| Clone Name | rbaal22a16 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AK102721.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033105G07, full insert sequence Length = 914 Score = 444 bits (224), Expect = e-121 Identities = 317/347 (91%), Gaps = 1/347 (0%) Strand = Plus / Minus Query: 211 cttgggccctgagcaagcctctcctccctcctggcaatctttctttcacggcttgccttg 270 |||||||||||||| | |||||||||||||||||||||||| || ||||||||||||||| Sbjct: 649 cttgggccctgagccaacctctcctccctcctggcaatcttcctctcacggcttgccttg 590 Query: 271 ctcttggcacgcttagcctcaaactggtcagagagcgtcttctctctagccttctcagcc 330 ||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| Sbjct: 589 ctcttggcacgcttagcctcaaactggtcagagagtgtcttctctcttgccttctcagcc 530 Query: 331 tttgacttgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgacc 390 || |||||||| || ||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 529 ttagacttgtggatactttccataagaacacgcttgttcttgaacatgttacccttgacc 470 Query: 391 ttcaagtacatgtcatggtacatgtgcttgtcgatcttctttgcttcacggtacttgcgg 450 |||| |||||||||||| |||||||||||||| |||||||| || ||||| |||||||| Sbjct: 469 ttcatgtacatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcgc 410 Query: 451 agcaggcgtctgagcacgcgcatcctcctcatccacagaatcttggtgggaagcctagcc 510 |||| || |||||||| |||||||||||||||||||| ||||||||||| ||||||||| Sbjct: 409 agcaaacgcctgagcacacgcatcctcctcatccacaggatcttggtggggagcctagcc 350 Query: 511 tnccttgt-cccctgcgcttaccatatccagaatggcggcccttctg 556 | |||||| ||||| ||||||||||| ||||| || || |||||||| Sbjct: 349 tcccttgtacccctacgcttaccatagccagagtgacgtcccttctg 303 Score = 73.8 bits (37), Expect = 5e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 152 ttcacttctttgacttctttggtgccgctgcaggttgagcaggagctgc 200 |||||||||||| |||||| ||||||||||||| ||||||||||||||| Sbjct: 720 ttcacttctttgccttcttaggtgccgctgcagtttgagcaggagctgc 672
>dbj|AK059309.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-025-G06, full insert sequence Length = 1121 Score = 444 bits (224), Expect = e-121 Identities = 317/347 (91%), Gaps = 1/347 (0%) Strand = Plus / Minus Query: 211 cttgggccctgagcaagcctctcctccctcctggcaatctttctttcacggcttgccttg 270 |||||||||||||| | |||||||||||||||||||||||| || ||||||||||||||| Sbjct: 650 cttgggccctgagccaacctctcctccctcctggcaatcttcctctcacggcttgccttg 591 Query: 271 ctcttggcacgcttagcctcaaactggtcagagagcgtcttctctctagccttctcagcc 330 ||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| Sbjct: 590 ctcttggcacgcttagcctcaaactggtcagagagtgtcttctctcttgccttctcagcc 531 Query: 331 tttgacttgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgacc 390 || |||||||| || ||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 530 ttagacttgtggatactttccataagaacacgcttgttcttgaacatgttacccttgacc 471 Query: 391 ttcaagtacatgtcatggtacatgtgcttgtcgatcttctttgcttcacggtacttgcgg 450 |||| |||||||||||| |||||||||||||| |||||||| || ||||| |||||||| Sbjct: 470 ttcatgtacatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcgc 411 Query: 451 agcaggcgtctgagcacgcgcatcctcctcatccacagaatcttggtgggaagcctagcc 510 |||| || |||||||| |||||||||||||||||||| ||||||||||| ||||||||| Sbjct: 410 agcaaacgcctgagcacacgcatcctcctcatccacaggatcttggtggggagcctagcc 351 Query: 511 tnccttgt-cccctgcgcttaccatatccagaatggcggcccttctg 556 | |||||| ||||| ||||||||||| ||||| || || |||||||| Sbjct: 350 tcccttgtacccctacgcttaccatagccagagtgacgtcccttctg 304 Score = 73.8 bits (37), Expect = 5e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 152 ttcacttctttgacttctttggtgccgctgcaggttgagcaggagctgc 200 |||||||||||| |||||| ||||||||||||| ||||||||||||||| Sbjct: 721 ttcacttctttgccttcttaggtgccgctgcagtttgagcaggagctgc 673
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 414 bits (209), Expect = e-112 Identities = 290/316 (91%), Gaps = 1/316 (0%) Strand = Plus / Plus Query: 218 cctgagcaagcctctcctccctcctggcaatctttctttcacggcttgccttgctcttgg 277 ||||||| | |||||||||||||||||||||||| || |||||||||||||||||||||| Sbjct: 12517448 cctgagccaacctctcctccctcctggcaatcttcctctcacggcttgccttgctcttgg 12517507 Query: 278 cacgcttagcctcaaactggtcagagagcgtcttctctctagccttctcagcctttgact 337 |||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |||| Sbjct: 12517508 cacgcttagcctcaaactggtcagagagtgtcttctctcttgccttctcagccttagact 12517567 Query: 338 tgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgaccttcaagt 397 |||| || ||||||||||| ||||||||||||||||||||||||||||||||||||| || Sbjct: 12517568 tgtggatactttccataagaacacgcttgttcttgaacatgttacccttgaccttcatgt 12517627 Query: 398 acatgtcatggtacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggc 457 |||||||||| |||||||||||||| |||||||| || ||||| |||||||| |||| | Sbjct: 12517628 acatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcgcagcaaac 12517687 Query: 458 gtctgagcacgcgcatcctcctcatccacagaatcttggtgggaagcctagcctnccttg 517 | |||||||| |||||||||||||||||||| ||||||||||| |||||||||| ||||| Sbjct: 12517688 gcctgagcacacgcatcctcctcatccacaggatcttggtggggagcctagcctcccttg 12517747 Query: 518 t-cccctgcgcttacc 532 | ||||| |||||||| Sbjct: 12517748 tacccctacgcttacc 12517763 Score = 359 bits (181), Expect = 6e-96 Identities = 283/316 (89%), Gaps = 1/316 (0%) Strand = Plus / Plus Query: 218 cctgagcaagcctctcctccctcctggcaatctttctttcacggcttgccttgctcttgg 277 ||||||| | |||||| || | |||||||||||| || ||||| || ||||||||||||| Sbjct: 21047190 cctgagccaacctctcgtcacgcctggcaatcttcctctcacgactggccttgctcttgg 21047249 Query: 278 cacgcttagcctcaaactggtcagagagcgtcttctctctagccttctcagcctttgact 337 |||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |||| Sbjct: 21047250 cacgcttagcctcaaactggtcagagagtgtcttctctcttgccttctcagccttagact 21047309 Query: 338 tgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgaccttcaagt 397 |||| || |||||||| || ||||||||||||||||||||||||||||||||||||| || Sbjct: 21047310 tgtggatactttccatgagaacacgcttgttcttgaacatgttacccttgaccttcatgt 21047369 Query: 398 acatgtcatggtacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggc 457 |||||||||| |||||||||||||| |||||||| || ||||| |||||||| |||| | Sbjct: 21047370 acatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcgcagcaaac 21047429 Query: 458 gtctgagcacgcgcatcctcctcatccacagaatcttggtgggaagcctagcctnccttg 517 | |||||||| |||||||||||||||||||| ||||||||||| |||||||||| ||| | Sbjct: 21047430 gcctgagcacacgcatcctcctcatccacaggatcttggtggggagcctagcctccctgg 21047489 Query: 518 t-cccctgcgcttacc 532 | ||||| |||||||| Sbjct: 21047490 tacccctacgcttacc 21047505 Score = 40.1 bits (20), Expect = 7.6 Identities = 29/32 (90%) Strand = Plus / Plus Query: 146 cagatcttcacttctttgacttctttggtgcc 177 ||||| |||||||||| |||||||||||||| Sbjct: 21046731 cagatgttcacttcttatacttctttggtgcc 21046762 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 177 cgctgcaggttgagcaggagctgc 200 |||||||| ||||||||||||||| Sbjct: 12517154 cgctgcagtttgagcaggagctgc 12517177
>gb|AC134885.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OJ1125B03, from chromosome 3, complete sequence Length = 124550 Score = 414 bits (209), Expect = e-112 Identities = 290/316 (91%), Gaps = 1/316 (0%) Strand = Plus / Minus Query: 218 cctgagcaagcctctcctccctcctggcaatctttctttcacggcttgccttgctcttgg 277 ||||||| | |||||||||||||||||||||||| || |||||||||||||||||||||| Sbjct: 70493 cctgagccaacctctcctccctcctggcaatcttcctctcacggcttgccttgctcttgg 70434 Query: 278 cacgcttagcctcaaactggtcagagagcgtcttctctctagccttctcagcctttgact 337 |||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |||| Sbjct: 70433 cacgcttagcctcaaactggtcagagagtgtcttctctcttgccttctcagccttagact 70374 Query: 338 tgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgaccttcaagt 397 |||| || ||||||||||| ||||||||||||||||||||||||||||||||||||| || Sbjct: 70373 tgtggatactttccataagaacacgcttgttcttgaacatgttacccttgaccttcatgt 70314 Query: 398 acatgtcatggtacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggc 457 |||||||||| |||||||||||||| |||||||| || ||||| |||||||| |||| | Sbjct: 70313 acatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcgcagcaaac 70254 Query: 458 gtctgagcacgcgcatcctcctcatccacagaatcttggtgggaagcctagcctnccttg 517 | |||||||| |||||||||||||||||||| ||||||||||| |||||||||| ||||| Sbjct: 70253 gcctgagcacacgcatcctcctcatccacaggatcttggtggggagcctagcctcccttg 70194 Query: 518 t-cccctgcgcttacc 532 | ||||| |||||||| Sbjct: 70193 tacccctacgcttacc 70178 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 177 cgctgcaggttgagcaggagctgc 200 |||||||| ||||||||||||||| Sbjct: 70787 cgctgcagtttgagcaggagctgc 70764
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 414 bits (209), Expect = e-112 Identities = 290/316 (91%), Gaps = 1/316 (0%) Strand = Plus / Plus Query: 218 cctgagcaagcctctcctccctcctggcaatctttctttcacggcttgccttgctcttgg 277 ||||||| | |||||||||||||||||||||||| || |||||||||||||||||||||| Sbjct: 12514211 cctgagccaacctctcctccctcctggcaatcttcctctcacggcttgccttgctcttgg 12514270 Query: 278 cacgcttagcctcaaactggtcagagagcgtcttctctctagccttctcagcctttgact 337 |||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |||| Sbjct: 12514271 cacgcttagcctcaaactggtcagagagtgtcttctctcttgccttctcagccttagact 12514330 Query: 338 tgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgaccttcaagt 397 |||| || ||||||||||| ||||||||||||||||||||||||||||||||||||| || Sbjct: 12514331 tgtggatactttccataagaacacgcttgttcttgaacatgttacccttgaccttcatgt 12514390 Query: 398 acatgtcatggtacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggc 457 |||||||||| |||||||||||||| |||||||| || ||||| |||||||| |||| | Sbjct: 12514391 acatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcgcagcaaac 12514450 Query: 458 gtctgagcacgcgcatcctcctcatccacagaatcttggtgggaagcctagcctnccttg 517 | |||||||| |||||||||||||||||||| ||||||||||| |||||||||| ||||| Sbjct: 12514451 gcctgagcacacgcatcctcctcatccacaggatcttggtggggagcctagcctcccttg 12514510 Query: 518 t-cccctgcgcttacc 532 | ||||| |||||||| Sbjct: 12514511 tacccctacgcttacc 12514526 Score = 359 bits (181), Expect = 6e-96 Identities = 283/316 (89%), Gaps = 1/316 (0%) Strand = Plus / Plus Query: 218 cctgagcaagcctctcctccctcctggcaatctttctttcacggcttgccttgctcttgg 277 ||||||| | |||||| || | |||||||||||| || ||||| || ||||||||||||| Sbjct: 21040219 cctgagccaacctctcgtcacgcctggcaatcttcctctcacgactggccttgctcttgg 21040278 Query: 278 cacgcttagcctcaaactggtcagagagcgtcttctctctagccttctcagcctttgact 337 |||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |||| Sbjct: 21040279 cacgcttagcctcaaactggtcagagagtgtcttctctcttgccttctcagccttagact 21040338 Query: 338 tgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgaccttcaagt 397 |||| || |||||||| || ||||||||||||||||||||||||||||||||||||| || Sbjct: 21040339 tgtggatactttccatgagaacacgcttgttcttgaacatgttacccttgaccttcatgt 21040398 Query: 398 acatgtcatggtacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggc 457 |||||||||| |||||||||||||| |||||||| || ||||| |||||||| |||| | Sbjct: 21040399 acatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcgcagcaaac 21040458 Query: 458 gtctgagcacgcgcatcctcctcatccacagaatcttggtgggaagcctagcctnccttg 517 | |||||||| |||||||||||||||||||| ||||||||||| |||||||||| ||| | Sbjct: 21040459 gcctgagcacacgcatcctcctcatccacaggatcttggtggggagcctagcctccctgg 21040518 Query: 518 t-cccctgcgcttacc 532 | ||||| |||||||| Sbjct: 21040519 tacccctacgcttacc 21040534 Score = 40.1 bits (20), Expect = 7.6 Identities = 29/32 (90%) Strand = Plus / Plus Query: 146 cagatcttcacttctttgacttctttggtgcc 177 ||||| |||||||||| |||||||||||||| Sbjct: 21039760 cagatgttcacttcttatacttctttggtgcc 21039791 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 177 cgctgcaggttgagcaggagctgc 200 |||||||| ||||||||||||||| Sbjct: 12513917 cgctgcagtttgagcaggagctgc 12513940
>gb|AY103679.1| Zea mays PCO152526 mRNA sequence Length = 1051 Score = 391 bits (197), Expect = e-105 Identities = 299/332 (90%), Gaps = 1/332 (0%) Strand = Plus / Minus Query: 211 cttgggccctgagcaagcctctcctccctcctggcaatctttctttcacggcttgccttg 270 ||||||||||| || ||||||||||||||||| |||||||| || ||||||||||||||| Sbjct: 635 cttgggccctgggccagcctctcctccctcctagcaatcttcctctcacggcttgccttg 576 Query: 271 ctcttggcacgcttagcctcaaactggtcagagagcgtcttctctctagccttctcagcc 330 ||||| |||||||| ||||||||||| ||||| || ||||||||||| |||||||||||| Sbjct: 575 ctctttgcacgcttggcctcaaactgatcagaaagtgtcttctctctggccttctcagcc 516 Query: 331 tttgacttgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgacc 390 || |||||||| || || ||||||||||| | ||||||||| ||||| |||||||||||| Sbjct: 515 ttggacttgtggatactctccataagcaccctcttgttcttaaacatattacccttgacc 456 Query: 391 ttcaagtacatgtcatggtacatgtgcttgtcgatcttctttgcttcacggtacttgcgg 450 |||| |||||||||||| ||||||||||||||||||||||| || ||||||||||||||| Sbjct: 455 ttcatgtacatgtcatgatacatgtgcttgtcgatcttcttggcctcacggtacttgcgg 396 Query: 451 agcaggcgtctgagcacgcgcatcctcctcatccacagaatcttggtgggaagcctagcc 510 |||||||| || || || |||||||||||||||||||||||||||||||| ||||||||| Sbjct: 395 agcaggcgcctcagaacacgcatcctcctcatccacagaatcttggtggggagcctagcc 336 Query: 511 tnccttgt-cccctgcgcttaccatatccaga 541 | ||| || ||||||||||| || |||||||| Sbjct: 335 tccctggtacccctgcgcttgccgtatccaga 304
>gb|AF542969.2| Triticum aestivum ribosomal protein L19 mRNA, complete cds Length = 854 Score = 377 bits (190), Expect = e-101 Identities = 295/329 (89%), Gaps = 1/329 (0%) Strand = Plus / Minus Query: 229 ctctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcc 288 ||||||||||||||||||||||| || || | |||||||||||||||||| ||||| ||| Sbjct: 555 ctctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcgcgcttggcc 496 Query: 289 tcaaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctt 348 ||||||||||||||||| ||||||||||| |||||||||||||| |||||||| || || Sbjct: 495 tcaaactggtcagagagggtcttctctcttgccttctcagccttggacttgtggatactc 436 Query: 349 tccataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatgg 408 ||||| || || | ||||||||||||||||||||| |||||||||| ||||||||||||| Sbjct: 435 tccatgaggaccctcttgttcttgaacatgttacctttgaccttcaggtacatgtcatgg 376 Query: 409 tacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcacg 468 ||||||||||||||||||||||| || |||||||||||||| || ||||| || || ||| Sbjct: 375 tacatgtgcttgtcgatcttcttggcctcacggtacttgcgcagaaggcgcctcaggacg 316 Query: 469 cgcatcctcctcatccacagaatcttggtgggaagcctagcctnccttgt-cccctgcgc 527 |||||||||| ||||||||| ||||||||||| |||||||||| ||| || ||||| ||| Sbjct: 315 cgcatcctccgcatccacaggatcttggtggggagcctagcctccctggtacccctacgc 256 Query: 528 ttaccatatccagaatggcggcccttctg 556 |||||||||||||| || ||||||||||| Sbjct: 255 ttaccatatccagagtgacggcccttctg 227 Score = 48.1 bits (24), Expect = 0.031 Identities = 33/36 (91%) Strand = Plus / Minus Query: 144 gtcagatcttcacttctttgacttctttggtgccgc 179 |||||| ||||||||||| | ||||||||||||||| Sbjct: 647 gtcagaacttcacttcttggccttctttggtgccgc 612
>gb|BT016919.1| Zea mays clone E04912701B11.c mRNA sequence Length = 974 Score = 365 bits (184), Expect = 1e-97 Identities = 295/331 (89%), Gaps = 1/331 (0%) Strand = Plus / Plus Query: 212 ttgggccctgagcaagcctctcctccctcctggcaatctttctttcacggcttgccttgc 271 |||||||||| || ||||| ||||||||||| | |||||| ||||||||| ||||||||| Sbjct: 327 ttgggccctgggccagcctttcctccctcctagaaatcttcctttcacgggttgccttgc 386 Query: 272 tcttggcacgcttagcctcaaactggtcagagagcgtcttctctctagccttctcagcct 331 |||| |||||||| ||||||||||| ||| | || ||||||||||| ||||||||||||| Sbjct: 387 tctttgcacgcttggcctcaaactgatcaaaaagtgtcttctctctggccttctcagcct 446 Query: 332 ttgacttgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgacct 391 | |||||||| || || ||||||||||| | ||||||||| ||||| ||||||||||||| Sbjct: 447 tggacttgtggatactctccataagcaccctcttgttcttaaacatattacccttgacct 506 Query: 392 tcaagtacatgtcatggtacatgtgcttgtcgatcttctttgcttcacggtacttgcgga 451 ||| |||||||||||| |||||||||||| |||||||||| || |||||||||||||||| Sbjct: 507 tcatgtacatgtcatgatacatgtgcttggcgatcttcttggcctcacggtacttgcgga 566 Query: 452 gcaggcgtctgagcacgcgcatcctcctcatccacagaatcttggtgggaagcctagcct 511 ||||||| || || || |||||||||||||||||||||||||||||||| |||||||||| Sbjct: 567 gcaggcgcctcagaacacgcatcctcctcatccacagaatcttggtggggagcctagcct 626 Query: 512 nccttgt-cccctgcgcttaccatatccaga 541 ||| || ||||||||||| ||||||||||| Sbjct: 627 ccctggtacccctgcgcttgccatatccaga 657
>gb|AC147962.1| Oryza sativa chromosome 3 BAC OSJNBa0083K01 genomic sequence, complete sequence Length = 167239 Score = 359 bits (181), Expect = 6e-96 Identities = 283/316 (89%), Gaps = 1/316 (0%) Strand = Plus / Minus Query: 218 cctgagcaagcctctcctccctcctggcaatctttctttcacggcttgccttgctcttgg 277 ||||||| | |||||| || | |||||||||||| || ||||| || ||||||||||||| Sbjct: 38088 cctgagccaacctctcgtcacgcctggcaatcttcctctcacgactggccttgctcttgg 38029 Query: 278 cacgcttagcctcaaactggtcagagagcgtcttctctctagccttctcagcctttgact 337 |||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |||| Sbjct: 38028 cacgcttagcctcaaactggtcagagagtgtcttctctcttgccttctcagccttagact 37969 Query: 338 tgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgaccttcaagt 397 |||| || |||||||| || ||||||||||||||||||||||||||||||||||||| || Sbjct: 37968 tgtggatactttccatgagaacacgcttgttcttgaacatgttacccttgaccttcatgt 37909 Query: 398 acatgtcatggtacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggc 457 |||||||||| |||||||||||||| |||||||| || ||||| |||||||| |||| | Sbjct: 37908 acatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcgcagcaaac 37849 Query: 458 gtctgagcacgcgcatcctcctcatccacagaatcttggtgggaagcctagcctnccttg 517 | |||||||| |||||||||||||||||||| ||||||||||| |||||||||| ||| | Sbjct: 37848 gcctgagcacacgcatcctcctcatccacaggatcttggtggggagcctagcctccctgg 37789 Query: 518 t-cccctgcgcttacc 532 | ||||| |||||||| Sbjct: 37788 tacccctacgcttacc 37773 Score = 40.1 bits (20), Expect = 7.6 Identities = 29/32 (90%) Strand = Plus / Minus Query: 146 cagatcttcacttctttgacttctttggtgcc 177 ||||| |||||||||| |||||||||||||| Sbjct: 38547 cagatgttcacttcttatacttctttggtgcc 38516
>gb|AC128645.5| Oryza sativa chromosome 3 BAC OSJNBb0016P23 genomic sequence, complete sequence Length = 131250 Score = 359 bits (181), Expect = 6e-96 Identities = 283/316 (89%), Gaps = 1/316 (0%) Strand = Plus / Plus Query: 218 cctgagcaagcctctcctccctcctggcaatctttctttcacggcttgccttgctcttgg 277 ||||||| | |||||| || | |||||||||||| || ||||| || ||||||||||||| Sbjct: 24946 cctgagccaacctctcgtcacgcctggcaatcttcctctcacgactggccttgctcttgg 25005 Query: 278 cacgcttagcctcaaactggtcagagagcgtcttctctctagccttctcagcctttgact 337 |||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |||| Sbjct: 25006 cacgcttagcctcaaactggtcagagagtgtcttctctcttgccttctcagccttagact 25065 Query: 338 tgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgaccttcaagt 397 |||| || |||||||| || ||||||||||||||||||||||||||||||||||||| || Sbjct: 25066 tgtggatactttccatgagaacacgcttgttcttgaacatgttacccttgaccttcatgt 25125 Query: 398 acatgtcatggtacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggc 457 |||||||||| |||||||||||||| |||||||| || ||||| |||||||| |||| | Sbjct: 25126 acatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcgcagcaaac 25185 Query: 458 gtctgagcacgcgcatcctcctcatccacagaatcttggtgggaagcctagcctnccttg 517 | |||||||| |||||||||||||||||||| ||||||||||| |||||||||| ||| | Sbjct: 25186 gcctgagcacacgcatcctcctcatccacaggatcttggtggggagcctagcctccctgg 25245 Query: 518 t-cccctgcgcttacc 532 | ||||| |||||||| Sbjct: 25246 tacccctacgcttacc 25261 Score = 40.1 bits (20), Expect = 7.6 Identities = 29/32 (90%) Strand = Plus / Plus Query: 146 cagatcttcacttctttgacttctttggtgcc 177 ||||| |||||||||| |||||||||||||| Sbjct: 24487 cagatgttcacttcttatacttctttggtgcc 24518
>gb|BT019233.1| Zea mays clone Contig906.F mRNA sequence Length = 1470 Score = 333 bits (168), Expect = 4e-88 Identities = 288/327 (88%), Gaps = 1/327 (0%) Strand = Plus / Plus Query: 228 cctctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagc 287 ||||||||||||||| || ||||| || |||||||| |||||||||||||| ||||| || Sbjct: 289 cctctcctccctcctagcgatcttcctctcacggctcgccttgctcttggcgcgcttggc 348 Query: 288 ctcaaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgct 347 ||||||||||||||| || ||||||||||| |||||||||||||| |||||||| || || Sbjct: 349 ctcaaactggtcagaaagtgtcttctctctggccttctcagccttggacttgtggatact 408 Query: 348 ttccataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatg 407 ||||||||||| | |||||||||||| |||||| |||||||||| |||||||||||| Sbjct: 409 ctccataagcaccctcttgttcttgaaggcgttacctttgaccttcatgtacatgtcatg 468 Query: 408 gtacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcac 467 |||||||||||||| |||||||| || ||||| ||||||||||| ||||| || ||||| Sbjct: 469 atacatgtgcttgtcaatcttcttggcctcacgatacttgcggagaaggcgcctcagcac 528 Query: 468 gcgcatcctcctcatccacagaatcttggtgggaagcctagcctnccttgt-cccctgcg 526 |||||||||||||||||||||| ||||||||| |||||||||| ||| || ||||| || Sbjct: 529 acgcatcctcctcatccacagaaccttggtgggtagcctagcctccctggtacccctacg 588 Query: 527 cttaccatatccagaatggcggccctt 553 |||||||||||| || ||||| ||||| Sbjct: 589 cttaccatatcctgagtggcgtccctt 615
>gb|BT016537.1| Zea mays clone Contig370 mRNA sequence Length = 956 Score = 333 bits (168), Expect = 4e-88 Identities = 288/327 (88%), Gaps = 1/327 (0%) Strand = Plus / Minus Query: 228 cctctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagc 287 ||||||||||||||| || ||||| || |||||||| |||||||||||||| ||||| || Sbjct: 727 cctctcctccctcctagcgatcttcctctcacggctcgccttgctcttggcgcgcttggc 668 Query: 288 ctcaaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgct 347 ||||||||||||||| || ||||||||||| |||||||||||||| |||||||| || || Sbjct: 667 ctcaaactggtcagaaagtgtcttctctctggccttctcagccttggacttgtggatact 608 Query: 348 ttccataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatg 407 ||||||||||| | |||||||||||| |||||| |||||||||| |||||||||||| Sbjct: 607 ctccataagcaccctcttgttcttgaaggcgttacctttgaccttcatgtacatgtcatg 548 Query: 408 gtacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcac 467 |||||||||||||| |||||||| || ||||| ||||||||||| ||||| || ||||| Sbjct: 547 atacatgtgcttgtcaatcttcttggcctcacgatacttgcggagaaggcgcctcagcac 488 Query: 468 gcgcatcctcctcatccacagaatcttggtgggaagcctagcctnccttgt-cccctgcg 526 |||||||||||||||||||||| ||||||||| |||||||||| ||| || ||||| || Sbjct: 487 acgcatcctcctcatccacagaaccttggtgggtagcctagcctccctggtacccctacg 428 Query: 527 cttaccatatccagaatggcggccctt 553 |||||||||||| || ||||| ||||| Sbjct: 427 cttaccatatcctgagtggcgtccctt 401
>gb|AY103638.1| Zea mays PCO153348 mRNA sequence Length = 1258 Score = 333 bits (168), Expect = 4e-88 Identities = 288/327 (88%), Gaps = 1/327 (0%) Strand = Plus / Minus Query: 228 cctctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagc 287 ||||||||||||||| || ||||| || |||||||| |||||||||||||| ||||| || Sbjct: 922 cctctcctccctcctagcgatcttcctctcacggctcgccttgctcttggcgcgcttggc 863 Query: 288 ctcaaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgct 347 ||||||||||||||| || ||||||||||| |||||||||||||| |||||||| || || Sbjct: 862 ctcaaactggtcagaaagtgtcttctctctggccttctcagccttggacttgtggatact 803 Query: 348 ttccataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatg 407 ||||||||||| | |||||||||||| |||||| |||||||||| |||||||||||| Sbjct: 802 ctccataagcaccctcttgttcttgaaggcgttacctttgaccttcatgtacatgtcatg 743 Query: 408 gtacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcac 467 |||||||||||||| |||||||| || ||||| ||||||||||| ||||| || ||||| Sbjct: 742 atacatgtgcttgtcaatcttcttggcctcacgatacttgcggagaaggcgcctcagcac 683 Query: 468 gcgcatcctcctcatccacagaatcttggtgggaagcctagcctnccttgt-cccctgcg 526 |||||||||||||||||||||| ||||||||| |||||||||| ||| || ||||| || Sbjct: 682 acgcatcctcctcatccacagaaccttggtgggtagcctagcctccctggtacccctacg 623 Query: 527 cttaccatatccagaatggcggccctt 553 |||||||||||| || ||||| ||||| Sbjct: 622 cttaccatatcctgagtggcgtccctt 596
>gb|BT016443.1| Zea mays clone Contig276 mRNA sequence Length = 779 Score = 309 bits (156), Expect = 5e-81 Identities = 300/347 (86%), Gaps = 1/347 (0%) Strand = Plus / Minus Query: 211 cttgggccctgagcaagcctctcctccctcctggcaatctttctttcacggcttgccttg 270 ||||||||||| || |||||||| |||||||| ||| |||| || || || || |||||| Sbjct: 589 cttgggccctgggccagcctctcttccctcctagcattcttcctctcgcgactcgccttg 530 Query: 271 ctcttggcacgcttagcctcaaactggtcagagagcgtcttctctctagccttctcagcc 330 |||||||| ||| | ||||| ||||| || |||||||||||||| || |||||||||||| Sbjct: 529 ctcttggcgcgcctggcctcgaactgatcggagagcgtcttctccctggccttctcagcc 470 Query: 331 tttgacttgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgacc 390 || |||||||| ||||| ||||||||||| | ||||||||||||| |||||| |||||| Sbjct: 469 ttggacttgtggatgctctccataagcaccctcttgttcttgaacgagttacctttgacc 410 Query: 391 ttcaagtacatgtcatggtacatgtgcttgtcgatcttctttgcttcacggtacttgcgg 450 |||| |||||| || |||||||||||||||||||||||||| || || |||||||||||| Sbjct: 409 ttcatgtacatatcgtggtacatgtgcttgtcgatcttcttggcctcgcggtacttgcgg 350 Query: 451 agcaggcgtctgagcacgcgcatcctcctcatccacagaatcttggtgggaagcctagcc 510 |||||||| || |||||||||||||||||||||||||| | ||||||||| ||||||||| Sbjct: 349 agcaggcgcctcagcacgcgcatcctcctcatccacagtaccttggtggggagcctagcc 290 Query: 511 tnccttgt-cccctgcgcttaccatatccagaatggcggcccttctg 556 | ||| || || || ||||| |||||||| || || || |||||||| Sbjct: 289 tccctggtacctctacgcttcccatatcctgagtgccgtcccttctg 243
>gb|AY104244.1| Zea mays PCO075323 mRNA sequence Length = 924 Score = 262 bits (132), Expect = 1e-66 Identities = 285/335 (85%), Gaps = 1/335 (0%) Strand = Plus / Minus Query: 208 tcccttgggccctgagcaagcctctcctccctcctggcaatctttctttcacggcttgcc 267 ||||||||||||||||| | |||||||||||||| ||||||||||| |||||| ||| Sbjct: 632 tcccttgggccctgagccaatctctcctccctccttgcaatctttctctcacgggaagcc 573 Query: 268 ttgctcttggcacgcttagcctcaaactggtcagagagcgtcttctctctagccttctca 327 ||||||||||| ||||| ||||||||||| || ||||| ||||||||||| |||||||| Sbjct: 572 ttgctcttggctcgcttggcctcaaactgatccgagagagtcttctctctggccttctcg 513 Query: 328 gcctttgacttgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttg 387 |||||||||||||| ||||| ||||| || || | ||| || || |||||||| || || Sbjct: 512 gcctttgacttgtggatgctctccatgagtaccctcttatttttaaacatgtttcctttt 453 Query: 388 accttcaagtacatgtcatggtacatgtgcttgtcgatcttctttgcttcacggtacttg 447 || |||| ||||| || ||||||||||| |||||||| |||||||||||||| |||||| Sbjct: 452 actttcatatacatatcgtggtacatgtgtttgtcgattttctttgcttcacgatacttg 393 Query: 448 cggagcaggcgtctgagcacgcgcatcctcctcatccacagaatcttggtgggaagccta 507 || ||||| || ||||| || |||||||| | |||||| || ||||||||||| |||||| Sbjct: 392 cgcagcagacgcctgaggacacgcatcctgcgcatccaaaggatcttggtggggagccta 333 Query: 508 gcctnccttgt-cccctgcgcttaccatatccaga 541 |||| ||| || |||||||||||||| || ||||| Sbjct: 332 gcctccctggtacccctgcgcttaccgtaaccaga 298 Score = 40.1 bits (20), Expect = 7.6 Identities = 29/32 (90%) Strand = Plus / Minus Query: 152 ttcacttctttgacttctttggtgccgctgca 183 |||||||||| | |||||||||||| |||||| Sbjct: 700 ttcacttcttcgccttctttggtgcagctgca 669
>gb|AY489023.1| Capsicum annuum ribosomal protein L19 mRNA, complete sequence Length = 719 Score = 226 bits (114), Expect = 6e-56 Identities = 273/325 (84%), Gaps = 1/325 (0%) Strand = Plus / Minus Query: 231 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 290 |||||||| ||| || | ||| ||||| |||||||||||| |||| || | | ||||||| Sbjct: 550 ctcctcccgcctagcgaacttcctttctcggcttgccttgttctttgctctcctagcctc 491 Query: 291 aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 350 ||| ||||| || | |||||||||||||||||||||||||||| |||||| || |||| Sbjct: 490 aaattggtcggacaaggtcttctctctagccttctcagcctttgtcttgtggatattttc 431 Query: 351 cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 410 ||| |||||||||||||||||||| | |||||||| ||||||| |||||||||||| || Sbjct: 430 catcagcacacgcttgttcttgaagacattacccttcaccttcatgtacatgtcatgata 371 Query: 411 catgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcacgcg 470 ||||||||||||||||||||||| ||| | ||||||||| |||| || ||||| || | Sbjct: 370 catgtgcttgtcgatcttctttgattccctgtacttgcgaagcaaacgcctgaggactct 311 Query: 471 catcctcctcatccacagaatcttggtgggaagcctagcctnccttgt-cccctgcgctt 529 ||| ||||||||||| || | |||||| || || ||||||| ||| || || ||||||| Sbjct: 310 cattctcctcatccaaagcaccttggtaggcagtctagcctccctggtacctttgcgctt 251 Query: 530 accatatccagaatggcggcccttc 554 ||| |||||||| || ||||||||| Sbjct: 250 accgtatccagagtgacggcccttc 226
>gb|AY485789.1| Capsicum annuum 60S ribosomal protein L19 mRNA, complete cds Length = 831 Score = 226 bits (114), Expect = 6e-56 Identities = 273/325 (84%), Gaps = 1/325 (0%) Strand = Plus / Minus Query: 231 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 290 |||||||| ||| || | ||| ||||| |||||||||||| |||| || | | ||||||| Sbjct: 563 ctcctcccgcctagcgaacttcctttctcggcttgccttgttctttgctctcctagcctc 504 Query: 291 aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 350 ||| ||||| || | |||||||||||||||||||||||||||| |||||| || |||| Sbjct: 503 aaattggtcggacaaggtcttctctctagccttctcagcctttgtcttgtggatattttc 444 Query: 351 cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 410 ||| |||||||||||||||||||| | |||||||| ||||||| |||||||||||| || Sbjct: 443 catcagcacacgcttgttcttgaagacattacccttcaccttcatgtacatgtcatgata 384 Query: 411 catgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcacgcg 470 ||||||||||||||||||||||| ||| | ||||||||| |||| || ||||| || | Sbjct: 383 catgtgcttgtcgatcttctttgattccctgtacttgcgaagcaaacgcctgaggactct 324 Query: 471 catcctcctcatccacagaatcttggtgggaagcctagcctnccttgt-cccctgcgctt 529 ||| ||||||||||| || | |||||| || || ||||||| ||| || || ||||||| Sbjct: 323 cattctcctcatccaaagcaccttggtaggcagtctagcctccctggtacctttgcgctt 264 Query: 530 accatatccagaatggcggcccttc 554 ||| |||||||| || ||||||||| Sbjct: 263 accgtatccagagtgacggcccttc 239
>gb|AY389581.1| Hyacinthus orientalis ribosomal protein L19 (RPL19) mRNA, complete cds Length = 664 Score = 206 bits (104), Expect = 6e-50 Identities = 263/315 (83%), Gaps = 1/315 (0%) Strand = Plus / Minus Query: 231 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 290 |||||||||||||||||||||||| || | |||||||||||||||||||||||| || || Sbjct: 557 ctcctccctcctggcaatctttctctctctgcttgccttgctcttggcacgcttggcttc 498 Query: 291 aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 350 |||||| ||||| | |||||||| || ||||||||||| || || ||||||||||| || Sbjct: 497 aaactgatcagatatagtcttctcccttgccttctcagctttggatttgtgaatgctctc 438 Query: 351 cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 410 ||| ||||| | ||||||||| |||| |||||||| || |||| |||||| |||||||| Sbjct: 437 catcagcaccctcttgttcttaaacacattacccttcactttcatgtacatatcatggta 378 Query: 411 catgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcacgcg 470 |||||| ||||| || ||||| | ||| |||||||| | |||| |||| || || || Sbjct: 377 catgtgtttgtcaattttcttggattctcggtacttcctcagcaaacgtcgcagaactcg 318 Query: 471 catcctcctcatccacagaatcttggtgggaagcctagcctnccttgt-cccctgcgctt 529 ||||||||||||||| |||| |||||| || |||||||| | ||| || ||| ||||||| Sbjct: 317 catcctcctcatccaaagaaccttggttgggagcctagcttccctggtacccttgcgctt 258 Query: 530 accatatccagaatg 544 || || |||||||| Sbjct: 257 tccgtagccagaatg 243
>ref|NM_112551.2| Arabidopsis thaliana structural constituent of ribosome AT3G16780 mRNA, complete cds Length = 847 Score = 198 bits (100), Expect = 1e-47 Identities = 246/295 (83%) Strand = Plus / Minus Query: 229 ctctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcc 288 |||||||| || ||||||| |||||| || | ||| |||||| |||| |||||| ||| Sbjct: 596 ctctcctctcttctggcaaactttctctccctgctagccttgttcttaatacgcttggcc 537 Query: 289 tcaaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctt 348 ||||||||||||| ||| |||||||||||||||||||||||||| |||||| ||||| Sbjct: 536 tcaaactggtcagcgagagtcttctctctagccttctcagccttcatcttgtggatgctc 477 Query: 349 tccataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatgg 408 |||||||||||||||||||||||||| | |||||||| || |||| ||||||||||||| Sbjct: 476 tccataagcacacgcttgttcttgaaaacattacccttcactttcatgtacatgtcatgg 417 Query: 409 tacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcacg 468 ||||||||| | || |||||||||| ||||||||||||| | | || || | ||| Sbjct: 416 tacatgtgcctatcaatcttctttgactcacggtacttgctcaagaaacgcctcaacacc 357 Query: 469 cgcatcctcctcatccacagaatcttggtgggaagcctagcctnccttgtcccct 523 | ||| ||||||||||| ||||||||||| || ||||| |||| ||||| |||| Sbjct: 356 ctcattctcctcatccaaagaatcttggttggtagccttgcctctcttgtaccct 302
>gb|AY090335.1| Arabidopsis thaliana AT3g16780/MGL6_23 mRNA, complete cds Length = 630 Score = 198 bits (100), Expect = 1e-47 Identities = 246/295 (83%) Strand = Plus / Minus Query: 229 ctctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcc 288 |||||||| || ||||||| |||||| || | ||| |||||| |||| |||||| ||| Sbjct: 539 ctctcctctcttctggcaaactttctctccctgctagccttgttcttaatacgcttggcc 480 Query: 289 tcaaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctt 348 ||||||||||||| ||| |||||||||||||||||||||||||| |||||| ||||| Sbjct: 479 tcaaactggtcagcgagagtcttctctctagccttctcagccttcatcttgtggatgctc 420 Query: 349 tccataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatgg 408 |||||||||||||||||||||||||| | |||||||| || |||| ||||||||||||| Sbjct: 419 tccataagcacacgcttgttcttgaaaacattacccttcactttcatgtacatgtcatgg 360 Query: 409 tacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcacg 468 ||||||||| | || |||||||||| ||||||||||||| | | || || | ||| Sbjct: 359 tacatgtgcctatcaatcttctttgactcacggtacttgctcaagaaacgcctcaacacc 300 Query: 469 cgcatcctcctcatccacagaatcttggtgggaagcctagcctnccttgtcccct 523 | ||| ||||||||||| ||||||||||| || ||||| |||| ||||| |||| Sbjct: 299 ctcattctcctcatccaaagaatcttggttggtagccttgcctctcttgtaccct 245
>gb|AY045610.1| Arabidopsis thaliana AT3g16780/MGL6_23 mRNA, complete cds Length = 814 Score = 198 bits (100), Expect = 1e-47 Identities = 246/295 (83%) Strand = Plus / Minus Query: 229 ctctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcc 288 |||||||| || ||||||| |||||| || | ||| |||||| |||| |||||| ||| Sbjct: 582 ctctcctctcttctggcaaactttctctccctgctagccttgttcttaatacgcttggcc 523 Query: 289 tcaaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctt 348 ||||||||||||| ||| |||||||||||||||||||||||||| |||||| ||||| Sbjct: 522 tcaaactggtcagcgagagtcttctctctagccttctcagccttcatcttgtggatgctc 463 Query: 349 tccataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatgg 408 |||||||||||||||||||||||||| | |||||||| || |||| ||||||||||||| Sbjct: 462 tccataagcacacgcttgttcttgaaaacattacccttcactttcatgtacatgtcatgg 403 Query: 409 tacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcacg 468 ||||||||| | || |||||||||| ||||||||||||| | | || || | ||| Sbjct: 402 tacatgtgcctatcaatcttctttgactcacggtacttgctcaagaaacgcctcaacacc 343 Query: 469 cgcatcctcctcatccacagaatcttggtgggaagcctagcctnccttgtcccct 523 | ||| ||||||||||| ||||||||||| || ||||| |||| ||||| |||| Sbjct: 342 ctcattctcctcatccaaagaatcttggttggtagccttgcctctcttgtaccct 288
>gb|AY089073.1| Arabidopsis thaliana clone 27978 mRNA, complete sequence Length = 812 Score = 198 bits (100), Expect = 1e-47 Identities = 246/295 (83%) Strand = Plus / Minus Query: 229 ctctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcc 288 |||||||| || ||||||| |||||| || | ||| |||||| |||| |||||| ||| Sbjct: 594 ctctcctctcttctggcaaactttctctccctgctagccttgttcttaatacgcttggcc 535 Query: 289 tcaaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctt 348 ||||||||||||| ||| |||||||||||||||||||||||||| |||||| ||||| Sbjct: 534 tcaaactggtcagcgagggtcttctctctagccttctcagccttcatcttgtggatgctc 475 Query: 349 tccataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatgg 408 |||||||||||||||||||||||||| | |||||||| || |||| ||||||||||||| Sbjct: 474 tccataagcacacgcttgttcttgaaaacattacccttcactttcatgtacatgtcatgg 415 Query: 409 tacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcacg 468 ||||||||| | || |||||||||| ||||||||||||| | | || || | ||| Sbjct: 414 tacatgtgcctatcaatcttctttgactcacggtacttgctcaagaaacgcctcaacacc 355 Query: 469 cgcatcctcctcatccacagaatcttggtgggaagcctagcctnccttgtcccct 523 | ||| ||||||||||| ||||||||||| || ||||| |||| ||||| |||| Sbjct: 354 ctcattctcctcatccaaagaatcttggttggtagccttgcctctcttgtaccct 300
>dbj|AB022217.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGL6 Length = 79459 Score = 198 bits (100), Expect = 1e-47 Identities = 246/295 (83%) Strand = Plus / Minus Query: 229 ctctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcc 288 |||||||| || ||||||| |||||| || | ||| |||||| |||| |||||| ||| Sbjct: 76031 ctctcctctcttctggcaaactttctctccctgctagccttgttcttaatacgcttggcc 75972 Query: 289 tcaaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctt 348 ||||||||||||| ||| |||||||||||||||||||||||||| |||||| ||||| Sbjct: 75971 tcaaactggtcagcgagagtcttctctctagccttctcagccttcatcttgtggatgctc 75912 Query: 349 tccataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatgg 408 |||||||||||||||||||||||||| | |||||||| || |||| ||||||||||||| Sbjct: 75911 tccataagcacacgcttgttcttgaaaacattacccttcactttcatgtacatgtcatgg 75852 Query: 409 tacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcacg 468 ||||||||| | || |||||||||| ||||||||||||| | | || || | ||| Sbjct: 75851 tacatgtgcctatcaatcttctttgactcacggtacttgctcaagaaacgcctcaacacc 75792 Query: 469 cgcatcctcctcatccacagaatcttggtgggaagcctagcctnccttgtcccct 523 | ||| ||||||||||| ||||||||||| || ||||| |||| ||||| |||| Sbjct: 75791 ctcattctcctcatccaaagaatcttggttggtagccttgcctctcttgtaccct 75737
>dbj|D21304.1|RICSS504 Oryza sativa SS504 mRNA for ribosomal protein L19, partial sequence Length = 153 Score = 196 bits (99), Expect = 5e-47 Identities = 133/146 (91%) Strand = Plus / Minus Query: 256 tcacggcttgccttgctcttggcacgcttagcctcaaactggtcagagagcgtcttctct 315 |||||||||||||||||||||||| ||||||||| ||||||||||||||| ||||||| Sbjct: 151 tcacggcttgccttgctcttggcaagcttagcctnaaactggtcagagagtgtcttctnn 92 Query: 316 ctagccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaac 375 || |||||||||||||| ||||||| || ||||||||||| ||| |||||||||||||| Sbjct: 91 cttgccttctcagccttanacttgtggatactttccataagaacangcttgttcttgaac 32 Query: 376 atgttacccttgaccttcaagtacat 401 ||||||||||||||||||| |||||| Sbjct: 31 atgttacccttgaccttcatgtacat 6
>gb|DQ294277.1| Solanum tuberosum clone 172G04 60S ribosomal protein L19-like protein mRNA, complete cds Length = 759 Score = 194 bits (98), Expect = 2e-46 Identities = 263/317 (82%), Gaps = 1/317 (0%) Strand = Plus / Minus Query: 235 tccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctcaaac 294 |||||||| |||| ||||||||| | |||||||||| |||| || | | |||||||||| Sbjct: 543 tccctccttgcaaactttctttctctgcttgccttgttctttgccctcctagcctcaaat 484 Query: 295 tggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttccata 354 ||||| || | |||||||||||||| ||||||||||||| |||||| || ||||||| Sbjct: 483 tggtcggacaaggtcttctctctagctttctcagcctttgtcttgtggatattttccatc 424 Query: 355 agcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatg 414 |||||||||||||||||||| | |||||||| ||||||| |||||||||||| |||||| Sbjct: 423 agcacacgcttgttcttgaaaacattacccttcaccttcatgtacatgtcatgatacatg 364 Query: 415 tgcttgtcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcacgcgcatc 474 || ||||| |||||||||| ||| | |||||||| |||| || ||||| || | || Sbjct: 363 tgtttgtcaatcttctttgattccctatacttgcgaagcaaacgcctgaggactctcaat 304 Query: 475 ctcctcatccacagaatcttggtgggaagcctagcctnccttgt-cccctgcgcttacca 533 ||||||||||| || | |||||| || || ||||||| ||| || || ||||||||||| Sbjct: 303 ctcctcatccaaagcaccttggtaggcagtctagcctccctggtacctttgcgcttacca 244 Query: 534 tatccagaatggcggcc 550 |||||||| || ||||| Sbjct: 243 tatccagagtgacggcc 227
>gb|AY488031.1| Capsicum annuum ribosomal protein L19 mRNA, partial sequence Length = 526 Score = 190 bits (96), Expect = 3e-45 Identities = 192/224 (85%) Strand = Plus / Minus Query: 231 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 290 |||||||| ||| || | ||| ||||| |||||||||||| |||| || | | ||||||| Sbjct: 257 ctcctcccgcctagcgaacttcctttctcggcttgccttgttctttgctctcctagcctc 198 Query: 291 aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 350 ||| ||||| || | |||||||||||||||||||||||||||| |||||| || |||| Sbjct: 197 aaattggtcggacaaggtcttctctctagccttctcagcctttgtcttgtggatattttc 138 Query: 351 cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 410 ||| |||||||||||||||||||| | |||||||| ||||||| |||||||||||| || Sbjct: 137 catcagcacacgcttgttcttgaagacattacccttcaccttcatgtacatgtcatgata 78 Query: 411 catgtgcttgtcgatcttctttgcttcacggtacttgcggagca 454 | ||||||||||||||||||||| ||| | ||||||||| |||| Sbjct: 77 cgtgtgcttgtcgatcttctttgattccctgtacttgcgaagca 34
>emb|Z31720.1|NTL19RIB N.tabacum (cv.Samsun NN) L19 mRNA for ribosomal protein L19 Length = 1597 Score = 184 bits (93), Expect = 2e-43 Identities = 267/324 (82%), Gaps = 1/324 (0%) Strand = Plus / Minus Query: 232 tcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctca 291 ||||||||||| |||| ||| ||||| | ||| || ||| |||| || | | | |||||| Sbjct: 1332 tcctccctcctagcaaacttcctttccctgctggctttgttctttgccctcctggcctca 1273 Query: 292 aactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttcc 351 || || ||||| | ||||||||||||||||| |||||||||| ||||||||| ||||| Sbjct: 1272 aattgatcagacaaggtcttctctctagccttttcagcctttgttttgtgaatgttttcc 1213 Query: 352 ataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtac 411 || || ||||||||||||||||| | |||||||| ||||||| |||||||||||| ||| Sbjct: 1212 atgaggacacgcttgttcttgaaaacattacccttcaccttcatgtacatgtcatgatac 1153 Query: 412 atgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcacgcgc 471 |||||| ||||||||||||| | || | ||||||||| |||| || ||||| || | | Sbjct: 1152 atgtgcctgtcgatcttcttggactccctgtacttgcgaagcaaacgcctgagaactctc 1093 Query: 472 atcctcctcatccacagaatcttggtgggaagcctagcctnccttgt-cccctgcgctta 530 ||||||||||||||||| | ||| || || | |||||||| ||| || ||| | |||||| Sbjct: 1092 atcctcctcatccacagcacctttgttggcaacctagcctccctggtacccttacgctta 1033 Query: 531 ccatatccagaatggcggcccttc 554 ||||||||||| || || |||||| Sbjct: 1032 ccatatccagagtgacgacccttc 1009
>ref|NM_100157.2| Arabidopsis thaliana EMB2386; structural constituent of ribosome AT1G02780 (EMB2386) mRNA, complete cds Length = 988 Score = 168 bits (85), Expect = 1e-38 Identities = 172/201 (85%) Strand = Plus / Minus Query: 231 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 290 |||||| ||||| ||| ||| ||||| ||||| |||||| |||| || | ||||||||| Sbjct: 581 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 522 Query: 291 aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 350 |||||| ||||| || |||||||| |||||||||||||||||||||||||| || || || Sbjct: 521 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 462 Query: 351 cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 410 ||| | ||||||||||||||||||| |||||||| || || ||||||||||||||| Sbjct: 461 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 402 Query: 411 catgtgcttgtcgatcttctt 431 |||||||||||| |||||||| Sbjct: 401 catgtgcttgtcaatcttctt 381
>ref|NM_116456.2| Arabidopsis thaliana structural constituent of ribosome AT4G02230 mRNA, complete cds Length = 816 Score = 168 bits (85), Expect = 1e-38 Identities = 151/173 (87%) Strand = Plus / Minus Query: 259 cggcttgccttgctcttggcacgcttagcctcaaactggtcagagagcgtcttctctcta 318 ||||| |||||| |||| || | ||||||||||||||||||||| | |||||||||||| Sbjct: 536 cggctagccttgttcttagccctcttagcctcaaactggtcagacaatgtcttctctcta 477 Query: 319 gccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaacatg 378 |||||||||||||| || |||||||| |||||||| | |||||||||||||||||| | | Sbjct: 476 gccttctcagccttggatttgtgaatactttccatcaacacacgcttgttcttgaagacg 417 Query: 379 ttacccttgaccttcaagtacatgtcatggtacatgtgcttgtcgatcttctt 431 || |||||||| |||| |||||||||||||||||| || |||| |||||||| Sbjct: 416 tttcccttgactttcatgtacatgtcatggtacatatgtctgtcaatcttctt 364
>gb|AC009525.3| Arabidopsis thaliana chromosome I BAC F22D16 genomic sequence, complete sequence Length = 100239 Score = 168 bits (85), Expect = 1e-38 Identities = 172/201 (85%) Strand = Plus / Minus Query: 231 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 290 |||||| ||||| ||| ||| ||||| ||||| |||||| |||| || | ||||||||| Sbjct: 84067 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 84008 Query: 291 aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 350 |||||| ||||| || |||||||| |||||||||||||||||||||||||| || || || Sbjct: 84007 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 83948 Query: 351 cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 410 ||| | ||||||||||||||||||| |||||||| || || ||||||||||||||| Sbjct: 83947 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 83888 Query: 411 catgtgcttgtcgatcttctt 431 |||||||||||| |||||||| Sbjct: 83887 catgtgcttgtcaatcttctt 83867
>gb|BT010178.1| Arabidopsis thaliana At1g02780/T14P4_3 mRNA, complete cds Length = 645 Score = 168 bits (85), Expect = 1e-38 Identities = 172/201 (85%) Strand = Plus / Minus Query: 231 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 290 |||||| ||||| ||| ||| ||||| ||||| |||||| |||| || | ||||||||| Sbjct: 537 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 478 Query: 291 aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 350 |||||| ||||| || |||||||| |||||||||||||||||||||||||| || || || Sbjct: 477 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 418 Query: 351 cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 410 ||| | ||||||||||||||||||| |||||||| || || ||||||||||||||| Sbjct: 417 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 358 Query: 411 catgtgcttgtcgatcttctt 431 |||||||||||| |||||||| Sbjct: 357 catgtgcttgtcaatcttctt 337
>emb|AL161494.2|ATCHRIV6 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 6 Length = 194892 Score = 168 bits (85), Expect = 1e-38 Identities = 151/173 (87%) Strand = Plus / Plus Query: 259 cggcttgccttgctcttggcacgcttagcctcaaactggtcagagagcgtcttctctcta 318 ||||| |||||| |||| || | ||||||||||||||||||||| | |||||||||||| Sbjct: 15243 cggctagccttgttcttagccctcttagcctcaaactggtcagacaatgtcttctctcta 15302 Query: 319 gccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaacatg 378 |||||||||||||| || |||||||| |||||||| | |||||||||||||||||| | | Sbjct: 15303 gccttctcagccttggatttgtgaatactttccatcaacacacgcttgttcttgaagacg 15362 Query: 379 ttacccttgaccttcaagtacatgtcatggtacatgtgcttgtcgatcttctt 431 || |||||||| |||| |||||||||||||||||| || |||| |||||||| Sbjct: 15363 tttcccttgactttcatgtacatgtcatggtacatatgtctgtcaatcttctt 15415
>gb|AY072494.1| Arabidopsis thaliana similar to 60S ribosome protein L19 (At4g02230; T2H3.3) mRNA, complete cds Length = 677 Score = 168 bits (85), Expect = 1e-38 Identities = 151/173 (87%) Strand = Plus / Minus Query: 259 cggcttgccttgctcttggcacgcttagcctcaaactggtcagagagcgtcttctctcta 318 ||||| |||||| |||| || | ||||||||||||||||||||| | |||||||||||| Sbjct: 509 cggctagccttgttcttagccctcttagcctcaaactggtcagacaatgtcttctctcta 450 Query: 319 gccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaacatg 378 |||||||||||||| || |||||||| |||||||| | |||||||||||||||||| | | Sbjct: 449 gccttctcagccttggatttgtgaatactttccatcaacacacgcttgttcttgaagacg 390 Query: 379 ttacccttgaccttcaagtacatgtcatggtacatgtgcttgtcgatcttctt 431 || |||||||| |||| |||||||||||||||||| || |||| |||||||| Sbjct: 389 tttcccttgactttcatgtacatgtcatggtacatatgtctgtcaatcttctt 337
>gb|AF462835.1|AF462835 Arabidopsis thaliana At1g02780/T14P4_3 mRNA, complete cds Length = 847 Score = 168 bits (85), Expect = 1e-38 Identities = 172/201 (85%) Strand = Plus / Minus Query: 231 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 290 |||||| ||||| ||| ||| ||||| ||||| |||||| |||| || | ||||||||| Sbjct: 580 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 521 Query: 291 aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 350 |||||| ||||| || |||||||| |||||||||||||||||||||||||| || || || Sbjct: 520 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 461 Query: 351 cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 410 ||| | ||||||||||||||||||| |||||||| || || ||||||||||||||| Sbjct: 460 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 401 Query: 411 catgtgcttgtcgatcttctt 431 |||||||||||| |||||||| Sbjct: 400 catgtgcttgtcaatcttctt 380
>gb|AF424580.1|AF424580 Arabidopsis thaliana At1g02780/T14P4_3 mRNA, complete cds Length = 897 Score = 168 bits (85), Expect = 1e-38 Identities = 172/201 (85%) Strand = Plus / Minus Query: 231 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 290 |||||| ||||| ||| ||| ||||| ||||| |||||| |||| || | ||||||||| Sbjct: 580 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 521 Query: 291 aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 350 |||||| ||||| || |||||||| |||||||||||||||||||||||||| || || || Sbjct: 520 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 461 Query: 351 cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 410 ||| | ||||||||||||||||||| |||||||| || || ||||||||||||||| Sbjct: 460 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 401 Query: 411 catgtgcttgtcgatcttctt 431 |||||||||||| |||||||| Sbjct: 400 catgtgcttgtcaatcttctt 380
>gb|AF386993.1|AF386993 Arabidopsis thaliana Similar to 60S ribosome protein L19 (T2H3.3) mRNA, complete cds Length = 804 Score = 168 bits (85), Expect = 1e-38 Identities = 151/173 (87%) Strand = Plus / Minus Query: 259 cggcttgccttgctcttggcacgcttagcctcaaactggtcagagagcgtcttctctcta 318 ||||| |||||| |||| || | ||||||||||||||||||||| | |||||||||||| Sbjct: 536 cggctagccttgttcttagccctcttagcctcaaactggtcagacaatgtcttctctcta 477 Query: 319 gccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaacatg 378 |||||||||||||| || |||||||| |||||||| | |||||||||||||||||| | | Sbjct: 476 gccttctcagccttggatttgtgaatactttccatcaacacacgcttgttcttgaagacg 417 Query: 379 ttacccttgaccttcaagtacatgtcatggtacatgtgcttgtcgatcttctt 431 || |||||||| |||| |||||||||||||||||| || |||| |||||||| Sbjct: 416 tttcccttgactttcatgtacatgtcatggtacatatgtctgtcaatcttctt 364
>emb|BX816202.1|CNS0AE3J Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH34ZA05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 872 Score = 168 bits (85), Expect = 1e-38 Identities = 172/201 (85%) Strand = Plus / Minus Query: 231 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 290 |||||| ||||| ||| ||| ||||| ||||| |||||| |||| || | ||||||||| Sbjct: 557 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 498 Query: 291 aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 350 |||||| ||||| || |||||||| |||||||||||||||||||||||||| || || || Sbjct: 497 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 438 Query: 351 cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 410 ||| | ||||||||||||||||||| |||||||| || || ||||||||||||||| Sbjct: 437 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 378 Query: 411 catgtgcttgtcgatcttctt 431 |||||||||||| |||||||| Sbjct: 377 catgtgcttgtcaatcttctt 357
>emb|BX816956.1|CNS0AD7Y Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH78ZF01 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 848 Score = 168 bits (85), Expect = 1e-38 Identities = 172/201 (85%) Strand = Plus / Minus Query: 231 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 290 |||||| ||||| ||| ||| ||||| ||||| |||||| |||| || | ||||||||| Sbjct: 566 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 507 Query: 291 aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 350 |||||| ||||| || |||||||| |||||||||||||||||||||||||| || || || Sbjct: 506 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 447 Query: 351 cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 410 ||| | ||||||||||||||||||| |||||||| || || ||||||||||||||| Sbjct: 446 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 387 Query: 411 catgtgcttgtcgatcttctt 431 |||||||||||| |||||||| Sbjct: 386 catgtgcttgtcaatcttctt 366
>emb|BX816918.1|CNS0ADAO Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH76ZE12 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 865 Score = 168 bits (85), Expect = 1e-38 Identities = 172/201 (85%) Strand = Plus / Minus Query: 231 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 290 |||||| ||||| ||| ||| ||||| ||||| |||||| |||| || | ||||||||| Sbjct: 568 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 509 Query: 291 aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 350 |||||| ||||| || |||||||| |||||||||||||||||||||||||| || || || Sbjct: 508 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 449 Query: 351 cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 410 ||| | ||||||||||||||||||| |||||||| || || ||||||||||||||| Sbjct: 448 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 389 Query: 411 catgtgcttgtcgatcttctt 431 |||||||||||| |||||||| Sbjct: 388 catgtgcttgtcaatcttctt 368
>emb|BX815921.1|CNS0AD0X Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH16ZH11 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 813 Score = 168 bits (85), Expect = 1e-38 Identities = 172/201 (85%) Strand = Plus / Minus Query: 231 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 290 |||||| ||||| ||| ||| ||||| ||||| |||||| |||| || | ||||||||| Sbjct: 563 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 504 Query: 291 aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 350 |||||| ||||| || |||||||| |||||||||||||||||||||||||| || || || Sbjct: 503 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 444 Query: 351 cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 410 ||| | ||||||||||||||||||| |||||||| || || ||||||||||||||| Sbjct: 443 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 384 Query: 411 catgtgcttgtcgatcttctt 431 |||||||||||| |||||||| Sbjct: 383 catgtgcttgtcaatcttctt 363
>emb|BX817746.1|CNS0ACMV Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL3ZA09 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 873 Score = 168 bits (85), Expect = 1e-38 Identities = 172/201 (85%) Strand = Plus / Minus Query: 231 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 290 |||||| ||||| ||| ||| ||||| ||||| |||||| |||| || | ||||||||| Sbjct: 558 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 499 Query: 291 aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 350 |||||| ||||| || |||||||| |||||||||||||||||||||||||| || || || Sbjct: 498 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 439 Query: 351 cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 410 ||| | ||||||||||||||||||| |||||||| || || ||||||||||||||| Sbjct: 438 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 379 Query: 411 catgtgcttgtcgatcttctt 431 |||||||||||| |||||||| Sbjct: 378 catgtgcttgtcaatcttctt 358
>emb|BX813821.1|CNS0AAUL Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB41ZA10 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 885 Score = 168 bits (85), Expect = 1e-38 Identities = 172/201 (85%) Strand = Plus / Minus Query: 231 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 290 |||||| ||||| ||| ||| ||||| ||||| |||||| |||| || | ||||||||| Sbjct: 564 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 505 Query: 291 aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 350 |||||| ||||| || |||||||| |||||||||||||||||||||||||| || || || Sbjct: 504 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 445 Query: 351 cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 410 ||| | ||||||||||||||||||| |||||||| || || ||||||||||||||| Sbjct: 444 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 385 Query: 411 catgtgcttgtcgatcttctt 431 |||||||||||| |||||||| Sbjct: 384 catgtgcttgtcaatcttctt 364
>gb|AC022521.4|AC022521 Arabidopsis thaliana chromosome I BAC T14P4 genomic sequence, complete sequence Length = 121668 Score = 168 bits (85), Expect = 1e-38 Identities = 172/201 (85%) Strand = Plus / Minus Query: 231 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 290 |||||| ||||| ||| ||| ||||| ||||| |||||| |||| || | ||||||||| Sbjct: 9427 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 9368 Query: 291 aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 350 |||||| ||||| || |||||||| |||||||||||||||||||||||||| || || || Sbjct: 9367 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 9308 Query: 351 cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 410 ||| | ||||||||||||||||||| |||||||| || || ||||||||||||||| Sbjct: 9307 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 9248 Query: 411 catgtgcttgtcgatcttctt 431 |||||||||||| |||||||| Sbjct: 9247 catgtgcttgtcaatcttctt 9227
>gb|AF075597.1|T2H3 Arabidopsis thaliana BAC T2H3 Length = 48689 Score = 168 bits (85), Expect = 1e-38 Identities = 151/173 (87%) Strand = Plus / Minus Query: 259 cggcttgccttgctcttggcacgcttagcctcaaactggtcagagagcgtcttctctcta 318 ||||| |||||| |||| || | ||||||||||||||||||||| | |||||||||||| Sbjct: 37035 cggctagccttgttcttagccctcttagcctcaaactggtcagacaatgtcttctctcta 36976 Query: 319 gccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaacatg 378 |||||||||||||| || |||||||| |||||||| | |||||||||||||||||| | | Sbjct: 36975 gccttctcagccttggatttgtgaatactttccatcaacacacgcttgttcttgaagacg 36916 Query: 379 ttacccttgaccttcaagtacatgtcatggtacatgtgcttgtcgatcttctt 431 || |||||||| |||| |||||||||||||||||| || |||| |||||||| Sbjct: 36915 tttcccttgactttcatgtacatgtcatggtacatatgtctgtcaatcttctt 36863
>gb|AC152751.22| Medicago truncatula clone mth2-18n7, complete sequence Length = 117170 Score = 165 bits (83), Expect = 2e-37 Identities = 199/238 (83%) Strand = Plus / Plus Query: 286 gcctcaaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatg 345 ||||||||||| ||||| | |||||||| ||||||||||||||||| || |||||||| Sbjct: 101714 gcctcaaactgatcagataatgtcttctccctagccttctcagccttggatttgtgaata 101773 Query: 346 ctttccataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtca 405 || |||||||| || | |||||||||||| | || ||||| ||||||| |||||| ||| Sbjct: 101774 ctctccataaggactctcttgttcttgaagacatttcccttcaccttcatgtacatatca 101833 Query: 406 tggtacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggcgtctgagc 465 || ||||| || ||||| ||||||||||| || ||||||||||| |||| || ||||| Sbjct: 101834 tgatacatatgtttgtcaatcttctttgcctctcggtacttgcgaagcaaacgcctgagg 101893 Query: 466 acgcgcatcctcctcatccacagaatcttggtgggaagcctagcctnccttgtcccct 523 || ||||| ||||||||||| || || |||||||| |||||||||| ||||| |||| Sbjct: 101894 acacgcattctcctcatccaaaggattttggtggggagcctagcctctcttgtaccct 101951
>emb|BX818275.1|CNS0ACJX Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL6ZG09 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 830 Score = 165 bits (83), Expect = 2e-37 Identities = 158/183 (86%) Strand = Plus / Minus Query: 249 ctttctttcacggcttgccttgctcttggcacgcttagcctcaaactggtcagagagcgt 308 ||||||||| ||||| |||||| |||| || | ||||||||||||||| ||||| || || Sbjct: 548 ctttctttctcggctagccttgttcttcgccctcttagcctcaaactgatcagacagagt 489 Query: 309 cttctctctagccttctcagcctttgacttgtgaatgctttccataagcacacgcttgtt 368 |||||| |||||||||||||||||||||||||| || || ||||| | | ||||||||| Sbjct: 488 cttctccctagccttctcagcctttgacttgtggatactctccatcaagagacgcttgtt 429 Query: 369 cttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttgtcgatctt 428 |||||||| |||||||| || || ||||||||||||||||||||||||||| ||||| Sbjct: 428 cttgaacacattacccttcacacgcatgtacatgtcatggtacatgtgcttgtcaatctt 369 Query: 429 ctt 431 ||| Sbjct: 368 ctt 366
>emb|BX815471.1|CNS0ACXF Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS63ZB09 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 870 Score = 161 bits (81), Expect = 3e-36 Identities = 171/201 (85%) Strand = Plus / Minus Query: 231 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 290 |||||| ||||| ||| ||| ||||| ||||| |||||| |||| || | ||||||||| Sbjct: 566 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 507 Query: 291 aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 350 |||||| ||||| || |||||||| |||||||||||||||||||||||||| || || || Sbjct: 506 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 447 Query: 351 cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 410 ||| | ||||||||||||||||||| |||||||| || || ||||||||||||||| Sbjct: 446 catcaagacacgcttgttcttgaacacattacccttcacacgcatgtacatgtcatggta 387 Query: 411 catgtgcttgtcgatcttctt 431 ||||||||| || |||||||| Sbjct: 386 catgtgcttctcaatcttctt 366
>emb|BX842172.1|CNS09YDA Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL16ZB09 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 729 Score = 159 bits (80), Expect = 1e-35 Identities = 151/172 (87%), Gaps = 2/172 (1%) Strand = Plus / Minus Query: 279 acgcttagcctcaaactggtcagagagcgtcttctctctagcctt-ctcagcctt-tgac 336 |||||| |||||||||||||||| ||| ||||||||||||||||| ||||||||| | Sbjct: 527 acgcttggcctcaaactggtcagcgagagtcttctctctagccttactcagccttcatcc 468 Query: 337 ttgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgaccttcaag 396 ||||| ||||| |||||||||||||||||||||||||| | |||||||| || |||| | Sbjct: 467 ttgtggatgctctccataagcacacgcttgttcttgaaaacattacccttcactttcatg 408 Query: 397 tacatgtcatggtacatgtgcttgtcgatcttctttgcttcacggtacttgc 448 ||||||||||||||||||||| | || |||||||||| ||||||||||||| Sbjct: 407 tacatgtcatggtacatgtgcctatcaatcttctttgactcacggtacttgc 356
>gb|AY086882.1| Arabidopsis thaliana clone 2906 mRNA, complete sequence Length = 898 Score = 153 bits (77), Expect = 7e-34 Identities = 170/201 (84%) Strand = Plus / Minus Query: 231 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 290 |||||| ||||| ||| ||| ||||| ||||| |||||| |||| || | ||||||||| Sbjct: 581 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 522 Query: 291 aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 350 |||| ||||| || |||||||| |||||||||||||||||||||||||| || || || Sbjct: 521 ctactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 462 Query: 351 cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 410 ||| | ||||||||||||||||||| |||||||| || || ||||||||||||||| Sbjct: 461 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 402 Query: 411 catgtgcttgtcgatcttctt 431 |||||||||||| |||||||| Sbjct: 401 catgtgcttgtcaatcttctt 381
>emb|BX816648.1|CNS0AD9N Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH60ZC04 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 819 Score = 149 bits (75), Expect = 1e-32 Identities = 144/167 (86%) Strand = Plus / Minus Query: 253 ctttcacggcttgccttgctcttggcacgcttagcctcaaactggtcagagagcgtcttc 312 ||||| ||||| |||||| |||| || | ||||||||||||||| ||||| || |||||| Sbjct: 480 ctttctcggctagccttgttcttcgccctcttagcctcaaactgatcagacagagtcttc 421 Query: 313 tctctagccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttg 372 || |||||||||||||||||||||||||| || || ||||| | ||||||||||||||| Sbjct: 420 tccctagccttctcagcctttgacttgtggatactctccatcaagacacgcttgttcttg 361 Query: 373 aacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 |||| |||||||| || || |||||||||||||||||||||||| Sbjct: 360 aacacattacccttaacacgcatgtacatgtcatggtacatgtgctt 314
>dbj|D29721.1|RICYK34 Oryza sativa mRNA, partial homologous to ribosomal protein L19 gene Length = 369 Score = 139 bits (70), Expect = 1e-29 Identities = 114/125 (91%), Gaps = 3/125 (2%) Strand = Plus / Plus Query: 211 cttgggccctgagcaagcctctcctccctcctggcaatctttctttcacggctt-gcctt 269 |||||||||||||| | |||||||| ||||||||||||||| || |||||| || ||||| Sbjct: 241 cttgggccctgagccaacctctcctncctcctggcaatcttcctctcacgggtttgcctt 300 Query: 270 gctcttggcacgcttagcctcaaac-tggtcagagagcgtcttctctc-tagccttctca 327 ||||||||||||||||||||||||| ||||||||||| |||||||||| | ||||||||| Sbjct: 301 gctcttggcacgcttagcctcaaacttggtcagagagtgtcttctctcttggccttctca 360 Query: 328 gcctt 332 ||||| Sbjct: 361 gcctt 365 Score = 73.8 bits (37), Expect = 5e-10 Identities = 46/49 (93%) Strand = Plus / Plus Query: 152 ttcacttctttgacttctttggtgccgctgcaggttgagcaggagctgc 200 |||||||||||| |||||| ||||||||||||| ||||||||||||||| Sbjct: 170 ttcacttctttgccttcttaggtgccgctgcagtttgagcaggagctgc 218
>dbj|AK110270.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-163-C08, full insert sequence Length = 1089 Score = 113 bits (57), Expect = 6e-22 Identities = 108/125 (86%) Strand = Plus / Minus Query: 349 tccataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatgg 408 ||||| |||||||||||||||||||| | ||||||||||||||||| ||| | || ||| Sbjct: 498 tccatgagcacacgcttgttcttgaagacgttacccttgaccttcatgtagagctcgtgg 439 Query: 409 tacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcacg 468 ||| |||||||||||||||||| || ||||||||||||||||| || | |||||||| Sbjct: 438 tacgagtgcttgtcgatcttcttggcctcacggtacttgcggagaagcctcctgagcaca 379 Query: 469 cgcat 473 ||||| Sbjct: 378 cgcat 374
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 99.6 bits (50), Expect = 9e-18 Identities = 160/194 (82%), Gaps = 2/194 (1%) Strand = Plus / Minus Query: 218 cctgagcaagcctctcctccctcctggcaatctttctttcacggcttgccttgctcttgg 277 ||||||| | |||||||| |||||||| |||||| ||||| |||||||| ||||||||| Sbjct: 28305978 cctgagccaacctctcctacctcctggaaatcttcctttcttggcttgccatgctcttgg 28305919 Query: 278 cacgcttagcctcaaactggtcagagagcgtcttctctctagccttctcagcctttgact 337 || |||| || ||||||||||| || || || ||| ||||| ||||||| ||| ||| Sbjct: 28305918 caagcttggcttcaaactggtcggaaagagttctcttcctagctttctcag-cttgcact 28305860 Query: 338 tgtgaatgctttccataa-gcacacgcttgttcttgaacatgttacccttgaccttcaag 396 |||| || || ||||||| | | | |||||| |||| |||||||||||||||||||| Sbjct: 28305859 tgtggatactctccataaggtcccctcttgttgttgagcatgttacccttgaccttcatt 28305800 Query: 397 tacatgtcatggta 410 |||||||||||||| Sbjct: 28305799 tacatgtcatggta 28305786 Score = 61.9 bits (31), Expect = 2e-06 Identities = 31/31 (100%) Strand = Plus / Minus Query: 471 catcctcctcatccacagaatcttggtggga 501 ||||||||||||||||||||||||||||||| Sbjct: 28305712 catcctcctcatccacagaatcttggtggga 28305682
>dbj|AP004300.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0470D12 Length = 157248 Score = 99.6 bits (50), Expect = 9e-18 Identities = 160/194 (82%), Gaps = 2/194 (1%) Strand = Plus / Minus Query: 218 cctgagcaagcctctcctccctcctggcaatctttctttcacggcttgccttgctcttgg 277 ||||||| | |||||||| |||||||| |||||| ||||| |||||||| ||||||||| Sbjct: 31541 cctgagccaacctctcctacctcctggaaatcttcctttcttggcttgccatgctcttgg 31482 Query: 278 cacgcttagcctcaaactggtcagagagcgtcttctctctagccttctcagcctttgact 337 || |||| || ||||||||||| || || || ||| ||||| ||||||| ||| ||| Sbjct: 31481 caagcttggcttcaaactggtcggaaagagttctcttcctagctttctcag-cttgcact 31423 Query: 338 tgtgaatgctttccataa-gcacacgcttgttcttgaacatgttacccttgaccttcaag 396 |||| || || ||||||| | | | |||||| |||| |||||||||||||||||||| Sbjct: 31422 tgtggatactctccataaggtcccctcttgttgttgagcatgttacccttgaccttcatt 31363 Query: 397 tacatgtcatggta 410 |||||||||||||| Sbjct: 31362 tacatgtcatggta 31349 Score = 61.9 bits (31), Expect = 2e-06 Identities = 31/31 (100%) Strand = Plus / Minus Query: 471 catcctcctcatccacagaatcttggtggga 501 ||||||||||||||||||||||||||||||| Sbjct: 31275 catcctcctcatccacagaatcttggtggga 31245
>gb|DQ066293.1| Ixodes scapularis isolate is-all-397 ribosomal protein L19 mRNA, complete cds Length = 597 Score = 95.6 bits (48), Expect = 1e-16 Identities = 72/80 (90%) Strand = Plus / Minus Query: 349 tccataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatgg 408 ||||| || ||||||||||||||||||| ||| ||||| |||||||||||| ||||||| Sbjct: 419 tccatgaggacacgcttgttcttgaacacgttgcccttagccttcaagtacaggtcatgg 360 Query: 409 tacatgtgcttgtcgatctt 428 |||| ||||||||||||||| Sbjct: 359 tacaggtgcttgtcgatctt 340
>emb|BX814021.1|CNS0ADSF Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB52ZE12 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 425 Score = 85.7 bits (43), Expect = 1e-13 Identities = 88/103 (85%) Strand = Plus / Minus Query: 231 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 290 |||||| ||||| ||| ||| ||||| ||||| |||||| |||| || | ||||||||| Sbjct: 110 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 51 Query: 291 aaactggtcagagagcgtcttctctctagccttctcagccttt 333 |||||| ||||| || |||||||| |||||||||||||||||| Sbjct: 50 aaactgatcagacagagtcttctccctagccttctcagccttt 8
>ref|NM_001030929.1| Gallus gallus ribosomal protein L19 (RPL19), mRNA Length = 706 Score = 81.8 bits (41), Expect = 2e-12 Identities = 104/125 (83%) Strand = Plus / Minus Query: 361 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 420 |||||||||||||||| ||||||||||||||||| ||||| | |||||||| || | Sbjct: 439 cgcttgttcttgaacacgttacccttgaccttcaggtacaggctgtggtacatatggcgg 380 Query: 421 tcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcacgcgcatcctcctc 480 ||||||||||| | || | ||| ||||||||||||| ||||| | |||||||||||| Sbjct: 379 tcgatcttcttggactccctgtatctgcggagcaggcgcctgagaatccgcatcctcctc 320 Query: 481 atcca 485 ||||| Sbjct: 319 atcca 315
>emb|AJ720076.1| Gallus gallus mRNA for hypothetical protein, clone 10e3 Length = 706 Score = 81.8 bits (41), Expect = 2e-12 Identities = 104/125 (83%) Strand = Plus / Minus Query: 361 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 420 |||||||||||||||| ||||||||||||||||| ||||| | |||||||| || | Sbjct: 439 cgcttgttcttgaacacgttacccttgaccttcaggtacaggctgtggtacatatggcgg 380 Query: 421 tcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcacgcgcatcctcctc 480 ||||||||||| | || | ||| ||||||||||||| ||||| | |||||||||||| Sbjct: 379 tcgatcttcttggactccctgtatctgcggagcaggcgcctgagaatccgcatcctcctc 320 Query: 481 atcca 485 ||||| Sbjct: 319 atcca 315
>emb|AM049066.1| Sphaerius sp. APV-2005 mRNA for ribosomal protein L19e (rpL19e gene) Length = 600 Score = 77.8 bits (39), Expect = 3e-11 Identities = 78/91 (85%) Strand = Plus / Minus Query: 364 ttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttgtcg 423 ||||||||||||| ||||||||| |||||| ||||| ||||||| | |||| ||||| Sbjct: 404 ttgttcttgaacacgttacccttcgccttcatgtacagcgcatggtagaggtgcctgtcg 345 Query: 424 atcttctttgcttcacggtacttgcggagca 454 || ||||| |||| ||||||||||||||||| Sbjct: 344 attttcttcgcttgacggtacttgcggagca 314
>gb|AY393838.1| Gallus gallus ribosomal protein L19 mRNA, partial cds Length = 523 Score = 73.8 bits (37), Expect = 5e-10 Identities = 103/125 (82%) Strand = Plus / Minus Query: 361 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 420 |||||||||||||||| ||||||||||||||||| ||||| | |||||||| || | Sbjct: 384 cgcttgttcttgaacacgttacccttgaccttcaggtacaggctgtggtacatatggcgg 325 Query: 421 tcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcacgcgcatcctcctc 480 ||||||||||| | || | ||| |||||||||| || ||||| | |||||||||||| Sbjct: 324 tcgatcttcttggactccctgtatctgcggagcagacgcctgagaatccgcatcctcctc 265 Query: 481 atcca 485 ||||| Sbjct: 264 atcca 260
>gb|AY232030.1| Drosophila yakuba clone yak-ad_RpL19 mRNA sequence Length = 582 Score = 69.9 bits (35), Expect = 8e-09 Identities = 62/71 (87%) Strand = Plus / Minus Query: 361 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 420 |||||||||||||||| |||||||||| ||||| ||||| ||| ||||||| |||| || Sbjct: 407 cgcttgttcttgaacacgttacccttgcacttcatgtacaggtcgtggtacaggtgcctg 348 Query: 421 tcgatcttctt 431 || |||||||| Sbjct: 347 tcaatcttctt 337
>ref|XM_793320.1| PREDICTED: Strongylocentrotus purpuratus similar to CG2746-PA, isoform A (LOC593861), mRNA Length = 1296 Score = 69.9 bits (35), Expect = 8e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 349 tccataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatgg 408 ||||| || ||||||||||||||||| | |||||||||||||||| ||||| || ||| Sbjct: 440 tccatgagaacacgcttgttcttgaagacattacccttgaccttcatgtacagctcgtgg 381 Query: 409 tacatgtgcttgtcgatcttctt 431 |||| ||| ||||||||||||| Sbjct: 380 tacagatgcctgtcgatcttctt 358
>emb|X74776.1|DMRPL19 D.melanogaster rpL19 gene for ribosomal protein L19 Length = 1022 Score = 69.9 bits (35), Expect = 8e-09 Identities = 62/71 (87%) Strand = Plus / Minus Query: 361 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 420 |||||||||||||||| |||||||||| ||||| ||||| ||| ||||||| |||| || Sbjct: 748 cgcttgttcttgaacacgttacccttgcacttcatgtacaggtcgtggtacaggtgcctg 689 Query: 421 tcgatcttctt 431 || |||||||| Sbjct: 688 tcaatcttctt 678
>gb|L32181.1|DRORPL19X Drosophila melanogaster ribosomal protein L19 mRNA Length = 723 Score = 69.9 bits (35), Expect = 8e-09 Identities = 62/71 (87%) Strand = Plus / Minus Query: 361 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 420 |||||||||||||||| |||||||||| ||||| ||||| ||| ||||||| |||| || Sbjct: 426 cgcttgttcttgaacacgttacccttgcacttcatgtacaggtcgtggtacaggtgcctg 367 Query: 421 tcgatcttctt 431 || |||||||| Sbjct: 366 tcaatcttctt 356
>ref|XM_479458.1| Oryza sativa (japonica cultivar-group), mRNA Length = 165 Score = 63.9 bits (32), Expect = 5e-07 Identities = 127/156 (81%), Gaps = 2/156 (1%) Strand = Plus / Minus Query: 240 cctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctcaaactggtc 299 ||||| |||||| ||||| |||||||| ||||||||||| |||| || ||||||||||| Sbjct: 156 cctggaaatcttcctttcttggcttgccatgctcttggcaagcttggcttcaaactggtc 97 Query: 300 agagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttccataa-gca 358 || || || ||| ||||| ||||||| ||| ||||||| || || ||||||| | Sbjct: 96 ggaaagagttctcttcctagctttctcag-cttgcacttgtggatactctccataaggtc 38 Query: 359 cacgcttgttcttgaacatgttacccttgaccttca 394 | | |||||| |||| |||||||||||||||||||| Sbjct: 37 ccctcttgttgttgagcatgttacccttgaccttca 2
>ref|XM_752688.1| Ustilago maydis 521 hypothetical protein (UM01634.1) partial mRNA Length = 588 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 349 tccataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatgg 408 |||||||||||||||||||||||||| | ||||||||| ||| | ||| | || ||| Sbjct: 419 tccataagcacacgcttgttcttgaaaacgttacccttcgacttgaggtaaagctcgtgg 360 Query: 409 tacatgtgcttgtcgatctt 428 |||| ||||||||||||||| Sbjct: 359 tacaggtgcttgtcgatctt 340
>gb|BC041546.1| Xenopus laevis ribosomal protein L19, mRNA (cDNA clone MGC:53844 IMAGE:5542707), complete cds Length = 688 Score = 63.9 bits (32), Expect = 5e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| || |||| ||||| | |||||||||||| | Sbjct: 415 acgcttgttcttgaacacgttaccctttactttcaggtacaggctgtggtacatgtgcct 356 Query: 420 gtcgatcttctt 431 ||| |||||||| Sbjct: 355 gtcaatcttctt 344
>gb|AF401574.1| Ictalurus punctatus ribosomal protein L19 mRNA, complete cds Length = 640 Score = 63.9 bits (32), Expect = 5e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| |||||| ||| || ||| ||||| | |||||||||||| | Sbjct: 418 acgcttgttcttgaacacgttacctttggccctcaggtacaggctgtggtacatgtgcct 359 Query: 420 gtcgatcttctt 431 |||||||||||| Sbjct: 358 gtcgatcttctt 347
>gb|AY168759.1| Branchiostoma belcheri tsingtaunese ribosomal protein L19 mRNA, complete cds Length = 728 Score = 63.9 bits (32), Expect = 5e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| |||||||||| |||||| ||||| | ||||||| ||||| Sbjct: 438 acgcttgttcttgaacacgttacccttggccttcatgtacagctggtggtacagatgctt 379 Query: 420 gtcgatcttctt 431 |||||| ||||| Sbjct: 378 gtcgattttctt 367
>emb|AM049063.1| Cicindela campestris mRNA for ribosomal protein L19e (rpL19e gene) Length = 600 Score = 61.9 bits (31), Expect = 2e-06 Identities = 37/39 (94%) Strand = Plus / Minus Query: 348 ttccataagcacacgcttgttcttgaacatgttaccctt 386 ||||||||| ||||||||||||||||||| ||||||||| Sbjct: 420 ttccataaggacacgcttgttcttgaacacgttaccctt 382
>ref|NM_206219.1| Drosophila melanogaster Ribosomal protein L19 CG2746-RB, transcript variant B (RpL19), mRNA Length = 751 Score = 61.9 bits (31), Expect = 2e-06 Identities = 61/71 (85%) Strand = Plus / Minus Query: 361 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 420 |||||||||||||| | |||||||||| ||||| ||||| ||| ||||||| |||| || Sbjct: 439 cgcttgttcttgaatacgttacccttgcacttcatgtacaggtcgtggtacaggtgcctg 380 Query: 421 tcgatcttctt 431 || |||||||| Sbjct: 379 tcaatcttctt 369
>ref|NM_057283.4| Drosophila melanogaster Ribosomal protein L19 CG2746-RA, transcript variant A (RpL19), mRNA Length = 793 Score = 61.9 bits (31), Expect = 2e-06 Identities = 61/71 (85%) Strand = Plus / Minus Query: 361 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 420 |||||||||||||| | |||||||||| ||||| ||||| ||| ||||||| |||| || Sbjct: 481 cgcttgttcttgaatacgttacccttgcacttcatgtacaggtcgtggtacaggtgcctg 422 Query: 421 tcgatcttctt 431 || |||||||| Sbjct: 421 tcaatcttctt 411
>gb|AC007884.5|AC007884 Drosophila melanogaster, chromosome 2R, region 60F-60F, BAC clone BACR08I14, complete sequence Length = 190616 Score = 61.9 bits (31), Expect = 2e-06 Identities = 61/71 (85%) Strand = Plus / Plus Query: 361 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 420 |||||||||||||| | |||||||||| ||||| ||||| ||| ||||||| |||| || Sbjct: 129049 cgcttgttcttgaatacgttacccttgcacttcatgtacaggtcgtggtacaggtgcctg 129108 Query: 421 tcgatcttctt 431 || |||||||| Sbjct: 129109 tcaatcttctt 129119
>gb|AY130453.1| Branchiostoma lanceolatum ribosomal protein L19 mRNA, partial cds Length = 588 Score = 61.9 bits (31), Expect = 2e-06 Identities = 61/71 (85%) Strand = Plus / Minus Query: 361 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 420 |||||||||||||||| ||||||||| |||||| ||||| | ||||||| |||||| Sbjct: 407 cgcttgttcttgaacacgttacccttcgccttcatgtacagctggtggtacagatgcttg 348 Query: 421 tcgatcttctt 431 ||||||||||| Sbjct: 347 tcgatcttctt 337
>gb|AY061217.1| Drosophila melanogaster LD16326 full insert cDNA Length = 793 Score = 61.9 bits (31), Expect = 2e-06 Identities = 61/71 (85%) Strand = Plus / Minus Query: 361 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 420 |||||||||||||| | |||||||||| ||||| ||||| ||| ||||||| |||| || Sbjct: 463 cgcttgttcttgaatacgttacccttgcacttcatgtacaggtcgtggtacaggtgcctg 404 Query: 421 tcgatcttctt 431 || |||||||| Sbjct: 403 tcaatcttctt 393
>gb|BT024264.1| Drosophila melanogaster IP15818 full insert cDNA Length = 748 Score = 61.9 bits (31), Expect = 2e-06 Identities = 61/71 (85%) Strand = Plus / Minus Query: 361 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 420 |||||||||||||| | |||||||||| ||||| ||||| ||| ||||||| |||| || Sbjct: 423 cgcttgttcttgaatacgttacccttgcacttcatgtacaggtcgtggtacaggtgcctg 364 Query: 421 tcgatcttctt 431 || |||||||| Sbjct: 363 tcaatcttctt 353
>gb|AE003465.3| Drosophila melanogaster chromosome 2R, section 72 of 73 of the complete sequence Length = 343833 Score = 61.9 bits (31), Expect = 2e-06 Identities = 61/71 (85%) Strand = Plus / Plus Query: 361 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 420 |||||||||||||| | |||||||||| ||||| ||||| ||| ||||||| |||| || Sbjct: 281353 cgcttgttcttgaatacgttacccttgcacttcatgtacaggtcgtggtacaggtgcctg 281412 Query: 421 tcgatcttctt 431 || |||||||| Sbjct: 281413 tcaatcttctt 281423
>ref|NM_117696.1| Arabidopsis thaliana structural constituent of ribosome AT4G16030 mRNA, complete cds Length = 306 Score = 58.0 bits (29), Expect = 3e-05 Identities = 65/77 (84%) Strand = Plus / Minus Query: 334 gacttgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgaccttc 393 |||||||| |||||||||||||| |||| |||||||||| | | || || || |||||| Sbjct: 185 gacttgtgcatgctttccataagaacacacttgttcttgtaaacttttcctttcaccttc 126 Query: 394 aagtacatgtcatggta 410 | | ||||||||||||| Sbjct: 125 atgaacatgtcatggta 109
>emb|AM049062.1| Carabus granulatus partial mRNA for ribosomal protein L19e (rpL19e gene) Length = 548 Score = 58.0 bits (29), Expect = 3e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 322 ttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaacatgtta 381 ||||||||||| |||||||||| |||||| || ||||||||||||||||||| ||| Sbjct: 394 ttctcagccttcttcttgtgaatgtattccatcaggacacgcttgttcttgaacacatta 335 Query: 382 ccctt 386 ||||| Sbjct: 334 ccctt 330
>gb|BT010624.1| Arabidopsis thaliana At4g16030 gene, complete cds Length = 270 Score = 58.0 bits (29), Expect = 3e-05 Identities = 65/77 (84%) Strand = Plus / Minus Query: 334 gacttgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgaccttc 393 |||||||| |||||||||||||| |||| |||||||||| | | || || || |||||| Sbjct: 185 gacttgtgcatgctttccataagaacacacttgttcttgtaaacttttcctttcaccttc 126 Query: 394 aagtacatgtcatggta 410 | | ||||||||||||| Sbjct: 125 atgaacatgtcatggta 109
>gb|AF548014.1| Spodoptera frugiperda ribosomal protein L19 mRNA, partial cds Length = 244 Score = 58.0 bits (29), Expect = 3e-05 Identities = 71/85 (83%) Strand = Plus / Minus Query: 316 ctagccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaac 375 ||||||||||||||||| | |||| ||| |||||||| |||||||||||||||||| Sbjct: 97 ctagccttctcagccttcttcctgtggatgtactccataagtacacgcttgttcttgaac 38 Query: 376 atgttacccttgaccttcaagtaca 400 | |||||||| |||||| ||||| Sbjct: 37 acattaccctttgccttcatgtaca 13
>emb|Z97340.2|ATFCA5 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 5 Length = 209164 Score = 58.0 bits (29), Expect = 3e-05 Identities = 65/77 (84%) Strand = Plus / Minus Query: 334 gacttgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgaccttc 393 |||||||| |||||||||||||| |||| |||||||||| | | || || || |||||| Sbjct: 50580 gacttgtgcatgctttccataagaacacacttgttcttgtaaacttttcctttcaccttc 50521 Query: 394 aagtacatgtcatggta 410 | | ||||||||||||| Sbjct: 50520 atgaacatgtcatggta 50504
>emb|AL161543.2|ATCHRIV43 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 43 Length = 198226 Score = 58.0 bits (29), Expect = 3e-05 Identities = 65/77 (84%) Strand = Plus / Minus Query: 334 gacttgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgaccttc 393 |||||||| |||||||||||||| |||| |||||||||| | | || || || |||||| Sbjct: 19570 gacttgtgcatgctttccataagaacacacttgttcttgtaaacttttcctttcaccttc 19511 Query: 394 aagtacatgtcatggta 410 | | ||||||||||||| Sbjct: 19510 atgaacatgtcatggta 19494
>dbj|AK175808.1| Arabidopsis thaliana mRNA for probable ribosomal protein, complete cds, clone: RAFL22-40-J11 Length = 1006 Score = 58.0 bits (29), Expect = 3e-05 Identities = 65/77 (84%) Strand = Plus / Minus Query: 334 gacttgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgaccttc 393 |||||||| |||||||||||||| |||| |||||||||| | | || || || |||||| Sbjct: 295 gacttgtgcatgctttccataagaacacacttgttcttgtaaacttttcctttcaccttc 236 Query: 394 aagtacatgtcatggta 410 | | ||||||||||||| Sbjct: 235 atgaacatgtcatggta 219
>dbj|AK175588.1| Arabidopsis thaliana mRNA for probable ribosomal protein, complete cds, clone: RAFL22-04-M21 Length = 1004 Score = 58.0 bits (29), Expect = 3e-05 Identities = 65/77 (84%) Strand = Plus / Minus Query: 334 gacttgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgaccttc 393 |||||||| |||||||||||||| |||| |||||||||| | | || || || |||||| Sbjct: 295 gacttgtgcatgctttccataagaacacacttgttcttgtaaacttttcctttcaccttc 236 Query: 394 aagtacatgtcatggta 410 | | ||||||||||||| Sbjct: 235 atgaacatgtcatggta 219
>emb|CR725299.2|CNS0GML5 Tetraodon nigroviridis full-length cDNA Length = 337 Score = 56.0 bits (28), Expect = 1e-04 Identities = 79/96 (82%) Strand = Plus / Minus Query: 336 cttgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgaccttcaa 395 |||||||||| |||||||| | ||||||||||| |||| ||||||||| |||||| Sbjct: 112 cttgtgaatgtgctccataaggatgcgcttgttcttaaacacattacccttggccttcag 53 Query: 396 gtacatgtcatggtacatgtgcttgtcgatcttctt 431 ||||| | |||||||||||| |||| |||||||| Sbjct: 52 gtacaggctgtggtacatgtgcctgtcaatcttctt 17
>emb|CR707866.2|CNS0G952 Tetraodon nigroviridis full-length cDNA Length = 335 Score = 56.0 bits (28), Expect = 1e-04 Identities = 79/96 (82%) Strand = Plus / Minus Query: 336 cttgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgaccttcaa 395 |||||||||| |||||||| | ||||||||||| |||| ||||||||| |||||| Sbjct: 112 cttgtgaatgtgctccataaggatgcgcttgttcttaaacacattacccttggccttcag 53 Query: 396 gtacatgtcatggtacatgtgcttgtcgatcttctt 431 ||||| | |||||||||||| |||| |||||||| Sbjct: 52 gtacaggctgtggtacatgtgcctgtcaatcttctt 17
>gb|AY829780.1| Lonomia obliqua ribosomal protein L19e mRNA, partial cds Length = 333 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 349 tccataagcacacgcttgttcttgaacatgttacccttgaccttcaagtaca 400 ||||| || ||||||||||||||||||| |||||||| ||||||| ||||| Sbjct: 149 tccatgaggacacgcttgttcttgaacacattacccttcaccttcatgtaca 98
>gb|AY648758.1| Danio rerio 60s ribosomal protein L19 mRNA, complete cds Length = 701 Score = 54.0 bits (27), Expect = 5e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 361 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 420 |||||||||||||||| ||||||||| || ||| |||| | |||||||||||| || Sbjct: 437 cgcttgttcttgaacacgttaccctttgccctcagatacaggctgtggtacatgtgcctg 378 Query: 421 tcgatcttctt 431 ||||||||||| Sbjct: 377 tcgatcttctt 367
>ref|NM_213208.1| Danio rerio ribosomal protein L19 (rpl19), mRNA Length = 762 Score = 54.0 bits (27), Expect = 5e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 361 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 420 |||||||||||||||| ||||||||| || ||| |||| | |||||||||||| || Sbjct: 431 cgcttgttcttgaacacgttaccctttgccctcagatacaggctgtggtacatgtgcctg 372 Query: 421 tcgatcttctt 431 ||||||||||| Sbjct: 371 tcgatcttctt 361
>gb|BC062844.1| Danio rerio ribosomal protein L19, mRNA (cDNA clone MGC:77733 IMAGE:7000768), complete cds Length = 762 Score = 54.0 bits (27), Expect = 5e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 361 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 420 |||||||||||||||| ||||||||| || ||| |||| | |||||||||||| || Sbjct: 431 cgcttgttcttgaacacgttaccctttgccctcagatacaggctgtggtacatgtgcctg 372 Query: 421 tcgatcttctt 431 ||||||||||| Sbjct: 371 tcgatcttctt 361
>gb|AY769289.1| Bombyx mori ribosomal protein L19 (RpL19) mRNA, complete cds Length = 720 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 349 tccataagcacacgcttgttcttgaacatgttaccctt 386 ||||| |||||||||||||||||||||| |||||||| Sbjct: 482 tccatgagcacacgcttgttcttgaacacattaccctt 445
>gb|DQ443429.1| Bombyx mori PDP protein mRNA, complete cds Length = 991 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 349 tccataagcacacgcttgttcttgaacatgttaccctt 386 ||||| |||||||||||||||||||||| |||||||| Sbjct: 547 tccatgagcacacgcttgttcttgaacacattaccctt 510
>gb|AY431470.1| Aedes aegypti ASAP ID: 35661 cytosolic large ribosomal subunit L19 mRNA sequence Length = 832 Score = 50.1 bits (25), Expect = 0.008 Identities = 58/69 (84%) Strand = Plus / Minus Query: 318 agccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaacat 377 ||||||||| |||||| |||||| ||| |||||| || | ||||||||||||||||| Sbjct: 499 agccttctcggcctttcgcttgtggatgtgttccatcaggatacgcttgttcttgaacac 440 Query: 378 gttaccctt 386 |||||||| Sbjct: 439 attaccctt 431
>gb|AY389933.1| Latimeria chalumnae ribosomal protein L19 mRNA, partial cds Length = 520 Score = 50.1 bits (25), Expect = 0.008 Identities = 37/41 (90%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtaca 400 ||||||||||||||||| |||||||| ||||||| ||||| Sbjct: 382 acgcttgttcttgaacacattacccttaaccttcaggtaca 342
>gb|DQ440220.1| Aedes aegypti clone AET-2449 ribosomal protein L19 mRNA, complete cds Length = 615 Score = 50.1 bits (25), Expect = 0.008 Identities = 58/69 (84%) Strand = Plus / Minus Query: 318 agccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaacat 377 ||||||||| |||||| |||||| ||| |||||| || | ||||||||||||||||| Sbjct: 450 agccttctcggcctttcgcttgtggatgtgttccatcaggatacgcttgttcttgaacac 391 Query: 378 gttaccctt 386 |||||||| Sbjct: 390 attaccctt 382
>emb|CR938671.1| Single read from an extremity of a full-length cDNA clone made from Aedes aegypti total adult females. 5-prime end of clone KW0AAA1YB11AAM1 from strain Liverpool of Aedes aegypti (yellow fever mosquito) Length = 610 Score = 50.1 bits (25), Expect = 0.008 Identities = 58/69 (84%) Strand = Plus / Minus Query: 318 agccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaacat 377 ||||||||| |||||| |||||| ||| |||||| || | ||||||||||||||||| Sbjct: 443 agccttctcggcctttcgcttgtggatgtgttccatcaggatacgcttgttcttgaacac 384 Query: 378 gttaccctt 386 |||||||| Sbjct: 383 attaccctt 375
>emb|CR938382.1| Single read from an extremity of a full-length cDNA clone made from Aedes aegypti total adult females. 5-prime end of clone KW0AAA2YB01AAM1 from strain Liverpool of Aedes aegypti (yellow fever mosquito) Length = 854 Score = 50.1 bits (25), Expect = 0.008 Identities = 58/69 (84%) Strand = Plus / Minus Query: 318 agccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaacat 377 ||||||||| |||||| |||||| ||| |||||| || | ||||||||||||||||| Sbjct: 482 agccttctcggcctttcgcttgtggatgtgttccatcaggatacgcttgttcttgaacac 423 Query: 378 gttaccctt 386 |||||||| Sbjct: 422 attaccctt 414
>emb|CR938187.1| Single read from an extremity of a full-length cDNA clone made from Aedes aegypti total adult females. 5-prime end of clone KW0AAA2YH14AAM1 from strain Liverpool of Aedes aegypti (yellow fever mosquito) Length = 844 Score = 50.1 bits (25), Expect = 0.008 Identities = 58/69 (84%) Strand = Plus / Minus Query: 318 agccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaacat 377 ||||||||| |||||| |||||| ||| |||||| || | ||||||||||||||||| Sbjct: 482 agccttctcggcctttcgcttgtggatgtgttccatcaggatacgcttgttcttgaacac 423 Query: 378 gttaccctt 386 |||||||| Sbjct: 422 attaccctt 414
>emb|CR938174.1| Single read from an extremity of a full-length cDNA clone made from Aedes aegypti total adult females. 5-prime end of clone KW0AAA2YH23AAM1 from strain Liverpool of Aedes aegypti (yellow fever mosquito) Length = 834 Score = 50.1 bits (25), Expect = 0.008 Identities = 58/69 (84%) Strand = Plus / Minus Query: 318 agccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaacat 377 ||||||||| |||||| |||||| ||| |||||| || | ||||||||||||||||| Sbjct: 482 agccttctcggcctttcgcttgtggatgtgttccatcaggatacgcttgttcttgaacac 423 Query: 378 gttaccctt 386 |||||||| Sbjct: 422 attaccctt 414
>emb|CR938138.1| Single read from an extremity of a full-length cDNA clone made from Aedes aegypti total adult females. 5-prime end of clone KW0AAA2YJ05AAM1 from strain Liverpool of Aedes aegypti (yellow fever mosquito) Length = 858 Score = 50.1 bits (25), Expect = 0.008 Identities = 58/69 (84%) Strand = Plus / Minus Query: 318 agccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaacat 377 ||||||||| |||||| |||||| ||| |||||| || | ||||||||||||||||| Sbjct: 486 agccttctcggcctttcgcttgtggatgtgttccatcaggatacgcttgttcttgaacac 427 Query: 378 gttaccctt 386 |||||||| Sbjct: 426 attaccctt 418
>emb|CR938033.1| Single read from an extremity of a full-length cDNA clone made from Aedes aegypti total adult females. 5-prime end of clone KW0AAA2YM17AAM1 from strain Liverpool of Aedes aegypti (yellow fever mosquito) Length = 737 Score = 50.1 bits (25), Expect = 0.008 Identities = 58/69 (84%) Strand = Plus / Minus Query: 318 agccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaacat 377 ||||||||| |||||| |||||| ||| |||||| || | ||||||||||||||||| Sbjct: 419 agccttctcggcctttcgcttgtggatgtgttccatcaggatacgcttgttcttgaacac 360 Query: 378 gttaccctt 386 |||||||| Sbjct: 359 attaccctt 351
>gb|AY130357.1| Petromyzon marinus ribosomal protein L19 mRNA, partial cds Length = 539 Score = 50.1 bits (25), Expect = 0.008 Identities = 73/89 (82%) Strand = Plus / Minus Query: 361 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 420 |||||||||||||||| |||||| || || |||| ||||| | ||||||||||| Sbjct: 381 cgcttgttcttgaacacgttacctttcactttcaggtacagattgtggtacatgtggcga 322 Query: 421 tcgatcttctttgcttcacggtacttgcg 449 ||||||||||| || || ||||||||||| Sbjct: 321 tcgatcttcttggcctcgcggtacttgcg 293
>gb|BC077657.1| Xenopus tropicalis MGC89675 protein, mRNA (cDNA clone MGC:89675 IMAGE:7026279), complete cds Length = 709 Score = 48.1 bits (24), Expect = 0.031 Identities = 69/84 (82%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 |||||| |||||||||| ||| ||||| || |||| |||| | |||||||||||| | Sbjct: 433 acgcttattcttgaacacgtttccctttactttcagatacaggctgtggtacatgtgcct 374 Query: 420 gtcgatcttctttgcttcacggta 443 ||| |||||||| | ||||||||| Sbjct: 373 gtcaatcttcttagattcacggta 350
>ref|NM_001005122.1| Xenopus tropicalis MGC89675 protein (MGC89675), mRNA Length = 709 Score = 48.1 bits (24), Expect = 0.031 Identities = 69/84 (82%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 |||||| |||||||||| ||| ||||| || |||| |||| | |||||||||||| | Sbjct: 433 acgcttattcttgaacacgtttccctttactttcagatacaggctgtggtacatgtgcct 374 Query: 420 gtcgatcttctttgcttcacggta 443 ||| |||||||| | ||||||||| Sbjct: 373 gtcaatcttcttagattcacggta 350
>gb|AY439425.1| Armigeres subalbatus ASAP ID: 39837 cytosolic large ribosomal subunit L19 mRNA sequence Length = 771 Score = 46.1 bits (23), Expect = 0.12 Identities = 57/69 (82%) Strand = Plus / Minus Query: 318 agccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaacat 377 |||||||||||||||| |||||| ||| ||||| || | ||||||| ||||||||| Sbjct: 486 agccttctcagcctttcgcttgtggatgtgctccatcaggatacgcttgytcttgaacac 427 Query: 378 gttaccctt 386 |||||||| Sbjct: 426 attaccctt 418
>ref|XM_549228.2| PREDICTED: Canis familiaris similar to ribosomal protein L19 (LOC492107), mRNA Length = 473 Score = 46.1 bits (23), Expect = 0.12 Identities = 35/39 (89%) Strand = Plus / Minus Query: 362 gcttgttcttgaacatgttacccttgaccttcaagtaca 400 ||||||||||||||| ||||||||| || |||| ||||| Sbjct: 214 gcttgttcttgaacacgttacccttcactttcaggtaca 176
>ref|XM_572717.1| Cryptococcus neoformans var. neoformans JEC21 60S ribosomal protein L19 (CNI01090) partial mRNA Length = 677 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 406 tggtacatgtgcttgtcgatctt 428 ||||||||||||||||||||||| Sbjct: 377 tggtacatgtgcttgtcgatctt 355
>ref|XM_859015.1| PREDICTED: Canis familiaris Ribosomal protein L19, transcript variant 4 (RPL19), mRNA Length = 706 Score = 46.1 bits (23), Expect = 0.12 Identities = 68/83 (81%) Strand = Plus / Minus Query: 361 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 420 |||||||||||||||| |||||||| || |||| ||||| | ||| |||||||| | Sbjct: 434 cgcttgttcttgaacacattacccttcactttcaggtacaggctatgatacatgtggcgg 375 Query: 421 tcgatcttctttgcttcacggta 443 || |||||||| | ||||||||| Sbjct: 374 tcaatcttcttagattcacggta 352
>ref|XM_858990.1| PREDICTED: Canis familiaris Ribosomal protein L19, transcript variant 3 (RPL19), mRNA Length = 578 Score = 46.1 bits (23), Expect = 0.12 Identities = 68/83 (81%) Strand = Plus / Minus Query: 361 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 420 |||||||||||||||| |||||||| || |||| ||||| | ||| |||||||| | Sbjct: 306 cgcttgttcttgaacacattacccttcactttcaggtacaggctatgatacatgtggcgg 247 Query: 421 tcgatcttctttgcttcacggta 443 || |||||||| | ||||||||| Sbjct: 246 tcaatcttcttagattcacggta 224
>ref|XM_858974.1| PREDICTED: Canis familiaris Ribosomal protein L19, transcript variant 2 (RPL19), mRNA Length = 702 Score = 46.1 bits (23), Expect = 0.12 Identities = 68/83 (81%) Strand = Plus / Minus Query: 361 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 420 |||||||||||||||| |||||||| || |||| ||||| | ||| |||||||| | Sbjct: 433 cgcttgttcttgaacacattacccttcactttcaggtacaggctatgatacatgtggcgg 374 Query: 421 tcgatcttctttgcttcacggta 443 || |||||||| | ||||||||| Sbjct: 373 tcaatcttcttagattcacggta 351
>ref|XM_537655.2| PREDICTED: Canis familiaris Ribosomal protein L19, transcript variant 1 (RPL19), mRNA Length = 735 Score = 46.1 bits (23), Expect = 0.12 Identities = 68/83 (81%) Strand = Plus / Minus Query: 361 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 420 |||||||||||||||| |||||||| || |||| ||||| | ||| |||||||| | Sbjct: 463 cgcttgttcttgaacacattacccttcactttcaggtacaggctatgatacatgtggcgg 404 Query: 421 tcgatcttctttgcttcacggta 443 || |||||||| | ||||||||| Sbjct: 403 tcaatcttcttagattcacggta 381
>emb|BX072418.1|CNS09S1I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAD1BC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 615 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Plus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 232 gtcgattttcttcgcctcacggtactt 258
>emb|BX072399.1|CNS09S0Z Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAD1BC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 530 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Plus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 232 gtcgattttcttcgcctcacggtactt 258
>emb|BX072398.1|CNS09S0Y Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAD1BC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 637 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 461 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 402 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 401 gtcgattttcttcgcctcacggtactt 375
>emb|BX072218.1|CNS09RVY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAD1AC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 468 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Plus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 232 gtcgattttcttcgcctcacggtactt 258
>emb|BX072217.1|CNS09RVX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAD1AC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 712 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 463 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 404 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 403 gtcgattttcttcgcctcacggtactt 377
>emb|BX072184.1|CNS09RV0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAD1AB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 511 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Plus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 232 gtcgattttcttcgcctcacggtactt 258
>emb|BX072183.1|CNS09RUZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAD1AB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 615 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 458 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 399 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 398 gtcgattttcttcgcctcacggtactt 372
>emb|BX071678.1|CNS09RGY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9BC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 745 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Plus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 245 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 304 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 305 gtcgattttcttcgcctcacggtactt 331
>emb|BX071677.1|CNS09RGX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9BC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 703 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttaccctt 386 ||||||||||||||||| ||||||||| Sbjct: 393 acgcttgttcttgaacacgttaccctt 367
>emb|BX066612.1|CNS09NK8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5DH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 929 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Plus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 633 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 692 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 693 gtcgattttcttcgcctcacggtactt 719
>emb|BX066611.1|CNS09NK7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5DH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 981 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 445 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 386 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 385 gtcgattttcttcgcctcacggtactt 359
>emb|BX063837.1|CNS09LF5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45DE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 584 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Plus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 264 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 323 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 324 gtcgattttcttcgcctcacggtactt 350
>emb|BX063836.1|CNS09LF4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45DE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1016 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 748 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 689 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 688 gtcgattttcttcgcctcacggtactt 662
>emb|BX059860.1|CNS09ICO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4DH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 626 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 322 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 263 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 262 gtcgattttcttcgcctcacggtactt 236
>emb|BX059159.1|CNS09HT7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39DE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 673 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Plus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 232 gtcgattttcttcgcctcacggtactt 258
>emb|BX057349.1|CNS09GEX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37BA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 239 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttaccctt 386 ||||||||||||||||| ||||||||| Sbjct: 166 acgcttgttcttgaacacgttaccctt 140
>emb|BX056471.1|CNS09FQJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35DB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 297 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttaccctt 386 ||||||||||||||||| ||||||||| Sbjct: 105 acgcttgttcttgaacacgttaccctt 79
>emb|BX055496.1|CNS09EZG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34AE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 771 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 444 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 385 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 384 gtcgattttcttcgcctcacggtactt 358
>emb|BX054547.1|CNS09E93 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC32DA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 675 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Plus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 232 gtcgattttcttcgcctcacggtactt 258
>emb|BX054546.1|CNS09E92 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32DA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 751 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 446 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 387 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 386 gtcgattttcttcgcctcacggtactt 360
>emb|BX052331.1|CNS09CJJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC3BE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 749 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 440 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 381 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 380 gtcgattttcttcgcctcacggtactt 354
>emb|BX050811.1|CNS09BDB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC27CA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 920 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttaccctt 386 ||||||||||||||||| ||||||||| Sbjct: 441 acgcttgttcttgaacacgttaccctt 415
>emb|BX030921.1|CNS08W0T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA46AF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 751 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 433 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 374 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 373 gtcgattttcttcgcctcacggtactt 347
>emb|BX030866.1|CNS08VZA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA46AD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 751 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 437 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 378 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 377 gtcgattttcttcgcctcacggtactt 351
>emb|BX041770.1|CNS094E6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC13BF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 754 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 439 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 380 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 379 gtcgattttcttcgcctcacggtactt 353
>emb|BX039610.1|CNS092Q6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC10AA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 291 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Plus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 232 gtcgattttcttcgcctcacggtactt 258
>emb|BX039182.1|CNS092EA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB3DF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 653 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Plus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 232 gtcgattttcttcgcctcacggtactt 258
>emb|BX039161.1|CNS092DP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB3DE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 310 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Plus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 232 gtcgattttcttcgcctcacggtactt 258
>emb|BX038823.1|CNS0924B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB3BE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 662 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 460 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 401 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 400 gtcgattttcttcgcctcacggtactt 374
>emb|BX038377.1|CNS091RX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB2DA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 609 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Plus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 232 gtcgattttcttcgcctcacggtactt 258
>emb|BX038376.1|CNS091RW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB2DA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 734 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 446 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 387 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 386 gtcgattttcttcgcctcacggtactt 360
>emb|BX038311.1|CNS091Q3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB2CF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 755 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 457 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 398 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 397 gtcgattttcttcgcctcacggtactt 371
>emb|BX038155.1|CNS091LR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB2BF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 339 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Plus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 232 gtcgattttcttcgcctcacggtactt 258
>emb|BX038154.1|CNS091LQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB2BF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 750 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 467 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 408 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 407 gtcgattttcttcgcctcacggtactt 381
>emb|BX038058.1|CNS091J2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB2BB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 683 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 458 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 399 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 398 gtcgattttcttcgcctcacggtactt 372
>emb|BX038043.1|CNS091IN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB2BA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 756 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 459 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 400 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 399 gtcgattttcttcgcctcacggtactt 373
>emb|BX038006.1|CNS091HM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB2AG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 746 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 459 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 400 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 399 gtcgattttcttcgcctcacggtactt 373
>emb|BX037816.1|CNS091CC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB1BG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 601 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 466 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 407 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 406 gtcgattttcttcgcctcacggtactt 380
>emb|BX037762.1|CNS091AU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB1BD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 535 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Plus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 232 gtcgattttcttcgcctcacggtactt 258
>emb|BX037761.1|CNS091AT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB1BD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 649 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 458 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 399 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 398 gtcgattttcttcgcctcacggtactt 372
>emb|BX037665.1|CNS09185 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB1AH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 551 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Plus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 232 gtcgattttcttcgcctcacggtactt 258
>emb|BX037664.1|CNS09184 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB1AH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 634 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 462 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 403 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 402 gtcgattttcttcgcctcacggtactt 376
>emb|BX036410.1|CNS0909A Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA8BB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 680 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Plus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 232 gtcgattttcttcgcctcacggtactt 258
>emb|BX036409.1|CNS09099 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA8BB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 725 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttaccctt 386 ||||||||||||||||| ||||||||| Sbjct: 430 acgcttgttcttgaacacgttaccctt 404
>emb|BX035051.1|CNS08Z7J Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA6AH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 616 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 431 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 372 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 371 gtcgattttcttcgcctcacggtactt 345
>emb|BX033777.1|CNS08Y85 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA5BF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 660 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Plus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 232 gtcgattttcttcgcctcacggtactt 258
>emb|BX033776.1|CNS08Y84 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA5BF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 748 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 432 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 373 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 372 gtcgattttcttcgcctcacggtactt 346
>emb|BX033726.1|CNS08Y6Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA5BD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 757 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 447 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 388 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 387 gtcgattttcttcgcctcacggtactt 361
>emb|BX033086.1|CNS08XOY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA49BE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 751 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 437 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 378 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 377 gtcgattttcttcgcctcacggtactt 351
>emb|BX032914.1|CNS08XK6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA49AD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 645 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Plus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 232 gtcgattttcttcgcctcacggtactt 258
>emb|BX032913.1|CNS08XK5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA49AD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 736 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 430 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 371 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 370 gtcgattttcttcgcctcacggtactt 344
>emb|BX032398.1|CNS08X5U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA48BB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 272 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Plus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 232 gtcgattttcttcgcctcacggtactt 258
>emb|BX032397.1|CNS08X5T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA48BB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 464 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 396 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 337 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 336 gtcgattttcttcgcctcacggtactt 310
>emb|BX031307.1|CNS08WBJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA46CG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 764 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 442 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 383 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 382 gtcgattttcttcgcctcacggtactt 356
>emb|BX030422.1|CNS08VMY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA45BF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 742 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 431 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 372 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 371 gtcgattttcttcgcctcacggtactt 345
>emb|BX030095.1|CNS08VDV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA44DG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 668 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 360 acgcttgttcttgaacatgttaccctt 386 ||||||||||||||||| ||||||||| Sbjct: 172 acgcttgttcttgaacacgttaccctt 198
>emb|BX030094.1|CNS08VDU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA44DG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 745 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 433 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 374 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 373 gtcgattttcttcgcctcacggtactt 347
>emb|BX028661.1|CNS08UA1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA42DC08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 755 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 434 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 375 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 374 gtcgattttcttcgcctcacggtactt 348
>emb|BX027463.1|CNS08TCR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA41AE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 348 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 360 acgcttgttcttgaacatgttaccctt 386 ||||||||||||||||| ||||||||| Sbjct: 173 acgcttgttcttgaacacgttaccctt 199
>emb|BX027462.1|CNS08TCQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA41AE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 515 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 448 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 389 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 388 gtcgattttcttcgcctcacggtactt 362
>emb|BX026971.1|CNS08SZ3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA40BH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 525 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 210 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 151 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 150 gtcgattttcttcgcctcacggtactt 124
>emb|BX026323.1|CNS08SH3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA4CC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 618 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 435 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 376 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 375 gtcgattttcttcgcctcacggtactt 349
>emb|BX026099.1|CNS08SAV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA4BA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 746 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 440 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 381 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 380 gtcgattttcttcgcctcacggtactt 354
>emb|BX025970.1|CNS08S7A Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA4AB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 749 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 427 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 368 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 367 gtcgattttcttcgcctcacggtactt 341
>emb|BX022898.1|CNS08PTY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA35AA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 631 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 451 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 392 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 391 gtcgattttcttcgcctcacggtactt 365
>emb|BX022839.1|CNS08PSB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA34DG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 169 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 108 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 49 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 48 gtcgattttcttcgcctcacggtactt 22
>emb|BX022814.1|CNS08PRM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA34DE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 624 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 452 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 393 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 392 gtcgattttcttcgcctcacggtactt 366
>emb|BX024692.1|CNS08R7S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA37DB12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 754 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 436 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 377 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 376 gtcgattttcttcgcctcacggtactt 350
>emb|BX024544.1|CNS08R3O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA37BH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 694 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 406 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 347 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 346 gtcgattttcttcgcctcacggtactt 320
>emb|BX023626.1|CNS08QE6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA36AD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 771 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 444 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 385 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 384 gtcgattttcttcgcctcacggtactt 358
>emb|BX023558.1|CNS08QCA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA36AA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 768 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 445 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 386 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 385 gtcgattttcttcgcctcacggtactt 359
>emb|BX022610.1|CNS08PLY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA34CD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 553 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 453 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 394 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 393 gtcgattttcttcgcctcacggtactt 367
>emb|BX022499.1|CNS08PIV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA34BG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 705 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 395 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 336 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 335 gtcgattttcttcgcctcacggtactt 309
>emb|BX021000.1|CNS08OD8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA31AC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 767 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttaccctt 386 ||||||||||||||||| ||||||||| Sbjct: 455 acgcttgttcttgaacacgttaccctt 429
>emb|BX020965.1|CNS08OC9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA31AA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 636 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 448 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 389 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 388 gtcgattttcttcgcctcacggtactt 362
>emb|BX020716.1|CNS08O5C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA30CB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 659 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 440 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 381 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 380 gtcgattttcttcgcctcacggtactt 354
>emb|BX019823.1|CNS08NGJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA3BA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 740 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttaccctt 386 ||||||||||||||||| ||||||||| Sbjct: 426 acgcttgttcttgaacacgttaccctt 400
>emb|BX019178.1|CNS08MYM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA29AG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 756 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttaccctt 386 ||||||||||||||||| ||||||||| Sbjct: 441 acgcttgttcttgaacacgttaccctt 415
>emb|BX018850.1|CNS08MPI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA28CE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 744 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 428 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 369 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 368 gtcgattttcttcgcctcacggtactt 342
>emb|BX018223.1|CNS08M83 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA27CD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 318 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Plus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 232 gtcgattttcttcgcctcacggtactt 258
>emb|BX018222.1|CNS08M82 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA27CD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 754 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttaccctt 386 ||||||||||||||||| ||||||||| Sbjct: 449 acgcttgttcttgaacacgttaccctt 423
>emb|BX016569.1|CNS08KY5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA24DF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 427 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttaccctt 386 ||||||||||||||||| ||||||||| Sbjct: 107 acgcttgttcttgaacacgttaccctt 81
>emb|BX015711.1|CNS08KAB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA23CD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 449 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 442 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 383 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 382 gtcgattttcttcgcctcacggtactt 356
>emb|BX013212.1|CNS08ICW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA2DF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 665 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 360 acgcttgttcttgaacatgttaccctt 386 ||||||||||||||||| ||||||||| Sbjct: 172 acgcttgttcttgaacacgttaccctt 198
>emb|BX013211.1|CNS08ICV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA2DF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 745 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 434 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 375 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 374 gtcgattttcttcgcctcacggtactt 348
>emb|BX011390.1|CNS08GYA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA18AH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 663 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 442 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 383 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 382 gtcgattttcttcgcctcacggtactt 356
>emb|BX010651.1|CNS08GDR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA17AE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 666 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 360 acgcttgttcttgaacatgttaccctt 386 ||||||||||||||||| ||||||||| Sbjct: 172 acgcttgttcttgaacacgttaccctt 198
>emb|BX010223.1|CNS08G1V Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA16BH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 523 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 219 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 160 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 159 gtcgattttcttcgcctcacggtactt 133
>emb|BX007556.1|CNS08DZS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA12CD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 769 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 451 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 392 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 391 gtcgattttcttcgcctcacggtactt 365
>emb|BX007498.1|CNS08DY6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA12CA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 754 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 437 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 378 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 377 gtcgattttcttcgcctcacggtactt 351
>emb|BX007416.1|CNS08DVW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA12BE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 507 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 186 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 127 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 126 gtcgattttcttcgcctcacggtactt 100
>emb|BX007311.1|CNS08DSZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA12BA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 659 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 340 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 281 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 280 gtcgattttcttcgcctcacggtactt 254
>emb|BX007293.1|CNS08DSH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA12AH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 737 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 426 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 367 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 366 gtcgattttcttcgcctcacggtactt 340
>gb|AF526203.1| Argopecten irradians isolate iolsaicl5ct12cn12 ribosomal protein L19 mRNA, partial cds Length = 643 Score = 46.1 bits (23), Expect = 0.12 Identities = 98/123 (79%) Strand = Plus / Minus Query: 315 tctagccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaa 374 |||||||||||| ||||| ||||||||| ||||| | |||||||||||||||||| Sbjct: 466 tctagccttctcggccttcctcttgtgaatatgctccatcaacacacgcttgttcttgaa 407 Query: 375 catgttacccttgaccttcaagtacatgtcatggtacatgtgcttgtcgatcttctttgc 434 |||||| ||| |||| ||||| || ||||||| ||||||||||| ||||| || Sbjct: 406 gccgttacctttgcatttcatgtacagctcgtggtacagatgcttgtcgattttcttggc 347 Query: 435 ttc 437 ||| Sbjct: 346 ttc 344
>emb|AJ563476.1|CGI563476 Crassostrea gigas partial mRNA for ribosomal protein L19 (rpls gene) Length = 604 Score = 46.1 bits (23), Expect = 0.12 Identities = 62/75 (82%) Strand = Plus / Minus Query: 363 cttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttgtc 422 |||||||||||| |||||| ||| ||||| ||||| |||||||| | ||||||||| Sbjct: 412 cttgttcttgaatccgttacctttgctcttcatgtacagttcatggtataagtgcttgtc 353 Query: 423 gatcttctttgcttc 437 ||| ||||| ||||| Sbjct: 352 gattttcttggcttc 338
>ref|XM_313705.2| Anopheles gambiae str. PEST ENSANGP00000017616 (ENSANGG00000015127), partial mRNA Length = 662 Score = 46.1 bits (23), Expect = 0.12 Identities = 71/87 (81%) Strand = Plus / Minus Query: 360 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 419 ||||||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| Sbjct: 461 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 402 Query: 420 gtcgatcttctttgcttcacggtactt 446 |||||| ||||| || ||||||||||| Sbjct: 401 gtcgattttcttcgcctcacggtactt 375
>emb|AJ388522.1|CFA388522 Canis familiaris mRNA for partial Ribosomal protein L19 (rpL19 gene) Length = 342 Score = 46.1 bits (23), Expect = 0.12 Identities = 68/83 (81%) Strand = Plus / Minus Query: 361 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 420 |||||||||||||||| |||||||| || |||| ||||| | ||| |||||||| | Sbjct: 318 cgcttgttcttgaacacattacccttcactttcaggtacaggctatgatacatgtggcgg 259 Query: 421 tcgatcttctttgcttcacggta 443 || |||||||| | ||||||||| Sbjct: 258 tcaatcttcttagattcacggta 236
>gb|AY753669.1| Enterobacteria phage D6 immC region, complete sequence Length = 7644 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 174 tgccgctgcaggttgagcagga 195 |||||||||||||||||||||| Sbjct: 79 tgccgctgcaggttgagcagga 100
>emb|AM049064.1| Curculio glandium partial mRNA for ribosomal protein L19e (rpL19e gene) Length = 414 Score = 44.1 bits (22), Expect = 0.48 Identities = 34/38 (89%) Strand = Plus / Minus Query: 363 cttgttcttgaacatgttacccttgaccttcaagtaca 400 |||||||||||||| ||||||||| |||||| ||||| Sbjct: 405 cttgttcttgaacacgttacccttacccttcatgtaca 368
>ref|XM_763259.1| Giardia lamblia ATCC 50803 hypothetical protein (GLP_72_19704_20255) partial mRNA Length = 552 Score = 44.1 bits (22), Expect = 0.48 Identities = 25/26 (96%) Strand = Plus / Plus Query: 361 cgcttgttcttgaacatgttaccctt 386 ||||| |||||||||||||||||||| Sbjct: 284 cgcttattcttgaacatgttaccctt 309
>ref|XM_763260.1| Giardia lamblia ATCC 50803 60S ribosomal protein L19B (GLP_72_20393_19803) partial mRNA Length = 591 Score = 44.1 bits (22), Expect = 0.48 Identities = 25/26 (96%) Strand = Plus / Minus Query: 361 cgcttgttcttgaacatgttaccctt 386 ||||| |||||||||||||||||||| Sbjct: 407 cgcttattcttgaacatgttaccctt 382
>emb|CT010474.12| Mouse DNA sequence from clone RP23-199B14 on chromosome 12, complete sequence Length = 205340 Score = 44.1 bits (22), Expect = 0.48 Identities = 25/26 (96%) Strand = Plus / Plus Query: 72 aacaaaacagttcatacttgaaaatt 97 |||||||||||||| ||||||||||| Sbjct: 27956 aacaaaacagttcacacttgaaaatt 27981
>gb|AC131991.8| Mus musculus chromosome 12, clone RP24-190H17, complete sequence Length = 148426 Score = 44.1 bits (22), Expect = 0.48 Identities = 25/26 (96%) Strand = Plus / Plus Query: 72 aacaaaacagttcatacttgaaaatt 97 |||||||||||||| ||||||||||| Sbjct: 112983 aacaaaacagttcacacttgaaaatt 113008
>emb|CR388097.9| Zebrafish DNA sequence from clone CH211-10J9 in linkage group 3, complete sequence Length = 195927 Score = 44.1 bits (22), Expect = 0.48 Identities = 25/26 (96%) Strand = Plus / Plus Query: 361 cgcttgttcttgaacatgttaccctt 386 |||||||||||||||| ||||||||| Sbjct: 124539 cgcttgttcttgaacacgttaccctt 124564
>ref|XM_518463.1| PREDICTED: Pan troglodytes forkhead box P4 (LOC462682), mRNA Length = 1744 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Minus Query: 174 tgccgctgcaggttgagcaggagctgctg 202 |||| |||||||||||||||| ||||||| Sbjct: 618 tgcctctgcaggttgagcaggtgctgctg 590
>ref|NM_138457.2| Homo sapiens forkhead box P4 (FOXP4), transcript variant 2, mRNA Length = 5926 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Minus Query: 174 tgccgctgcaggttgagcaggagctgctg 202 |||| |||||||||||||||| ||||||| Sbjct: 1057 tgcctctgcaggttgagcaggtgctgctg 1029
>ref|NM_001012427.1| Homo sapiens forkhead box P4 (FOXP4), transcript variant 3, mRNA Length = 5959 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Minus Query: 174 tgccgctgcaggttgagcaggagctgctg 202 |||| |||||||||||||||| ||||||| Sbjct: 1051 tgcctctgcaggttgagcaggtgctgctg 1023
>ref|NM_001012426.1| Homo sapiens forkhead box P4 (FOXP4), transcript variant 1, mRNA Length = 5965 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Minus Query: 174 tgccgctgcaggttgagcaggagctgctg 202 |||| |||||||||||||||| ||||||| Sbjct: 1057 tgcctctgcaggttgagcaggtgctgctg 1029
>emb|AM049065.1| Meladema coriacea mRNA for ribosomal protein L19e (rpL19e gene) Length = 600 Score = 42.1 bits (21), Expect = 1.9 Identities = 54/65 (83%) Strand = Plus / Minus Query: 336 cttgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgaccttcaa 395 |||||||||| |||||| || ||||| ||||||||||| | |||||||| |||||| Sbjct: 432 cttgtgaatgtattccatgaggacacgtttgttcttgaagacattacccttcgccttcat 373 Query: 396 gtaca 400 ||||| Sbjct: 372 gtaca 368
>emb|AM049061.1| Biphyllus lunatus partial mRNA for ribosomal protein L19e (rpL19e gene) Length = 489 Score = 42.1 bits (21), Expect = 1.9 Identities = 45/53 (84%) Strand = Plus / Minus Query: 348 ttccataagcacacgcttgttcttgaacatgttacccttgaccttcaagtaca 400 ||||||||| || | |||||||||||| | |||||||||| | |||| ||||| Sbjct: 309 ttccataagaactctcttgttcttgaatacgttacccttggctttcatgtaca 257
>emb|Z98949.1|HS125H2 Human DNA sequence from clone CTA-125H2 on chromosome 22q11-12, complete sequence Length = 173513 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 217 ccctgagcaagcctctcctcc 237 ||||||||||||||||||||| Sbjct: 29799 ccctgagcaagcctctcctcc 29779
>emb|AL445472.15| Human DNA sequence from clone RP13-137O5 on chromosome X Contains the 5' end of a novel gene, complete sequence Length = 65349 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 232 tcctccctcctggcaatctttcttt 256 ||||||||||||||| ||||||||| Sbjct: 14113 tcctccctcctggcattctttcttt 14137
>emb|AL139331.19| Human DNA sequence from clone RP11-328M4 on chromosome 6 Contains a novel gene, the FOXP4 gene for forkhead box P4 and five CpG islands, complete sequence Length = 180547 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Minus Query: 174 tgccgctgcaggttgagcaggagctgctg 202 |||| |||||||||||||||| ||||||| Sbjct: 158637 tgcctctgcaggttgagcaggtgctgctg 158609
>emb|X53633.1|CTPOX18 C.tropicalis POX18 gene Length = 1428 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 375 catgttacccttgaccttcaa 395 ||||||||||||||||||||| Sbjct: 1067 catgttacccttgaccttcaa 1047
>emb|AJ310932.1|HSA310932 Homo sapiens MYO18B gene for myosin heavy chain, exons 1-44 Length = 288888 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 217 ccctgagcaagcctctcctcc 237 ||||||||||||||||||||| Sbjct: 122380 ccctgagcaagcctctcctcc 122360
>gb|AC147541.8| Pan troglodytes clone rp43-31n2, complete sequence Length = 39420 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 217 ccctgagcaagcctctcctcc 237 ||||||||||||||||||||| Sbjct: 14094 ccctgagcaagcctctcctcc 14074
>gb|AY857433.1| Suberites domuncula L19 mRNA, complete cds Length = 600 Score = 42.1 bits (21), Expect = 1.9 Identities = 36/41 (87%) Strand = Plus / Minus Query: 349 tccataagcacacgcttgttcttgaacatgttacccttgac 389 ||||| || ||||| |||||||| |||| |||||||||||| Sbjct: 419 tccatgagtacacgtttgttcttaaacacgttacccttgac 379
>gb|AC096533.3| Homo sapiens chromosome 1 clone RP11-6B6, complete sequence Length = 163339 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 215 ggccctgagcaagcctctcct 235 ||||||||||||||||||||| Sbjct: 50040 ggccctgagcaagcctctcct 50060
>emb|BX120013.5| Zebrafish DNA sequence from clone DKEY-76H10, complete sequence Length = 170264 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 ctgaacaaaacagttcatact 89 ||||||||||||||||||||| Sbjct: 111783 ctgaacaaaacagttcatact 111803
>gb|BC052803.1| Homo sapiens forkhead box P4, transcript variant 3, mRNA (cDNA clone MGC:59875 IMAGE:6420057), complete cds Length = 3311 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Minus Query: 174 tgccgctgcaggttgagcaggagctgctg 202 |||| |||||||||||||||| ||||||| Sbjct: 829 tgcctctgcaggttgagcaggtgctgctg 801
>dbj|AB080747.1| Homo sapiens hFKHLA mRNA for fork head-related protein like A, complete cds Length = 3770 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Minus Query: 174 tgccgctgcaggttgagcaggagctgctg 202 |||| |||||||||||||||| ||||||| Sbjct: 611 tgcctctgcaggttgagcaggtgctgctg 583
>gb|BC040962.1| Homo sapiens forkhead box P4, mRNA (cDNA clone MGC:48953 IMAGE:5527139), complete cds Length = 4186 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Minus Query: 174 tgccgctgcaggttgagcaggagctgctg 202 |||| |||||||||||||||| ||||||| Sbjct: 1057 tgcctctgcaggttgagcaggtgctgctg 1029
>gb|M24440.1|YSAPOX18A Candida tropicalis (ATCC 20336)small aleate-inducible peroxisomal protein gene, complete cds Length = 1259 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 375 catgttacccttgaccttcaa 395 ||||||||||||||||||||| Sbjct: 915 catgttacccttgaccttcaa 895
>dbj|D86472.1| Candida tropicalis pox18-2 gene for PXP-18, complete cds Length = 1428 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 375 catgttacccttgaccttcaa 395 ||||||||||||||||||||| Sbjct: 971 catgttacccttgaccttcaa 951
>gb|AC152944.2| Mus musculus 10 BAC RP23-427I4 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 179149 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 320 ccttctcagcctttgacttgtgaa 343 ||||||||||||||||| |||||| Sbjct: 76853 ccttctcagcctttgacctgtgaa 76830
>ref|XM_631874.1| Dictyostelium discoideum hypothetical protein (DDB0187709), partial mRNA Length = 633 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 99 agataagaccaaactgattt 118 |||||||||||||||||||| Sbjct: 143 agataagaccaaactgattt 124
>gb|AE017349.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 9, complete sequence Length = 1178688 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 409 tacatgtgcttgtcgatctt 428 |||||||||||||||||||| Sbjct: 273528 tacatgtgcttgtcgatctt 273509
>gb|BC068015.1| Danio rerio zgc:77348, mRNA (cDNA clone MGC:77348 IMAGE:6968172), complete cds Length = 6276 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 474 cctcctcatccacagaatct 493 |||||||||||||||||||| Sbjct: 3378 cctcctcatccacagaatct 3397
>ref|XR_002473.1| PREDICTED: Mus musculus hypothetical LOC631067 (LOC631067), mRNA Length = 744 Score = 40.1 bits (20), Expect = 7.6 Identities = 35/40 (87%) Strand = Plus / Minus Query: 361 cgcttgttcttgaacatgttacccttgaccttcaagtaca 400 |||||||| ||||||| || ||||||||||||| ||||| Sbjct: 445 cgcttgtttttgaacacattccccttgaccttcaggtaca 406
>emb|CR376824.10| Zebrafish DNA sequence from clone DKEY-9P24 in linkage group 23, complete sequence Length = 235026 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 474 cctcctcatccacagaatct 493 |||||||||||||||||||| Sbjct: 109097 cctcctcatccacagaatct 109116
>ref|XM_862965.1| PREDICTED: Canis familiaris similar to Disabled homolog 2 (Differentially expressed protein 2) (DOC-2), transcript variant 4 (LOC479353), mRNA Length = 3074 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 152 ttcacttctttgacttcttt 171 |||||||||||||||||||| Sbjct: 1976 ttcacttctttgacttcttt 1957
>ref|XM_862961.1| PREDICTED: Canis familiaris similar to Disabled homolog 2 (Differentially expressed protein 2) (DOC-2), transcript variant 3 (LOC479353), mRNA Length = 2483 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 152 ttcacttctttgacttcttt 171 |||||||||||||||||||| Sbjct: 1385 ttcacttctttgacttcttt 1366
>ref|XM_536493.2| PREDICTED: Canis familiaris similar to Disabled homolog 2 (Differentially expressed protein 2) (DOC-2), transcript variant 1 (LOC479353), mRNA Length = 3144 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 152 ttcacttctttgacttcttt 171 |||||||||||||||||||| Sbjct: 2046 ttcacttctttgacttcttt 2027
>gb|AC097354.12| Mus musculus strain 129/Sv clone ct7-297f7 map X, complete sequence Length = 242318 Score = 40.1 bits (20), Expect = 7.6 Identities = 29/32 (90%) Strand = Plus / Plus Query: 385 ttgaccttcaagtacatgtcatggtacatgtg 416 ||||||| || || |||||||||||||||||| Sbjct: 127121 ttgacctccatgtgcatgtcatggtacatgtg 127152
>emb|AL354981.41| Human DNA sequence from clone RP11-696J10 on chromosome 9 Contains part of the ASTN2 gene for astrotactin 2 (KIAA0634), complete sequence Length = 117488 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 ccagggtatctgggataaca 34 |||||||||||||||||||| Sbjct: 109976 ccagggtatctgggataaca 109957
>gb|AC116071.5| Rattus norvegicus 3 BAC CH230-230O7 (Children's Hospital Oakland Research Institute) complete sequence Length = 224778 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 394 aagtacatgtcatggtacat 413 |||||||||||||||||||| Sbjct: 129465 aagtacatgtcatggtacat 129446
>gb|AC090363.16| Homo sapiens chromosome 18, clone RP11-885J19, complete sequence Length = 152200 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 234 ctccctcctggcaatctttctttc 257 |||||||||| ||||||||||||| Sbjct: 50706 ctccctcctgccaatctttctttc 50683
>gb|AC103814.2| Homo sapiens chromosome 18, clone CTD-3111I19, complete sequence Length = 172461 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 234 ctccctcctggcaatctttctttc 257 |||||||||| ||||||||||||| Sbjct: 86218 ctccctcctgccaatctttctttc 86195 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,449,202 Number of Sequences: 3902068 Number of extensions: 5449202 Number of successful extensions: 113262 Number of sequences better than 10.0: 267 Number of HSP's better than 10.0 without gapping: 266 Number of HSP's successfully gapped in prelim test: 3 Number of HSP's that attempted gapping in prelim test: 112563 Number of HSP's gapped (non-prelim): 673 length of query: 557 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 534 effective length of database: 17,143,297,704 effective search space: 9154520973936 effective search space used: 9154520973936 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)