ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal20o01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC066608.6| Homo sapiens chromosome 3 clone RP11-785A7 map 3p... 40 1.8
2gb|AE017340.1| Idiomarina loihiensis L2TR, complete genome 40 1.8
3gb|AC087094.3| Homo sapiens chromosome 3 clone RP11-94M9 map 3p,... 40 1.8
4gb|CP000117.1| Anabaena variabilis ATCC 29413 chromosome, comple... 38 7.0
5emb|CR388015.14| Zebrafish DNA sequence from clone DKEY-246L21 i... 38 7.0
6emb|CR536614.5| Zebrafish DNA sequence from clone CH211-154E6 in... 38 7.0
7gb|AC148348.6| Medicago truncatula clone mth2-28b4, complete seq... 38 7.0
8gb|AC124172.4| Mus musculus BAC clone RP23-168P24 from chromosom... 38 7.0
9gb|AC005042.2| Homo sapiens BAC clone RP11-552E1 from 2, complet... 38 7.0
10dbj|AB194066.1| Ipomoea nil InNHX2 gene for sodium proton antipo... 38 7.0
11gb|AC079374.4|AC079374 Arabidopsis thaliana chromosome 1 BAC F4F... 38 7.0
12emb|BX649446.6| Zebrafish DNA sequence from clone DKEY-247M22 in... 38 7.0
13emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB1... 38 7.0
14dbj|AP006101.1| Lotus japonicus genomic DNA, chromosome 1, clone... 38 7.0
15dbj|AP004955.1| Lotus japonicus genomic DNA, chromosome 1, clone... 38 7.0
16emb|AL844581.7| Mouse DNA sequence from clone RP23-146O7 on chro... 38 7.0

>gb|AC066608.6| Homo sapiens chromosome 3 clone RP11-785A7 map 3p, complete
           sequence
          Length = 172811

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 39  attttcaacccaggtgatatgatt 62
           ||||||||||||| ||||||||||
Sbjct: 162 attttcaacccagttgatatgatt 139



to top

>gb|AE017340.1| Idiomarina loihiensis L2TR, complete genome
          Length = 2839318

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 116     aactaaccttagtcgaccct 135
               ||||||||||||||||||||
Sbjct: 2184682 aactaaccttagtcgaccct 2184663



to top

>gb|AC087094.3| Homo sapiens chromosome 3 clone RP11-94M9 map 3p, complete sequence
          Length = 170876

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 39    attttcaacccaggtgatatgatt 62
             ||||||||||||| ||||||||||
Sbjct: 58586 attttcaacccagttgatatgatt 58609



to top

>gb|CP000117.1| Anabaena variabilis ATCC 29413 chromosome, complete sequence
          Length = 6365727

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 81      aaatggcgtatagtgtatt 99
               |||||||||||||||||||
Sbjct: 2913870 aaatggcgtatagtgtatt 2913852



to top

>emb|CR388015.14| Zebrafish DNA sequence from clone DKEY-246L21 in linkage group 24,
             complete sequence
          Length = 140648

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 40    ttttcaacccaggtgatat 58
             |||||||||||||||||||
Sbjct: 56915 ttttcaacccaggtgatat 56897



to top

>emb|CR536614.5| Zebrafish DNA sequence from clone CH211-154E6 in linkage group 17,
              complete sequence
          Length = 155951

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 14     tacactagtctcacgatta 32
              |||||||||||||||||||
Sbjct: 140224 tacactagtctcacgatta 140242



to top

>gb|AC148348.6| Medicago truncatula clone mth2-28b4, complete sequence
          Length = 118633

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 99    ttctcactatgaaagagaa 117
             |||||||||||||||||||
Sbjct: 80916 ttctcactatgaaagagaa 80898



to top

>gb|AC124172.4| Mus musculus BAC clone RP23-168P24 from chromosome 1, complete sequence
          Length = 192946

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 25     cacgattaaacaaaattttcaac 47
              |||||||||||||||| ||||||
Sbjct: 114939 cacgattaaacaaaatgttcaac 114961



to top

>gb|AC005042.2| Homo sapiens BAC clone RP11-552E1 from 2, complete sequence
          Length = 192219

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 38    aattttcaacccaggtgat 56
             |||||||||||||||||||
Sbjct: 69530 aattttcaacccaggtgat 69548



to top

>dbj|AB194066.1| Ipomoea nil InNHX2 gene for sodium proton antiporter, complete cds
          Length = 11061

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 29   attaaacaaaattttcaac 47
            |||||||||||||||||||
Sbjct: 4727 attaaacaaaattttcaac 4709



to top

>gb|AC079374.4|AC079374 Arabidopsis thaliana chromosome 1 BAC F4F7 genomic sequence, complete
             sequence
          Length = 89690

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 28    gattaaacaaaattttcaa 46
             |||||||||||||||||||
Sbjct: 43315 gattaaacaaaattttcaa 43297



to top

>emb|BX649446.6| Zebrafish DNA sequence from clone DKEY-247M22 in linkage group 4,
             complete sequence
          Length = 155024

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 13    atacactagtctcacgatt 31
             |||||||||||||||||||
Sbjct: 89561 atacactagtctcacgatt 89579



to top

>emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB122 of Yarrowia lipolytica
          Length = 3066374

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 25      cacgattaaacaaaatttt 43
               |||||||||||||||||||
Sbjct: 2685774 cacgattaaacaaaatttt 2685756



to top

>dbj|AP006101.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT09A07, TM0181,
             complete sequence
          Length = 185320

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 97    atttctcactatgaaagag 115
             |||||||||||||||||||
Sbjct: 50042 atttctcactatgaaagag 50024



to top

>dbj|AP004955.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT19K21, TM0132,
             complete sequence
          Length = 59303

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 97    atttctcactatgaaagag 115
             |||||||||||||||||||
Sbjct: 29522 atttctcactatgaaagag 29504



to top

>emb|AL844581.7| Mouse DNA sequence from clone RP23-146O7 on chromosome 2, complete
              sequence
          Length = 207639

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 94     tgtatttctcactatgaaa 112
              |||||||||||||||||||
Sbjct: 151548 tgtatttctcactatgaaa 151530


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,207,910
Number of Sequences: 3902068
Number of extensions: 1207910
Number of successful extensions: 91318
Number of sequences better than 10.0: 16
Number of HSP's better than 10.0 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 91259
Number of HSP's gapped (non-prelim): 59
length of query: 146
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 125
effective length of database: 17,151,101,840
effective search space: 2143887730000
effective search space used: 2143887730000
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top