| Clone Name | rbaal21k03 |
|---|---|
| Clone Library Name | barley_pub |
>gb|BT009272.1| Triticum aestivum clone wlk8.pk0011.e10:fis, full insert mRNA sequence Length = 1878 Score = 250 bits (126), Expect = 1e-63 Identities = 157/167 (94%), Gaps = 1/167 (0%) Strand = Plus / Minus Query: 14 cgaaacatcttacagtatgtgcctgcantaagaaactattgacaaagttcccatattctg 73 |||| |||||||||||||||||||||| ||||||||||| |||||||||||||||||||| Sbjct: 1780 cgaagcatcttacagtatgtgcctgcaataagaaactatcgacaaagttcccatattctg 1721 Query: 74 taaaatgcttggattccttttacataanatggcgcttcatcatggatctattgnttacat 133 |||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| Sbjct: 1720 taaaatgcttggattccttttacatatggtggcgcttcatcatggatctattgtttacat 1661 Query: 134 ggacttgtcctcagctgtgcttcctgtttgctttc-ttgctgttgaa 179 ||||||||||||||||||||||| ||||||||| | ||||||||||| Sbjct: 1660 ggacttgtcctcagctgtgcttcttgtttgcttcctttgctgttgaa 1614
>ref|XM_469653.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2052 Score = 44.1 bits (22), Expect = 0.14 Identities = 55/65 (84%), Gaps = 1/65 (1%) Strand = Plus / Minus Query: 17 aacatcttacagtatgtgcctgcantaagaaactattgacaaagttcccatattctgtaa 76 |||||||||||||| ||| || | |||||| |||||||||||||| ||| | |||||| Sbjct: 1876 aacatcttacagtaggtgtctacgataagaa-ctattgacaaagtttccacacgctgtaa 1818 Query: 77 aatgc 81 ||||| Sbjct: 1817 aatgc 1813
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 44.1 bits (22), Expect = 0.14 Identities = 55/65 (84%), Gaps = 1/65 (1%) Strand = Plus / Minus Query: 17 aacatcttacagtatgtgcctgcantaagaaactattgacaaagttcccatattctgtaa 76 |||||||||||||| ||| || | |||||| |||||||||||||| ||| | |||||| Sbjct: 30011757 aacatcttacagtaggtgtctacgataagaa-ctattgacaaagtttccacacgctgtaa 30011699 Query: 77 aatgc 81 ||||| Sbjct: 30011698 aatgc 30011694
>gb|AC117988.3| Oryza sativa chromosome 3 BAC OSJNBa0057G07 genomic sequence, complete sequence Length = 155106 Score = 44.1 bits (22), Expect = 0.14 Identities = 55/65 (84%), Gaps = 1/65 (1%) Strand = Plus / Plus Query: 17 aacatcttacagtatgtgcctgcantaagaaactattgacaaagttcccatattctgtaa 76 |||||||||||||| ||| || | |||||| |||||||||||||| ||| | |||||| Sbjct: 95994 aacatcttacagtaggtgtctacgataagaa-ctattgacaaagtttccacacgctgtaa 96052 Query: 77 aatgc 81 ||||| Sbjct: 96053 aatgc 96057
>dbj|AK061913.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-042-A08, full insert sequence Length = 1402 Score = 44.1 bits (22), Expect = 0.14 Identities = 55/65 (84%), Gaps = 1/65 (1%) Strand = Plus / Minus Query: 17 aacatcttacagtatgtgcctgcantaagaaactattgacaaagttcccatattctgtaa 76 |||||||||||||| ||| || | |||||| |||||||||||||| ||| | |||||| Sbjct: 1329 aacatcttacagtaggtgtctacgataagaa-ctattgacaaagtttccacacgctgtaa 1271 Query: 77 aatgc 81 ||||| Sbjct: 1270 aatgc 1266
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 44.1 bits (22), Expect = 0.14 Identities = 55/65 (84%), Gaps = 1/65 (1%) Strand = Plus / Minus Query: 17 aacatcttacagtatgtgcctgcantaagaaactattgacaaagttcccatattctgtaa 76 |||||||||||||| ||| || | |||||| |||||||||||||| ||| | |||||| Sbjct: 30103179 aacatcttacagtaggtgtctacgataagaa-ctattgacaaagtttccacacgctgtaa 30103121 Query: 77 aatgc 81 ||||| Sbjct: 30103120 aatgc 30103116
>dbj|AK119226.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-100-H12, full insert sequence Length = 1923 Score = 44.1 bits (22), Expect = 0.14 Identities = 55/65 (84%), Gaps = 1/65 (1%) Strand = Plus / Minus Query: 17 aacatcttacagtatgtgcctgcantaagaaactattgacaaagttcccatattctgtaa 76 |||||||||||||| ||| || | |||||| |||||||||||||| ||| | |||||| Sbjct: 1799 aacatcttacagtaggtgtctacgataagaa-ctattgacaaagtttccacacgctgtaa 1741 Query: 77 aatgc 81 ||||| Sbjct: 1740 aatgc 1736
>dbj|AK100404.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086P20, full insert sequence Length = 1976 Score = 44.1 bits (22), Expect = 0.14 Identities = 55/65 (84%), Gaps = 1/65 (1%) Strand = Plus / Minus Query: 17 aacatcttacagtatgtgcctgcantaagaaactattgacaaagttcccatattctgtaa 76 |||||||||||||| ||| || | |||||| |||||||||||||| ||| | |||||| Sbjct: 1800 aacatcttacagtaggtgtctacgataagaa-ctattgacaaagtttccacacgctgtaa 1742 Query: 77 aatgc 81 ||||| Sbjct: 1741 aatgc 1737
>dbj|AK060674.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-029-A01, full insert sequence Length = 1844 Score = 44.1 bits (22), Expect = 0.14 Identities = 55/65 (84%), Gaps = 1/65 (1%) Strand = Plus / Minus Query: 17 aacatcttacagtatgtgcctgcantaagaaactattgacaaagttcccatattctgtaa 76 |||||||||||||| ||| || | |||||| |||||||||||||| ||| | |||||| Sbjct: 1792 aacatcttacagtaggtgtctacgataagaa-ctattgacaaagtttccacacgctgtaa 1734 Query: 77 aatgc 81 ||||| Sbjct: 1733 aatgc 1729
>gb|AC153959.3| Mus musculus 10 BAC RP24-511J14 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 165278 Score = 44.1 bits (22), Expect = 0.14 Identities = 22/22 (100%) Strand = Plus / Minus Query: 153 cttcctgtttgctttcttgctg 174 |||||||||||||||||||||| Sbjct: 66092 cttcctgtttgctttcttgctg 66071
>gb|AC129331.4| Mus musculus BAC clone RP23-75C8 from chromosome 8, complete sequence Length = 257765 Score = 40.1 bits (20), Expect = 2.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 154 ttcctgtttgctttcttgct 173 |||||||||||||||||||| Sbjct: 64801 ttcctgtttgctttcttgct 64782
>emb|AL138885.21| Human DNA sequence from clone RP1-290I10 on chromosome 6 Contains a ribosomal protein L7 (RPL7) pseudogene, the TFAP2A gene for transcription factor AP-2 alpha (activating enhancer-binding protein 2 alpha), four novel genes, a mitochondrial ribosomal protein L47 (MRPL47) pseudogene and 11 CpG islands, complete sequence Length = 180133 Score = 40.1 bits (20), Expect = 2.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 141 tcctcagctgtgcttcctgt 160 |||||||||||||||||||| Sbjct: 132811 tcctcagctgtgcttcctgt 132792
>gb|AC009294.8|AC009294 Homo sapiens chromosome 11, clone 579_H_17, complete sequence Length = 211316 Score = 40.1 bits (20), Expect = 2.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 43 aagaaactattgacaaagtt 62 |||||||||||||||||||| Sbjct: 122669 aagaaactattgacaaagtt 122650
>dbj|AP003460.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-285P16, complete sequence Length = 171738 Score = 40.1 bits (20), Expect = 2.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 43 aagaaactattgacaaagtt 62 |||||||||||||||||||| Sbjct: 164989 aagaaactattgacaaagtt 165008
>gb|AC122315.5| Mus musculus BAC clone RP23-302P6 from 10, complete sequence Length = 197288 Score = 40.1 bits (20), Expect = 2.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 151 tgcttcctgtttgctttctt 170 |||||||||||||||||||| Sbjct: 76527 tgcttcctgtttgctttctt 76508
>gb|AC158779.4| Mus musculus chromosome 15, clone RP23-258P17, complete sequence Length = 203163 Score = 38.2 bits (19), Expect = 8.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 16 aaacatcttacagtatgtg 34 ||||||||||||||||||| Sbjct: 176503 aaacatcttacagtatgtg 176521
>ref|XM_419526.1| PREDICTED: Gallus gallus similar to Protein kinase C, nu type (nPKC-nu) (Protein kinase EPK2) (LOC421478), mRNA Length = 3638 Score = 38.2 bits (19), Expect = 8.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 144 tcagctgtgcttcctgttt 162 ||||||||||||||||||| Sbjct: 312 tcagctgtgcttcctgttt 330
>gb|AC149237.1| Pan troglodytes chromosome X clone RP43-049A09 map human ortholog q28, complete sequence Length = 168371 Score = 38.2 bits (19), Expect = 8.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 65 catattctgtaaaatgctt 83 ||||||||||||||||||| Sbjct: 141732 catattctgtaaaatgctt 141714
>gb|AC149235.1| Pan troglodytes chromosome X clone PTB-100E10 map human ortholog q28, complete sequence Length = 183411 Score = 38.2 bits (19), Expect = 8.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 65 catattctgtaaaatgctt 83 ||||||||||||||||||| Sbjct: 50844 catattctgtaaaatgctt 50826
>gb|AY146817.1| Zea mays subsp. mays cultivar W153R starch debranching enzyme (su1) gene, partial sequence Length = 10865 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 153 cttcctgtttgctttcttgctgt 175 |||||||||||||||| |||||| Sbjct: 2230 cttcctgtttgctttcatgctgt 2252
>gb|AY146816.1| Zea mays subsp. mays cultivar Tx601 starch debranching enzyme (su1) gene, partial sequence Length = 10853 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 153 cttcctgtttgctttcttgctgt 175 |||||||||||||||| |||||| Sbjct: 2219 cttcctgtttgctttcatgctgt 2241
>gb|AY146815.1| Zea mays subsp. mays cultivar N28Ht starch debranching enzyme (su1) gene, partial sequence Length = 10854 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 153 cttcctgtttgctttcttgctgt 175 |||||||||||||||| |||||| Sbjct: 2222 cttcctgtttgctttcatgctgt 2244
>gb|AY146814.1| Zea mays subsp. mays cultivar CI187-2 starch debranching enzyme (su1) gene, partial sequence Length = 10854 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 153 cttcctgtttgctttcttgctgt 175 |||||||||||||||| |||||| Sbjct: 2222 cttcctgtttgctttcatgctgt 2244
>gb|AY146813.1| Zea mays subsp. mays cultivar M162W starch debranching enzyme (su1) gene, partial sequence Length = 10856 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 153 cttcctgtttgctttcttgctgt 175 |||||||||||||||| |||||| Sbjct: 2220 cttcctgtttgctttcatgctgt 2242
>gb|AY146812.1| Zea mays subsp. mays cultivar T232 starch debranching enzyme (su1) gene, partial sequence Length = 10733 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 153 cttcctgtttgctttcttgctgt 175 |||||||||||||||| |||||| Sbjct: 2106 cttcctgtttgctttcatgctgt 2128
>gb|AY146811.1| Zea mays subsp. mays cultivar P39 starch debranching enzyme (su1) gene, partial sequence Length = 10835 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 153 cttcctgtttgctttcttgctgt 175 |||||||||||||||| |||||| Sbjct: 2207 cttcctgtttgctttcatgctgt 2229
>gb|AY146810.1| Zea mays subsp. mays cultivar IA2132 starch debranching enzyme (su1) gene, partial sequence Length = 10851 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 153 cttcctgtttgctttcttgctgt 175 |||||||||||||||| |||||| Sbjct: 2223 cttcctgtttgctttcatgctgt 2245
>gb|AY146809.1| Zea mays subsp. mays cultivar IL101 starch debranching enzyme (su1) gene, partial sequence Length = 10711 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 153 cttcctgtttgctttcttgctgt 175 |||||||||||||||| |||||| Sbjct: 2083 cttcctgtttgctttcatgctgt 2105
>gb|AY146808.1| Zea mays subsp. mays cultivar I205 starch debranching enzyme (su1) gene, partial sequence Length = 10817 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 153 cttcctgtttgctttcttgctgt 175 |||||||||||||||| |||||| Sbjct: 2189 cttcctgtttgctttcatgctgt 2211
>gb|AY146807.1| Zea mays subsp. mays cultivar IDS28 starch debranching enzyme (su1) gene, partial sequence Length = 10753 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 153 cttcctgtttgctttcttgctgt 175 |||||||||||||||| |||||| Sbjct: 2127 cttcctgtttgctttcatgctgt 2149
>gb|AY146806.1| Zea mays subsp. mays cultivar F2 starch debranching enzyme (su1) gene, partial sequence Length = 10856 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 153 cttcctgtttgctttcttgctgt 175 |||||||||||||||| |||||| Sbjct: 2220 cttcctgtttgctttcatgctgt 2242
>gb|AY146805.1| Zea mays subsp. mays cultivar NC348 starch debranching enzyme (su1) gene, partial sequence Length = 10858 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 153 cttcctgtttgctttcttgctgt 175 |||||||||||||||| |||||| Sbjct: 2222 cttcctgtttgctttcatgctgt 2244
>gb|AY146804.1| Zea mays subsp. mays cultivar Pa91 starch debranching enzyme (su1) gene, partial sequence Length = 10858 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 153 cttcctgtttgctttcttgctgt 175 |||||||||||||||| |||||| Sbjct: 2222 cttcctgtttgctttcatgctgt 2244
>gb|AY146803.1| Zea mays subsp. mays cultivar NC260 starch debranching enzyme (su1) gene, partial sequence Length = 10858 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 153 cttcctgtttgctttcttgctgt 175 |||||||||||||||| |||||| Sbjct: 2222 cttcctgtttgctttcatgctgt 2244
>gb|AY146802.1| Zea mays subsp. mays cultivar Ky21 starch debranching enzyme (su1) gene, partial sequence Length = 10858 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 153 cttcctgtttgctttcttgctgt 175 |||||||||||||||| |||||| Sbjct: 2222 cttcctgtttgctttcatgctgt 2244
>gb|AY146801.1| Zea mays subsp. mays cultivar D940Y starch debranching enzyme (su1) gene, partial sequence Length = 10858 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 153 cttcctgtttgctttcttgctgt 175 |||||||||||||||| |||||| Sbjct: 2222 cttcctgtttgctttcatgctgt 2244
>gb|AY146800.1| Zea mays subsp. mays cultivar CML258 starch debranching enzyme (su1) gene, partial sequence Length = 10855 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 153 cttcctgtttgctttcttgctgt 175 |||||||||||||||| |||||| Sbjct: 2220 cttcctgtttgctttcatgctgt 2242
>gb|AY146799.1| Zea mays subsp. mays cultivar Oh43 starch debranching enzyme (su1) gene, partial sequence Length = 10858 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 153 cttcctgtttgctttcttgctgt 175 |||||||||||||||| |||||| Sbjct: 2222 cttcctgtttgctttcatgctgt 2244
>gb|AY146798.1| Zea mays subsp. mays cultivar Mo17 starch debranching enzyme (su1) gene, partial sequence Length = 10854 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 153 cttcctgtttgctttcttgctgt 175 |||||||||||||||| |||||| Sbjct: 2222 cttcctgtttgctttcatgctgt 2244
>gb|AY146797.1| Zea mays subsp. mays cultivar KI21 starch debranching enzyme (su1) gene, partial sequence Length = 10856 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 153 cttcctgtttgctttcttgctgt 175 |||||||||||||||| |||||| Sbjct: 2220 cttcctgtttgctttcatgctgt 2242
>gb|AY146796.1| Zea mays subsp. mays cultivar KI9 starch debranching enzyme (su1) gene, partial sequence Length = 10839 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 153 cttcctgtttgctttcttgctgt 175 |||||||||||||||| |||||| Sbjct: 2203 cttcctgtttgctttcatgctgt 2225
>gb|AY146795.1| Zea mays subsp. mays cultivar EP1 starch debranching enzyme (su1) gene, partial sequence Length = 10858 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 153 cttcctgtttgctttcttgctgt 175 |||||||||||||||| |||||| Sbjct: 2222 cttcctgtttgctttcatgctgt 2244
>gb|AY146794.1| Zea mays subsp. mays cultivar CML333 starch debranching enzyme (su1) gene, partial sequence Length = 10858 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 153 cttcctgtttgctttcttgctgt 175 |||||||||||||||| |||||| Sbjct: 2222 cttcctgtttgctttcatgctgt 2244
>gb|AY146793.1| Zea mays subsp. mays cultivar CML254 starch debranching enzyme (su1) gene, partial sequence Length = 10858 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 153 cttcctgtttgctttcttgctgt 175 |||||||||||||||| |||||| Sbjct: 2222 cttcctgtttgctttcatgctgt 2244
>gb|AY146792.1| Zea mays subsp. mays cultivar B97 starch debranching enzyme (su1) gene, partial sequence Length = 10858 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 153 cttcctgtttgctttcttgctgt 175 |||||||||||||||| |||||| Sbjct: 2222 cttcctgtttgctttcatgctgt 2244
>gb|AY146791.1| Zea mays subsp. mays cultivar B73 starch debranching enzyme (su1) gene, partial sequence Length = 10856 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 153 cttcctgtttgctttcttgctgt 175 |||||||||||||||| |||||| Sbjct: 2220 cttcctgtttgctttcatgctgt 2242
>gb|AY146790.1| Zea mays subsp. mays cultivar B37 starch debranching enzyme (su1) gene, partial sequence Length = 10858 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 153 cttcctgtttgctttcttgctgt 175 |||||||||||||||| |||||| Sbjct: 2222 cttcctgtttgctttcatgctgt 2244
>gb|AY146789.1| Zea mays subsp. mays cultivar B14A starch debranching enzyme (su1) gene, partial sequence Length = 10858 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 153 cttcctgtttgctttcttgctgt 175 |||||||||||||||| |||||| Sbjct: 2222 cttcctgtttgctttcatgctgt 2244
>gb|AY146788.1| Zea mays subsp. mays cultivar B103 starch debranching enzyme (su1) gene, partial sequence Length = 10858 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 153 cttcctgtttgctttcttgctgt 175 |||||||||||||||| |||||| Sbjct: 2222 cttcctgtttgctttcatgctgt 2244
>gb|AY146787.1| Zea mays subsp. mays cultivar A6 starch debranching enzyme (su1) gene, partial sequence Length = 10858 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 153 cttcctgtttgctttcttgctgt 175 |||||||||||||||| |||||| Sbjct: 2222 cttcctgtttgctttcatgctgt 2244
>gb|AY146786.1| Zea mays subsp. mays cultivar A272 starch debranching enzyme (su1) gene, partial sequence Length = 10858 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 153 cttcctgtttgctttcttgctgt 175 |||||||||||||||| |||||| Sbjct: 2222 cttcctgtttgctttcatgctgt 2244
>ref|XM_752632.1| Ustilago maydis 521 hypothetical protein (UM01578.1) partial mRNA Length = 2190 Score = 38.2 bits (19), Expect = 8.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 155 tcctgtttgctttcttgct 173 ||||||||||||||||||| Sbjct: 887 tcctgtttgctttcttgct 869
>ref|XM_540878.2| PREDICTED: Canis familiaris similar to CDC42 binding protein kinase gamma (DMPK-like) (LOC483757), mRNA Length = 4644 Score = 38.2 bits (19), Expect = 8.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 141 tcctcagctgtgcttcctg 159 ||||||||||||||||||| Sbjct: 1819 tcctcagctgtgcttcctg 1801
>gb|AC127341.3| Mus musculus BAC clone RP23-189L19 from chromosome 17, complete sequence Length = 213609 Score = 38.2 bits (19), Expect = 8.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 141 tcctcagctgtgcttcctg 159 ||||||||||||||||||| Sbjct: 105828 tcctcagctgtgcttcctg 105810
>gb|AC124536.4| Mus musculus BAC clone RP23-332H4 from chromosome 3, complete sequence Length = 165047 Score = 38.2 bits (19), Expect = 8.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 155 tcctgtttgctttcttgct 173 ||||||||||||||||||| Sbjct: 109035 tcctgtttgctttcttgct 109017
>gb|AC131749.2| Mus musculus BAC clone RP23-26G8 from 9, complete sequence Length = 234280 Score = 38.2 bits (19), Expect = 8.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 157 ctgtttgctttcttgctgt 175 ||||||||||||||||||| Sbjct: 126395 ctgtttgctttcttgctgt 126413
>gb|AC102092.7| Mus musculus chromosome 3, clone RP23-20B1, complete sequence Length = 234874 Score = 38.2 bits (19), Expect = 8.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 155 tcctgtttgctttcttgct 173 ||||||||||||||||||| Sbjct: 5256 tcctgtttgctttcttgct 5274
>emb|AL844892.5| Human DNA sequence from clone RP11-396M20 on chromosome 10 Contains the 5' end of the GRID1 gene for glutamate receptor (ionotropic) delta 1, the 3' end of the gene for friend of EBNA2 (FOE) (KIAA0261) and five CpG islands, complete sequence Length = 167780 Score = 38.2 bits (19), Expect = 8.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 134 ggacttgtcctcagctgtg 152 ||||||||||||||||||| Sbjct: 80958 ggacttgtcctcagctgtg 80940
>emb|AL158032.32| Human DNA sequence from clone RP11-101P17 on chromosome 13 Contains the SAP18 gene for sin3-associated polypeptide, 18kD (SAP18p), six novel genes, the 3'end of a novel gene, an estrogen-related receptor alpha (ESRRA) pseudogene, a pseudogene similar to part of mitochondrial intermediate peptidase (MIPEP) and five CpG islands, complete sequence Length = 172004 Score = 38.2 bits (19), Expect = 8.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 160 tttgctttcttgctgttga 178 ||||||||||||||||||| Sbjct: 76069 tttgctttcttgctgttga 76051
>emb|AL136968.14| Human DNA sequence from clone RP1-182O16 on chromosome 6 Contains the 5' end of a novel protein, a ribosomal protein L34 pseudogene, a glyceraldehyde 3-phosphate dehydrogenase (GAPDH) pseudogene and a CpG island, complete sequence Length = 70541 Score = 38.2 bits (19), Expect = 8.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 160 tttgctttcttgctgttga 178 ||||||||||||||||||| Sbjct: 7431 tttgctttcttgctgttga 7449
>emb|AL121978.5|HSJ520B18 Human DNA sequence from clone RP3-520B18 on chromosome 6p24.1-25.3 Contains the 5' end of the gene for phenylalanine-tRNA synthetase (FARS1), a microtubule-associated protein 1A/1B light chain 3 pseudogene and a CpG island, complete sequence Length = 148385 Score = 38.2 bits (19), Expect = 8.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 160 tttgctttcttgctgttga 178 ||||||||||||||||||| Sbjct: 137730 tttgctttcttgctgttga 137748
>emb|CR626927.1| Bacteroides fragilis NCTC 9343, complete genome Length = 5205140 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Minus Query: 148 ctgtgcttcctgtttgctttctt 170 |||||||| |||||||||||||| Sbjct: 4977456 ctgtgcttgctgtttgctttctt 4977434
>emb|AL806524.10| Mouse DNA sequence from clone RP23-158E10 on chromosome 4, complete sequence Length = 211513 Score = 38.2 bits (19), Expect = 8.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 154 ttcctgtttgctttcttgc 172 ||||||||||||||||||| Sbjct: 48912 ttcctgtttgctttcttgc 48894
>gb|AC101690.7| Mus musculus chromosome 7, clone RP23-218E6, complete sequence Length = 229964 Score = 38.2 bits (19), Expect = 8.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 54 gacaaagttcccatattct 72 ||||||||||||||||||| Sbjct: 153422 gacaaagttcccatattct 153440
>gb|AC090701.5| Homo sapiens chromosome 18, clone RP11-810M21, complete sequence Length = 188779 Score = 38.2 bits (19), Expect = 8.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 66 atattctgtaaaatgcttg 84 ||||||||||||||||||| Sbjct: 156582 atattctgtaaaatgcttg 156564
>gb|AC073544.4| Homo sapiens chromosome 19 clone RP11-359H18, complete sequence Length = 177299 Score = 38.2 bits (19), Expect = 8.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 43 aagaaactattgacaaagt 61 ||||||||||||||||||| Sbjct: 152007 aagaaactattgacaaagt 151989
>gb|AC099500.2| Homo sapiens chromosome 19 clone RP11-209J6, complete sequence Length = 138627 Score = 38.2 bits (19), Expect = 8.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 43 aagaaactattgacaaagt 61 ||||||||||||||||||| Sbjct: 36653 aagaaactattgacaaagt 36635
>gb|AC109482.3| Homo sapiens chromosome 5 clone RP11-492A10, complete sequence Length = 101941 Score = 38.2 bits (19), Expect = 8.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 43 aagaaactattgacaaagt 61 ||||||||||||||||||| Sbjct: 70801 aagaaactattgacaaagt 70819
>gb|AC091108.5| Homo sapiens chromosome 18, clone RP11-765H19, complete sequence Length = 164790 Score = 38.2 bits (19), Expect = 8.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 66 atattctgtaaaatgcttg 84 ||||||||||||||||||| Sbjct: 16211 atattctgtaaaatgcttg 16193
>gb|AC159195.2| Mus musculus BAC clone RP23-467E1 from chromosome 13, complete sequence Length = 194915 Score = 38.2 bits (19), Expect = 8.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 153 cttcctgtttgctttcttg 171 ||||||||||||||||||| Sbjct: 49997 cttcctgtttgctttcttg 50015
>dbj|AP001732.1| Homo sapiens genomic DNA, chromosome 21q, section 76/105 Length = 340000 Score = 38.2 bits (19), Expect = 8.8 Identities = 29/31 (93%), Gaps = 1/31 (3%) Strand = Plus / Minus Query: 150 gtgcttcctgtttgctttct-tgctgttgaa 179 |||| ||||||||||||||| |||||||||| Sbjct: 119814 gtgcctcctgtttgctttctctgctgttgaa 119784
>gb|AC017071.9| Homo sapiens BAC clone RP11-410E4 from 2, complete sequence Length = 163456 Score = 38.2 bits (19), Expect = 8.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 43 aagaaactattgacaaagt 61 ||||||||||||||||||| Sbjct: 154093 aagaaactattgacaaagt 154111
>gb|AC005731.2| Human X BAC RP11-159I8 (Roswell Park Cancer Institute Human BAC Library), Cosmid LL0XNC01-3C3 (LLNL X Chromosome Library), and BAC GS1-92B2 (Genome Systems Human BAC Library) complete sequence Length = 143944 Score = 38.2 bits (19), Expect = 8.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 65 catattctgtaaaatgctt 83 ||||||||||||||||||| Sbjct: 82621 catattctgtaaaatgctt 82603
>gb|AC138126.1| Homo sapiens chromosome 19 clone RP11-274A19, complete sequence Length = 169063 Score = 38.2 bits (19), Expect = 8.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 43 aagaaactattgacaaagt 61 ||||||||||||||||||| Sbjct: 68401 aagaaactattgacaaagt 68383
>gb|AC007954.7|AC007954 Homo sapiens chromosome 14 clone RP11-493G17 and CTD-2516D11 map 14q24.3, complete sequence Length = 210204 Score = 38.2 bits (19), Expect = 8.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 42 taagaaactattgacaaag 60 ||||||||||||||||||| Sbjct: 96179 taagaaactattgacaaag 96197
>dbj|AP006841.1| Bacteroides fragilis YCH46 DNA, complete genome Length = 5277274 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Minus Query: 148 ctgtgcttcctgtttgctttctt 170 |||||||| |||||||||||||| Sbjct: 5044525 ctgtgcttgctgtttgctttctt 5044503
>emb|AL954221.1| Pan troglodytes chromosome 22 clone RP43-105F23 map q21.2, complete sequence Length = 169077 Score = 38.2 bits (19), Expect = 8.8 Identities = 29/31 (93%), Gaps = 1/31 (3%) Strand = Plus / Minus Query: 150 gtgcttcctgtttgctttct-tgctgttgaa 179 |||| ||||||||||||||| |||||||||| Sbjct: 63411 gtgcctcctgtttgctttctctgctgttgaa 63381
>emb|AL954220.1| Pan troglodytes chromosome 22 clone PTB-091C04 map q21.2, complete sequence Length = 241304 Score = 38.2 bits (19), Expect = 8.8 Identities = 29/31 (93%), Gaps = 1/31 (3%) Strand = Plus / Minus Query: 150 gtgcttcctgtttgctttct-tgctgttgaa 179 |||| ||||||||||||||| |||||||||| Sbjct: 64835 gtgcctcctgtttgctttctctgctgttgaa 64805
>gb|AC007631.3|AC007631 Genomic sequence of Homo sapiens clone R145D03A from chromosome 18, complete sequence Length = 146596 Score = 38.2 bits (19), Expect = 8.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 66 atattctgtaaaatgcttg 84 ||||||||||||||||||| Sbjct: 9297 atattctgtaaaatgcttg 9315
>gb|AC099722.7| Mus musculus chromosome 3, clone RP23-282E13, complete sequence Length = 233425 Score = 38.2 bits (19), Expect = 8.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 155 tcctgtttgctttcttgct 173 ||||||||||||||||||| Sbjct: 3978 tcctgtttgctttcttgct 3960
>gb|AC117767.13| Mus musculus chromosome 1, clone RP24-507O16, complete sequence Length = 192892 Score = 38.2 bits (19), Expect = 8.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 160 tttgctttcttgctgttga 178 ||||||||||||||||||| Sbjct: 125677 tttgctttcttgctgttga 125695
>gb|AF030882.1|AF030882 Zea mays SU1 isoamylase (sugary1) gene, complete cds Length = 11779 Score = 38.2 bits (19), Expect = 8.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 153 cttcctgtttgctttcttgctgt 175 |||||||||||||||| |||||| Sbjct: 3011 cttcctgtttgctttcatgctgt 3033
>gb|AC101841.5| Mus musculus chromosome 1, clone RP23-251G19, complete sequence Length = 174900 Score = 38.2 bits (19), Expect = 8.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 50 tattgacaaagttcccata 68 ||||||||||||||||||| Sbjct: 118463 tattgacaaagttcccata 118445
>emb|AL583887.9| Mouse DNA sequence from clone RP23-121M7 on chromosome 15, complete sequence Length = 220050 Score = 38.2 bits (19), Expect = 8.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 155 tcctgtttgctttcttgct 173 ||||||||||||||||||| Sbjct: 116429 tcctgtttgctttcttgct 116447
>dbj|AB009074.1| Triakis scyllium mRNA for mannose-binding lectin-associated serine protease, complete cds Length = 2407 Score = 38.2 bits (19), Expect = 8.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 16 aaacatcttacagtatgtg 34 ||||||||||||||||||| Sbjct: 1889 aaacatcttacagtatgtg 1907
>dbj|AP001037.1| Homo sapiens genomic DNA, chromosome 21, clone:KB2042G5, ERG-ETS2 region, complete sequence Length = 165644 Score = 38.2 bits (19), Expect = 8.8 Identities = 29/31 (93%), Gaps = 1/31 (3%) Strand = Plus / Minus Query: 150 gtgcttcctgtttgctttct-tgctgttgaa 179 |||| ||||||||||||||| |||||||||| Sbjct: 106695 gtgcctcctgtttgctttctctgctgttgaa 106665 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,575,877 Number of Sequences: 3902068 Number of extensions: 1575877 Number of successful extensions: 111451 Number of sequences better than 10.0: 86 Number of HSP's better than 10.0 without gapping: 82 Number of HSP's successfully gapped in prelim test: 4 Number of HSP's that attempted gapping in prelim test: 111236 Number of HSP's gapped (non-prelim): 211 length of query: 179 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 157 effective length of database: 17,147,199,772 effective search space: 2692110364204 effective search space used: 2692110364204 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)