326 Homo sapiens mRNA; cDNA DKFZp434J1015 (from clone DKFZp434J1015)
          Length = 1904

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 614 ggcgcccagcagcaggaggt 633
           ||||||||||||||||||||
Sbjct: 236 ggcgcccagcagcaggaggt 255

---

>emb|CR861342.1| Pongo pygmaeus mRNA; cDNA DKFZp459J1511 (from clone DKFZp459J1511)
          Length = 2532

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 541 cgttgctcccggagccggccggga 564
           ||||||| ||||||||||||||||
Sbjct: 482 cgttgctgccggagccggccggga 459

---

>gb|AC087892.16| Homo sapiens 12q BAC RP11-3L23 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 123004

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 38   atacaagaaacaggtgcatt 57
            ||||||||||||||||||||
Sbjct: 2769 atacaagaaacaggtgcatt 2788

---

>gb|AE005819.1| Caulobacter crescentus CB15 section 145 of 359 of the complete
           genome
          Length = 10591

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 513 agcttgtccttggcggcgacccct 536
           ||||||||||||||| ||||||||
Sbjct: 434 agcttgtccttggcgccgacccct 457

---

>gb|AC098615.2| Homo sapiens chromosome 3 clone RP11-268I20, complete sequence
          Length = 167486

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 42     aagaaacaggtgcatttata 61
              ||||||||||||||||||||
Sbjct: 151940 aagaaacaggtgcatttata 151921

---

>dbj|AK023155.1| Homo sapiens cDNA FLJ13093 fis, clone NT2RP3002151, highly similar
           to G1 TO S PHASE TRANSITION PROTEIN 1 HOMOLOG
          Length = 2492

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 541 cgttgctcccggagccggccggga 564
           ||||||| ||||||||||||||||
Sbjct: 454 cgttgctgccggagccggccggga 431

---

>dbj|AK001303.1| Homo sapiens cDNA FLJ10441 fis, clone NT2RP1000733, highly similar
           to Human mRNA for GSPT1-TK protein
          Length = 2481

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 541 cgttgctcccggagccggccggga 564
           ||||||| ||||||||||||||||
Sbjct: 448 cgttgctgccggagccggccggga 425

---

>gb|CP000133.1| Rhizobium etli CFN 42, complete genome
          Length = 4381608

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 490     cctcgacgaggatgtcgttgccga 513
               ||||||||| ||||||||||||||
Sbjct: 2955444 cctcgacgatgatgtcgttgccga 2955467

---

>ref|XM_498167.2| PREDICTED: Homo sapiens hypothetical protein DKFZp434J1015
           (DKFZp434J1015), mRNA
          Length = 4839

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 614 ggcgcccagcagcaggaggt 633
           ||||||||||||||||||||
Sbjct: 85  ggcgcccagcagcaggaggt 104

---

>gb|AC073343.6| Homo sapiens BAC clone RP11-611L7 from 7, complete sequence
          Length = 173967

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 614  ggcgcccagcagcaggaggt 633
            ||||||||||||||||||||
Sbjct: 7411 ggcgcccagcagcaggaggt 7430

---

>gb|AC157941.4| Mus musculus BAC clone RP24-253I2 from chromosome 3, complete sequence
          Length = 204323

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 633   ttcatcagctccctcttgctcatg 656
             ||||| ||||||||||||||||||
Sbjct: 34511 ttcataagctccctcttgctcatg 34488

---

>gb|AF336983.1|AF336983 Vaucheria litorea cytochrome b6f complex Rieske FeS protein mRNA,
           partial cds; nuclear gene for chloroplast product
          Length = 222

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 293 tactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348
           ||||| || ||||||||||| |||| ||||||||| || ||   ||||||||||||
Sbjct: 128 tactgcgacccatggcaaggacagatgaacttgttttcagccttgttccaaggcac 73

---

>emb|AL606597.4|OSJN00042 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0045P24,
              complete sequence
          Length = 124420

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 3      tttctcttctttntagactgtat 25
              |||||||||||| ||||||||||
Sbjct: 103410 tttctcttctttttagactgtat 103388

---

>gb|AC012451.8| Homo sapiens BAC clone RP11-414K19 from 2, complete sequence
          Length = 188121

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 306    ggcaagggcagaggaacttg 325
              ||||||||||||||||||||
Sbjct: 179433 ggcaagggcagaggaacttg 179452

---

>gb|AC055858.18| Homo sapiens chromosome 17, clone RP11-682M7, complete sequence
          Length = 167395

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 637   tcagctccctcttgctcatg 656
             ||||||||||||||||||||
Sbjct: 64929 tcagctccctcttgctcatg 64910

---

>gb|AF203698.1|AF203698 Rattus norvegicus T calcium channel alpha1G subunit (Cacna1g) gene,
            partial cds
          Length = 4171

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 427  aggatcacccttgagcccctgggc 450
            ||||||||||||||||| ||||||
Sbjct: 3868 aggatcacccttgagcctctgggc 3845


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,261,825
Number of Sequences: 3902068
Number of extensions: 4261825
Number of successful extensions: 72292
Number of sequences better than 10.0: 117
Number of HSP's better than 10.0 without gapping: 118
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 71565
Number of HSP's gapped (non-prelim): 679
length of query: 676
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 653
effective length of database: 17,143,297,704
effective search space: 11194573400712
effective search space used: 11194573400712
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---